The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011273	Planctomyces sp. SH-PL62, complete genome	6507102	3330099	3398609	6507102	tRNA,transposase,bacteriocin,integrase	Bacillus_virus(25.0%)	46	3329965:3329991	3333308:3333334
3329965:3329991	attL	CGATCAGCGCTTGGAGAACTGGAAGCT	NA	NA	NA	NA
WP_068415670.1|3330099_3331254_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_156512845.1|3331796_3332699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068415676.1|3333310_3333721_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
3333308:3333334	attR	CGATCAGCGCTTGGAGAACTGGAAGCT	NA	NA	NA	NA
WP_068415677.1|3333814_3334366_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_068415680.1|3334531_3337156_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	31.0	3.7e-52
WP_082858574.1|3337389_3337965_-	peroxidase-related enzyme	NA	NA	NA	NA	NA
WP_082858979.1|3338291_3339257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068415690.1|3339309_3340680_-	asparagine synthase	NA	NA	NA	NA	NA
WP_068415692.1|3340730_3341615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068415695.1|3341616_3343428_-	CRTAC1 family protein	NA	NA	NA	NA	NA
WP_068415698.1|3343447_3346912_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_082858980.1|3346908_3347661_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.1	3.0e-31
WP_156513151.1|3347747_3348545_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_068415704.1|3348847_3350047_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_068415707.1|3350185_3350419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068415710.1|3350467_3351877_-	amino acid permease	NA	NA	NA	NA	NA
WP_156512846.1|3353250_3353763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082858575.1|3354269_3354815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068415719.1|3357049_3358204_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_068415722.1|3358382_3359228_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.7	8.6e-19
WP_068415725.1|3359273_3359735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156512847.1|3360308_3361121_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_068415730.1|3361279_3362239_+	AAA domain-containing protein	NA	G3M9Z9	Bacillus_virus	44.6	1.1e-49
WP_156512848.1|3362990_3363155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068415737.1|3363534_3364227_-	response regulator	NA	NA	NA	NA	NA
WP_068415740.1|3364254_3366951_-	sensor histidine kinase KdpD	NA	NA	NA	NA	NA
WP_068415743.1|3366947_3367526_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_068421958.1|3367556_3369623_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.6	1.2e-26
WP_068415746.1|3369640_3371362_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_156512849.1|3371358_3371451_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_156512850.1|3372246_3373218_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	21.6	6.2e-05
WP_068415753.1|3375277_3375829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068415756.1|3376439_3377753_+	xylose isomerase	NA	NA	NA	NA	NA
WP_082858376.1|3377826_3378603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068411620.1|3378599_3379157_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082858577.1|3381268_3382525_-	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_068415762.1|3382582_3385522_-	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_082858578.1|3387809_3389522_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_068415765.1|3389817_3390465_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_082858579.1|3390433_3391960_-	hypothetical protein	NA	A0A1V0SGX0	Hokovirus	33.0	8.8e-06
WP_068415771.1|3392357_3392894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156512851.1|3393547_3395143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068415777.1|3395160_3396552_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_068415722.1|3396554_3397400_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.7	8.6e-19
WP_068415780.1|3397600_3397807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068415784.1|3398024_3398609_-|bacteriocin	bacteriocin-protection protein	bacteriocin	NA	NA	NA	NA
>prophage 2
NZ_CP011273	Planctomyces sp. SH-PL62, complete genome	6507102	4425845	4449760	6507102	transposase	Indivirus(50.0%)	15	NA	NA
WP_156512915.1|4425845_4426895_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_082858674.1|4427439_4428744_+	DUF4910 domain-containing protein	NA	NA	NA	NA	NA
WP_068417932.1|4429192_4429819_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082858675.1|4430253_4431609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068417940.1|4431918_4432098_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_082858676.1|4432741_4433551_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_156512916.1|4434921_4435233_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_156512917.1|4435209_4436259_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	22.2	1.6e-06
WP_082858678.1|4437170_4438319_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_082858679.1|4438315_4439512_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_156512918.1|4440910_4441087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156512919.1|4441288_4441693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068422209.1|4446498_4447092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068417975.1|4448245_4448905_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_068417979.1|4448956_4449760_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.2	2.2e-08
>prophage 3
NZ_CP011273	Planctomyces sp. SH-PL62, complete genome	6507102	5922916	6012376	6507102	transposase,terminase,protease,integrase	Erwinia_phage(14.29%)	56	5963075:5963118	5976726:5976769
WP_082858829.1|5922916_5925874_-|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_068420355.1|5926552_5927155_+	PEP-CTERM sorting domain-containing protein	NA	NA	NA	NA	NA
WP_068420356.1|5928462_5929245_+	hypothetical protein	NA	G0YQI6	Erwinia_phage	42.9	9.1e-07
WP_068420357.1|5930731_5931502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068420358.1|5931509_5932403_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_156513043.1|5932399_5934385_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_082858830.1|5935632_5936727_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_082858831.1|5937105_5938809_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.0	7.4e-54
WP_068422533.1|5938827_5939283_-	EamA family transporter	NA	NA	NA	NA	NA
WP_082858832.1|5939317_5940049_-	DUF190 domain-containing protein	NA	NA	NA	NA	NA
WP_082858833.1|5940045_5940525_-	CrcB family protein	NA	NA	NA	NA	NA
WP_068420360.1|5940604_5941261_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_068420361.1|5941507_5942551_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_156513044.1|5942722_5942929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068420362.1|5943664_5944711_-	DUF1559 domain-containing protein	NA	NA	NA	NA	NA
WP_156513045.1|5944794_5945004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068420364.1|5945587_5948527_-	DUF5060 domain-containing protein	NA	NA	NA	NA	NA
WP_068420365.1|5948568_5949678_-	agmatine deiminase family protein	NA	M1HES8	Acanthocystis_turfacea_Chlorella_virus	33.3	3.5e-52
WP_068422538.1|5949880_5950774_-	carbon-nitrogen hydrolase	NA	M1HAZ6	Paramecium_bursaria_Chlorella_virus	39.2	2.4e-48
WP_068420366.1|5951004_5951466_+	RidA family protein	NA	NA	NA	NA	NA
WP_068420367.1|5952338_5953115_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_156513046.1|5953118_5957066_-	hypothetical protein	NA	E5ESH9	Bathycoccus_sp._RCC1105_virus	23.8	3.8e-08
WP_068422541.1|5957408_5957972_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_068420369.1|5960173_5961589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068420370.1|5961640_5962075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068420371.1|5962046_5962955_-	glycosylase	NA	NA	NA	NA	NA
5963075:5963118	attL	TTCGCAATGCTGAGGTTGAGGGTTCGATCCCCTTCCGCTCCACT	NA	NA	NA	NA
WP_068420372.1|5963227_5964433_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_068420373.1|5964533_5965172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068420374.1|5965269_5965593_+	DUF1580 domain-containing protein	NA	NA	NA	NA	NA
WP_068420375.1|5965670_5966405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082858834.1|5966408_5968271_+	DNA polymerase I	NA	NA	NA	NA	NA
WP_156513047.1|5968505_5969438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156513048.1|5969519_5969912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068420378.1|5970037_5970343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068420379.1|5970511_5971357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082858835.1|5971804_5972824_+|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_068420387.1|5972862_5973234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068420389.1|5973470_5976503_+	N-6 DNA methylase	NA	Q8V6N5	Halorubrum_phage	31.4	1.7e-13
WP_068420391.1|5977124_5978300_-	ScyD/ScyE family protein	NA	NA	NA	NA	NA
5976726:5976769	attR	TTCGCAATGCTGAGGTTGAGGGTTCGATCCCCTTCCGCTCCACT	NA	NA	NA	NA
WP_068420394.1|5978818_5979112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068420396.1|5979536_5983697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068420399.1|5983861_5984560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082858836.1|5985064_5988304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068420405.1|5988300_5994675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068420406.1|5994671_5996549_+	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_068420407.1|5996557_5997886_+	RNA-dependent DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.3	7.6e-22
WP_068420408.1|5998069_5998600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068420409.1|5998789_5999215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068420411.1|5999248_6000580_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_068420413.1|6000760_6004054_+	DUF1553 domain-containing protein	NA	NA	NA	NA	NA
WP_068420415.1|6004064_6005534_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_156513049.1|6006019_6007174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156513050.1|6007874_6009236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068420432.1|6010040_6010478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068420434.1|6010639_6011443_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_068420436.1|6011689_6012376_-|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
