The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013344	Sphingopyxis macrogoltabida strain 203N chromosome, complete genome	5380888	156280	218248	5380888	capsid,transposase,head,tail,protease,tRNA,portal	Caulobacter_phage(15.79%)	61	NA	NA
WP_145923316.1|156280_157180_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054724054.1|157213_160804_+	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	24.0	3.2e-22
WP_054724055.1|161141_162965_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.0	4.7e-22
WP_054724058.1|163210_163492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054590010.1|163685_163985_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_054724060.1|163977_164370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082395361.1|164503_165649_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_054724069.1|165700_166138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054724071.1|166407_167097_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_082396171.1|167187_167499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082395362.1|167624_168188_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_054724076.1|168205_168907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054586486.1|169045_169303_+	DUF2171 domain-containing protein	NA	NA	NA	NA	NA
WP_145923317.1|169472_171053_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_054724080.1|171049_171508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156343987.1|172142_172640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054724084.1|172753_173068_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_145923318.1|173549_174720_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.1e-45
WP_145923319.1|174750_175461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054724102.1|175505_175736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054724104.1|175871_176933_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A0K1LM33	Caulobacter_phage	59.1	4.0e-114
WP_054724106.1|176999_177437_-	endonuclease domain-containing protein	NA	NA	NA	NA	NA
WP_054724108.1|177499_179458_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0K1LMZ5	Caulobacter_phage	69.0	8.9e-237
WP_006954973.1|180440_181655_+|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_082831477.1|181628_183896_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_054724110.1|184289_184667_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054724112.1|184666_186406_+	M56 family metallopeptidase	NA	NA	NA	NA	NA
WP_054724114.1|186533_187274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054732801.1|187273_189373_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_082395363.1|189390_189768_+	reverse transcriptase-like protein	NA	A0A2L0V0T1	Agrobacterium_phage	37.4	1.6e-09
WP_054724116.1|189842_190304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054586500.1|190494_191535_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_054724119.1|191544_193209_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_054732806.1|193285_194164_-	subclass B3 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_054724121.1|194259_195144_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	28.6	3.3e-13
WP_054724123.1|195130_195976_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.2e-15
WP_054724125.1|196207_197299_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_054724127.1|197333_198482_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_054724129.1|198495_199155_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054724130.1|199282_201286_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_158514378.1|201495_201657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054724132.1|201784_202309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082396174.1|202359_203664_+	DNA-packaging protein	NA	A0A0K0N6T3	Gordonia_phage	38.3	1.2e-56
WP_054724135.1|204144_205251_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	34.7	2.7e-44
WP_054724137.1|205266_205575_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	48.7	1.5e-10
WP_054724139.1|205571_206000_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	37.0	3.3e-11
WP_082395364.1|206005_207145_+|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	47.3	3.0e-83
WP_054724141.1|207391_208750_+	hypothetical protein	NA	A0A2L0HPI4	Escherichia_phage	44.8	1.7e-16
WP_156343989.1|208746_208911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082396177.1|208933_209209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054724146.1|209208_209754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054724148.1|209750_210143_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_054724150.1|210146_210482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054724152.1|210529_210937_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_054724154.1|210933_211245_+	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_082396180.1|211294_211450_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_054724158.1|211442_212015_+	hypothetical protein	NA	D6PGG3	uncultured_phage	32.0	1.5e-06
WP_054724160.1|212014_214348_+	DUF2460 domain-containing protein	NA	A0A0P1KKK5	Acinetobacter_phage	27.1	5.0e-53
WP_054724162.1|214341_215166_+	DUF2163 domain-containing protein	NA	K4JUH7	Caulobacter_phage	38.3	2.4e-05
WP_054724164.1|215617_217792_+	hypothetical protein	NA	K4JQL7	Caulobacter_virus	42.1	6.6e-31
WP_054724166.1|217804_218248_+	DUF2793 domain-containing protein	NA	F4YXU6	Roseobacter_phage	38.1	1.8e-12
>prophage 2
NZ_CP013344	Sphingopyxis macrogoltabida strain 203N chromosome, complete genome	5380888	692233	733567	5380888	transposase,integrase	Stenotrophomonas_phage(12.5%)	42	732037:732051	734792:734806
WP_039575702.1|692233_693469_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	48.1	4.6e-98
WP_039575699.1|693465_693666_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039581108.1|693888_694806_+	virulence-associated protein E	NA	A0A0H4IPK0	Shigella_phage	33.3	1.2e-13
WP_039575697.1|694838_696857_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_062912860.1|696990_701286_+	methylase	NA	A0A076FMQ0	Aureococcus_anophage	23.5	9.7e-34
WP_158514388.1|701839_702853_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_158514389.1|702858_703695_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_039575690.1|703994_704696_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_158514390.1|704840_707159_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_156343993.1|707435_707918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156343994.1|708023_708827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054732950.1|708893_709886_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_054724952.1|709878_710541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054724954.1|710520_711108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054724956.1|711104_711938_-	bis-aminopropyl spermidine synthase family protein	NA	NA	NA	NA	NA
WP_145923339.1|711957_712485_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_054724960.1|712709_713282_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_145923340.1|713278_714841_-	GNAT family N-acetyltransferase	NA	Q6SE88	Lactobacillus_prophage	26.4	5.6e-16
WP_054724964.1|714803_715277_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_054724966.1|715273_715780_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_156343996.1|715839_717141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039575666.1|718443_719637_+	hypothetical protein	NA	A0A1V0DX75	Synechococcus_virus	41.8	2.0e-74
WP_052208316.1|719693_720083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039575664.1|720079_720934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081997376.1|720995_721235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054724971.1|721367_721844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158514391.1|721785_722418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039575656.1|722414_722684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039575653.1|722750_723395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039575651.1|723406_723868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039581098.1|723936_724419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039575647.1|724529_726215_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_039575644.1|726289_726721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039575641.1|726760_726967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052208981.1|727169_728078_+	hypothetical protein	NA	G9BWC3	Planktothrix_phage	33.3	1.9e-24
WP_039575639.1|728173_728461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145923343.1|728619_729377_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_145923344.1|729414_729936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006954973.1|730189_731404_+|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_054724978.1|731406_731646_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054724981.1|731642_732569_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	28.6	6.7e-09
732037:732051	attL	TCGGCCTGCTTGCGG	NA	NA	NA	NA
WP_054724983.1|732565_733567_+|integrase	site-specific integrase	integrase	A0A2L1IV36	Escherichia_phage	29.4	2.9e-05
WP_054724983.1|732565_733567_+|integrase	site-specific integrase	integrase	A0A2L1IV36	Escherichia_phage	29.4	2.9e-05
734792:734806	attR	TCGGCCTGCTTGCGG	NA	NA	NA	NA
>prophage 3
NZ_CP013344	Sphingopyxis macrogoltabida strain 203N chromosome, complete genome	5380888	771897	790192	5380888	transposase	Indivirus(50.0%)	10	NA	NA
WP_039581028.1|771897_772239_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_039575474.1|772235_772589_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_039575472.1|774581_775886_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_039575467.1|776650_779587_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_006954973.1|780532_781747_-|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_145923343.1|782041_782799_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_039575463.1|784297_785320_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_137865735.1|785433_786376_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	23.6	4.1e-14
WP_039575457.1|787931_789140_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_145923346.1|789420_790192_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.1	1.9e-25
>prophage 4
NZ_CP013344	Sphingopyxis macrogoltabida strain 203N chromosome, complete genome	5380888	810956	857648	5380888	transposase,integrase	Stenotrophomonas_phage(12.5%)	37	854361:854420	858684:858776
WP_039575425.1|810956_811964_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_145923348.1|812294_813472_-|transposase	IS3-like element ISSpma1 family transposase	transposase	NA	NA	NA	NA
WP_081997338.1|814390_815239_+	universal stress protein	NA	NA	NA	NA	NA
WP_081997337.1|815317_816367_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_156343998.1|817878_818049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006954973.1|818276_819491_+|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_054732956.1|819696_820914_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	46.2	6.4e-92
WP_054725015.1|820986_821361_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_054732959.1|821332_822073_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_054725017.1|822125_822860_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_158514393.1|822904_823579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054725021.1|823694_823967_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_054725023.1|824007_824268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054725025.1|824316_827652_-	TM0106 family RecB-like putative nuclease	NA	NA	NA	NA	NA
WP_054732962.1|827714_828707_+	WYL domain-containing transcriptional regulator	NA	NA	NA	NA	NA
WP_054732965.1|828803_829073_+	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_158514394.1|829069_829402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145923343.1|829549_830306_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_082395406.1|830237_830966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006954973.1|830968_832183_-|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_054725027.1|832672_835924_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	44.1	2.3e-35
WP_054725030.1|836026_838537_-	Hsp70 family protein	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	30.7	3.4e-31
WP_145923351.1|838520_838910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054725034.1|838875_840963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054725036.1|841490_843458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054725037.1|846408_846732_+	DUF736 family protein	NA	NA	NA	NA	NA
WP_082395407.1|846789_847029_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_006954973.1|847525_848740_+|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_054725040.1|849679_850672_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	26.9	7.0e-20
WP_054725041.1|850668_851607_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054732971.1|851603_852821_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	31.0	3.6e-10
WP_158514485.1|852806_853235_+	antirestriction protein	NA	A0A1V0EEV1	Caulobacter_phage	56.3	8.2e-18
WP_145923610.1|853303_853486_+	RNA polymerase subunit sigma	NA	NA	NA	NA	NA
WP_054725044.1|853545_854445_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
854361:854420	attL	CGATTATGCCGAGCGCCACACTATGCCGAGCGGGCGCGGTAGGTCCCGGCTTTCCAGCAA	NA	NA	NA	NA
WP_158514395.1|854734_855727_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054724981.1|855723_856650_+|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	28.6	6.7e-09
WP_054724983.1|856646_857648_+|integrase	site-specific integrase	integrase	A0A2L1IV36	Escherichia_phage	29.4	2.9e-05
858684:858776	attR	TTGCTGGAAAGCCGGGACCTACCGCGCCCGCTCGGCATAGTGTGGCGCTCGGCATAATCGCCGCATTACAAGATTAGCGCGGAGGAATTGAAG	NA	NA	NA	NA
>prophage 5
NZ_CP013344	Sphingopyxis macrogoltabida strain 203N chromosome, complete genome	5380888	1001946	1052389	5380888	tRNA,integrase	Mycobacterium_phage(25.0%)	49	1019719:1019735	1057557:1057573
WP_054725297.1|1001946_1002690_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_054725299.1|1002686_1003607_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.2	7.7e-05
WP_054725301.1|1003642_1004239_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_062912869.1|1004252_1004642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054725307.1|1004673_1005207_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.7	8.9e-22
WP_054725310.1|1005356_1005920_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_054725312.1|1005924_1006968_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_054725315.1|1007069_1007786_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_054725318.1|1007787_1008411_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C7C699	Ugandan_cassava_brown_streak_virus	32.3	3.0e-13
WP_054725322.1|1008472_1008991_+	DUF2239 family protein	NA	NA	NA	NA	NA
WP_054725325.1|1009022_1010168_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_054725328.1|1010277_1011168_+	tyrosine recombinase XerC	NA	A0A1I9SC88	Mycobacterium_phage	32.8	6.3e-12
WP_054725331.1|1011170_1011779_-	DedA family protein	NA	NA	NA	NA	NA
WP_054725334.1|1011803_1012754_-	glutathione synthase	NA	NA	NA	NA	NA
WP_054588574.1|1012764_1013115_-	YraN family protein	NA	NA	NA	NA	NA
WP_054725337.1|1013111_1013972_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_054733026.1|1013982_1015170_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_054588572.1|1015349_1015886_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	7.6e-13
WP_054725339.1|1015897_1016596_-	NRDE family protein	NA	NA	NA	NA	NA
WP_054733028.1|1016692_1017247_+	DUF4287 domain-containing protein	NA	NA	NA	NA	NA
WP_054725342.1|1017258_1017867_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054733030.1|1017890_1018328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054725344.1|1018486_1019995_-	peptidase S10	NA	NA	NA	NA	NA
1019719:1019735	attL	GGCGGCTCGGGTCGCGC	NA	NA	NA	NA
WP_054725347.1|1020098_1020791_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_054725351.1|1020894_1023081_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_062912870.1|1023167_1023686_+	DUF3617 domain-containing protein	NA	NA	NA	NA	NA
WP_054725357.1|1023814_1024357_+	DUF3617 domain-containing protein	NA	NA	NA	NA	NA
WP_054725360.1|1025016_1026774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003039428.1|1026901_1027138_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_054725364.1|1027321_1028584_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_082396229.1|1028884_1029802_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_054725370.1|1029845_1030598_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_054733033.1|1030764_1031250_+	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_054733036.1|1031566_1032820_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.6	2.4e-73
WP_082395425.1|1033046_1033706_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	48.5	1.5e-23
WP_062912871.1|1033833_1034742_+	virulence protein	NA	A0A2I6UG20	Salinibacter_virus	40.8	1.4e-06
WP_054725375.1|1034845_1037314_+	methylase	NA	NA	NA	NA	NA
WP_030540398.1|1037451_1038456_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	33.9	3.5e-11
WP_030540399.1|1038452_1039367_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054725389.1|1039360_1040908_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_082396231.1|1041072_1042803_+	methylase	NA	A0A076FMQ0	Aureococcus_anophage	31.2	1.2e-14
WP_054733039.1|1042862_1043276_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_054725394.1|1043272_1043989_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_054725397.1|1044002_1045166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054725399.1|1045172_1045955_-	phage Gp37/Gp68 family protein	NA	A0A088F7U1	Mycobacterium_phage	42.9	1.7e-58
WP_054725401.1|1045957_1047073_-	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_054725404.1|1047349_1049338_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_054732971.1|1050236_1051454_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	31.0	3.6e-10
WP_054725041.1|1051450_1052389_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1057557:1057573	attR	GGCGGCTCGGGTCGCGC	NA	NA	NA	NA
>prophage 6
NZ_CP013344	Sphingopyxis macrogoltabida strain 203N chromosome, complete genome	5380888	1092952	1153782	5380888	transposase,integrase	Stx2-converting_phage(25.0%)	59	1150210:1150269	1153847:1153931
WP_054725480.1|1092952_1094569_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	41.9	7.7e-101
WP_054725483.1|1094628_1094976_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	50.9	1.1e-28
WP_054725486.1|1094972_1095302_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054725489.1|1096753_1097110_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_054725492.1|1097106_1097559_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_158514398.1|1097738_1098506_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_145923616.1|1098583_1098790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054725498.1|1098800_1101503_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_054725502.1|1101536_1102973_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_054725518.1|1102974_1103820_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_054725520.1|1103800_1105528_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_054725523.1|1105524_1106289_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_054725526.1|1106285_1107314_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_082396237.1|1107310_1107910_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_054725530.1|1107954_1108479_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_054725533.1|1108465_1108873_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_054725535.1|1108869_1109262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054725538.1|1109291_1111835_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_054725541.1|1111834_1112647_-	conjugal transfer protein TraV	NA	NA	NA	NA	NA
WP_054725544.1|1112651_1113554_-	DsbC family protein	NA	NA	NA	NA	NA
WP_054725547.1|1113550_1114891_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_054725550.1|1114883_1115642_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_054725553.1|1115641_1116214_-	conjugal transfer protein TraE	NA	NA	NA	NA	NA
WP_036527642.1|1116226_1116514_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_054725555.1|1116541_1116871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054725559.1|1117221_1117683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082395431.1|1117728_1117962_+	AlpA family phage regulatory protein	NA	A0A1B0VNF0	Pseudomonas_phage	45.3	6.6e-06
WP_054725563.1|1118131_1119043_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145923364.1|1119200_1121528_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054725569.1|1121517_1122894_+	purine permease	NA	Q9KX94	Enterobacteria_phage	29.8	8.2e-19
WP_054725572.1|1122895_1123924_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_054725574.1|1123952_1124936_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_054725580.1|1124947_1125340_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_054725583.1|1125336_1126416_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_054725586.1|1126624_1128205_+	gamma-glutamyltransferase family protein	NA	NA	NA	NA	NA
WP_054725589.1|1128198_1129455_+	allantoate amidohydrolase	NA	NA	NA	NA	NA
WP_082395433.1|1129345_1130677_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_054725596.1|1130673_1131561_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_054725600.1|1131553_1132027_+	2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase	NA	NA	NA	NA	NA
WP_054725603.1|1132023_1133436_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054725606.1|1133432_1133762_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_054725608.1|1133812_1134925_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	27.5	2.3e-32
WP_145923365.1|1134935_1135187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054725612.1|1135179_1136070_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_054725615.1|1136066_1136498_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_054725619.1|1136501_1137116_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_082395434.1|1137115_1138183_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_054733054.1|1138200_1139535_+	AtzE family amidohydrolase	NA	NA	NA	NA	NA
WP_054725622.1|1139531_1139912_+	oxalurate catabolism protein HpxZ	NA	NA	NA	NA	NA
WP_054733056.1|1139917_1140928_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_054725625.1|1140915_1141842_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054725628.1|1141971_1142961_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_006954973.1|1143093_1144308_+|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_062902859.1|1145920_1146580_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	48.5	2.0e-23
WP_054729029.1|1146707_1147616_+	virulence protein	NA	A0A2I6UG20	Salinibacter_virus	40.8	1.4e-06
WP_062912875.1|1147719_1150188_+	methylase	NA	NA	NA	NA	NA
1150210:1150269	attL	TATTCTTTGCAGTCGCAGTTTATGTCGAGCGTGGCGGCGGTAGGCGCAGGTTTCCTTCGG	NA	NA	NA	NA
WP_030540398.1|1150325_1151330_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	33.9	3.5e-11
WP_030540399.1|1151326_1152241_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054725389.1|1152234_1153782_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1153847:1153931	attR	CCGAAGGAAACCTGCGCCTACCGCCGCCACGCTCGACATAAACTGCGACTGCAAAGAATACGTGGTCGATTACCTCACCAAAAGC	NA	NA	NA	NA
>prophage 7
NZ_CP013344	Sphingopyxis macrogoltabida strain 203N chromosome, complete genome	5380888	1609439	1666171	5380888	tail,plate,transposase	Moraxella_phage(25.0%)	42	NA	NA
WP_054728182.1|1609439_1609961_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_054728180.1|1609968_1610712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054728178.1|1610708_1611515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054728176.1|1611511_1612264_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_054728174.1|1612260_1614159_+	ATP-binding protein	NA	A0A0R6PCP6	Moraxella_phage	35.4	1.4e-24
WP_054728173.1|1614155_1614392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145923384.1|1614388_1617787_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_054728168.1|1617797_1618454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054728166.1|1618450_1618771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054728164.1|1618757_1619876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054728163.1|1619872_1620388_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_054728161.1|1620402_1620738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054728159.1|1620734_1621109_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_054728157.1|1621105_1623586_+	hypothetical protein	NA	A0A1J0GW37	Streptomyces_phage	25.4	3.0e-11
WP_054728155.1|1623582_1626177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054728153.1|1626173_1628579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054728151.1|1628575_1632118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054728149.1|1632345_1633761_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_054728147.1|1634683_1635979_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.5	4.3e-54
WP_054728145.1|1635982_1637080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054728143.1|1637063_1638533_-	serine hydrolase	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	23.9	1.9e-05
WP_054728141.1|1638690_1640562_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_082831453.1|1640404_1641028_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054728139.1|1641079_1642036_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054728136.1|1642040_1643279_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054728134.1|1643268_1644198_-	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_054728131.1|1644285_1645002_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082396314.1|1645236_1646256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145923386.1|1646252_1647377_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_054728126.1|1647431_1648181_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054728123.1|1648321_1650772_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054728121.1|1650798_1651728_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_054728119.1|1651668_1652970_-	MFS transporter	NA	NA	NA	NA	NA
WP_054728117.1|1653092_1653680_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054728116.1|1653756_1656054_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054728114.1|1656066_1657473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082395608.1|1657629_1659399_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_145923348.1|1659459_1660636_+|transposase	IS3-like element ISSpma1 family transposase	transposase	NA	NA	NA	NA
WP_006954973.1|1660953_1662168_-|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_145923387.1|1662330_1662969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006954973.1|1663296_1664511_+|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_145923348.1|1664994_1666171_+|transposase	IS3-like element ISSpma1 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP013344	Sphingopyxis macrogoltabida strain 203N chromosome, complete genome	5380888	2601257	2613614	5380888	terminase	Sinorhizobium_phage(63.64%)	17	NA	NA
WP_145923427.1|2601257_2601935_-	hypothetical protein	NA	A0A076GD25	Sinorhizobium_phage	41.4	7.8e-31
WP_054726319.1|2602181_2602550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145923428.1|2602553_2603027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054726312.1|2603023_2603452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054726310.1|2603451_2603874_-	hypothetical protein	NA	A0A076G8G8	Sinorhizobium_phage	30.7	1.2e-10
WP_145923429.1|2603873_2604092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054726308.1|2604103_2605279_-	hypothetical protein	NA	A0A076G6I6	Sinorhizobium_phage	34.1	5.3e-43
WP_054726306.1|2605275_2605668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054726304.1|2605667_2606165_-	hypothetical protein	NA	A0A076G6I4	Sinorhizobium_phage	44.2	1.2e-23
WP_054726302.1|2606238_2606823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054726298.1|2606837_2607920_-	hypothetical protein	NA	A0A076GD16	Sinorhizobium_phage	62.5	4.3e-124
WP_054726295.1|2607932_2608421_-	hypothetical protein	NA	A0A2I7RPR6	Vibrio_phage	39.0	5.6e-15
WP_054726292.1|2608424_2609576_-	hypothetical protein	NA	A0A076G8G2	Sinorhizobium_phage	48.1	7.7e-87
WP_054726289.1|2609572_2610967_-	DUF1073 domain-containing protein	NA	A0A076G6H8	Sinorhizobium_phage	46.2	2.5e-108
WP_054733143.1|2611007_2612363_-|terminase	phage terminase large subunit	terminase	W8VT11	Pseudomonas_phage	52.6	2.3e-122
WP_054726286.1|2612484_2612982_-	DUF2280 domain-containing protein	NA	A0A125RNL6	Pseudomonas_phage	49.6	2.4e-29
WP_054726283.1|2612984_2613614_-	hypothetical protein	NA	I6S676	Salmonella_phage	48.6	2.5e-47
>prophage 9
NZ_CP013344	Sphingopyxis macrogoltabida strain 203N chromosome, complete genome	5380888	2802197	2810592	5380888		uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_054733073.1|2802197_2803697_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	64.6	2.9e-171
WP_054725755.1|2803709_2804558_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	40.1	4.4e-47
WP_054725751.1|2804617_2804950_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_145923636.1|2804967_2805390_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	68.6	5.2e-49
WP_054733071.1|2805386_2806457_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_054725745.1|2806456_2807215_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.8	5.2e-76
WP_054725741.1|2807287_2807587_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_054725738.1|2808052_2808379_+	YnfA family protein	NA	A0A2H4JF35	uncultured_Caudovirales_phage	58.0	1.2e-26
WP_054725735.1|2808519_2810592_-	ParB N-terminal domain-containing protein	NA	G8DH78	Emiliania_huxleyi_virus	26.4	3.3e-32
>prophage 10
NZ_CP013344	Sphingopyxis macrogoltabida strain 203N chromosome, complete genome	5380888	2855570	2916709	5380888	transposase	Catovirus(33.33%)	53	NA	NA
WP_006954973.1|2855570_2856785_-|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_034953538.1|2857876_2858149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082831454.1|2858210_2860418_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.7	2.0e-83
WP_054588495.1|2860600_2861926_+	APC family permease	NA	NA	NA	NA	NA
WP_034953530.1|2862064_2862814_+	glutaredoxin	NA	A0A248SKD6	Salicola_phage	41.4	3.7e-05
WP_034953527.1|2862810_2863224_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_082831455.1|2863220_2863475_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_054588496.1|2863471_2863960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054588497.1|2864592_2865828_+	TolC family protein	NA	NA	NA	NA	NA
WP_054588498.1|2865824_2867318_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006954973.1|2869905_2871120_+|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_054588499.1|2871908_2872268_+	copper-binding protein	NA	NA	NA	NA	NA
WP_082831456.1|2872529_2872772_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_054588500.1|2872764_2873247_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_034953512.1|2873607_2873934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054588501.1|2873959_2874247_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_054588502.1|2874259_2874829_+	conjugal transfer protein TraE	NA	NA	NA	NA	NA
WP_054588503.1|2874825_2875581_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_054588504.1|2875580_2876867_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_054588505.1|2876863_2877733_+	DsbC family protein	NA	NA	NA	NA	NA
WP_082831478.1|2877744_2878311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054588507.1|2878307_2880857_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_034953502.1|2880856_2881261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054588508.1|2881253_2881649_+	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_054588509.1|2881645_2882152_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_054588510.1|2882151_2882784_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_054588511.1|2882780_2883794_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_054588512.1|2883790_2884546_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_054588513.1|2884542_2886264_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_054588514.1|2886260_2887073_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_054588515.1|2887062_2888499_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_054588516.1|2888509_2891212_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_054588517.1|2891213_2891423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054590279.1|2891788_2892109_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_054588518.1|2892734_2893370_+	S24 family peptidase	NA	A5X9F5	Aeromonas_virus	38.7	1.7e-19
WP_158500086.1|2893493_2894021_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_054588519.1|2893966_2894689_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	31.4	2.1e-18
WP_082831459.1|2895010_2895322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006954973.1|2895371_2896586_+|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_082831460.1|2896552_2897332_-	beta-carotene hydroxylase	NA	NA	NA	NA	NA
WP_082831461.1|2897328_2897523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145923454.1|2897708_2898422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062902880.1|2898437_2899271_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_054588521.1|2899366_2900053_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_054588522.1|2900074_2901718_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_082820005.1|2901839_2902886_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_082820006.1|2903115_2904711_+	hypothetical protein	NA	A0A1V0S9M4	Catovirus	31.8	1.3e-55
WP_082820007.1|2904984_2906664_+	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.5	1.0e-26
WP_062770873.1|2906795_2908283_-	MFS transporter	NA	NA	NA	NA	NA
WP_054588540.1|2908289_2909723_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_158514425.1|2909840_2912591_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_006954973.1|2912698_2913913_-|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_145923455.1|2915346_2916709_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP013344	Sphingopyxis macrogoltabida strain 203N chromosome, complete genome	5380888	2975868	3072138	5380888	holin,transposase,integrase	Aureococcus_anophage(13.64%)	73	3037061:3037120	3072207:3072334
WP_054725040.1|2975868_2976861_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	26.9	7.0e-20
WP_054725041.1|2976857_2977796_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054732971.1|2977792_2979010_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	31.0	3.6e-10
WP_062912952.1|2979908_2981897_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_062913022.1|2982286_2983246_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_006954973.1|2983780_2984995_+|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_082831467.1|2985080_2987282_+	DEAD/DEAH box helicase	NA	M1HM79	Paramecium_bursaria_Chlorella_virus	23.0	2.0e-11
WP_062912953.1|2987297_2987606_+	DCL family protein	NA	NA	NA	NA	NA
WP_145923458.1|2987602_2987854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062912954.1|2987900_2988620_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_047823591.1|2988616_2989030_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_082831468.1|2989090_2990821_-	methylase	NA	A0A076FMQ0	Aureococcus_anophage	31.4	1.5e-14
WP_082831481.1|2990851_2992393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019053426.1|2992382_2993399_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	33.3	2.7e-11
WP_019053427.1|2993395_2994310_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_026149763.1|2994303_2995851_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_062912956.1|2995996_2998465_-	methylase	NA	NA	NA	NA	NA
WP_062913024.1|2998568_2999477_-	virulence protein	NA	A0A2I6UG20	Salinibacter_virus	38.2	1.8e-06
WP_062912957.1|2999604_3000264_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	48.5	1.5e-23
WP_145923318.1|3002316_3003487_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.1e-45
WP_006954973.1|3004082_3005297_-|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_158514427.1|3005505_3008208_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054588536.1|3008326_3009760_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_082831472.1|3009647_3011324_+	MFS transporter	NA	NA	NA	NA	NA
WP_006954973.1|3011826_3013041_+|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_062902848.1|3013219_3014827_+|holin	glucose-methanol-choline oxidoreductase	holin	A0A1V0SI18	Klosneuvirus	30.9	5.0e-60
WP_158514399.1|3015057_3016728_+	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.4	1.1e-22
WP_082831473.1|3017030_3018149_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_054588524.1|3019288_3020932_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_054588525.1|3020951_3021647_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_054588526.1|3021815_3022007_+	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_054729007.1|3022373_3022568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013832744.1|3022670_3022907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054733571.1|3023233_3023464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038575578.1|3023581_3023971_-	single-stranded DNA-binding protein	NA	A0A2I6PDH4	Staphylococcus_phage	35.5	1.7e-14
WP_062912961.1|3024268_3024697_-	hypothetical protein	NA	A0A1B1IUL8	uncultured_Mediterranean_phage	59.0	1.1e-35
WP_062912962.1|3024707_3025145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062912963.1|3025262_3026216_-	DUF2493 domain-containing protein	NA	NA	NA	NA	NA
WP_015459196.1|3026516_3026939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054732971.1|3027415_3028633_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	31.0	3.6e-10
WP_054725041.1|3028629_3029568_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054725040.1|3029564_3030557_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	26.9	7.0e-20
WP_054729017.1|3031421_3033410_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_082395703.1|3033577_3034063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729020.1|3034102_3034822_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_054733577.1|3034818_3035232_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_082396336.1|3035287_3037024_-	methylase	NA	A0A076FMQ0	Aureococcus_anophage	31.2	1.2e-14
3037061:3037120	attL	CACGTATTCTTTGCAGTCGCAGTTTATGTCGAGCGTGGCGGCGGTAGGCGCAGGTTTCCT	NA	NA	NA	NA
WP_054725389.1|3037188_3038736_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_030540399.1|3038729_3039644_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_030540398.1|3039640_3040645_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	33.9	3.5e-11
WP_054729026.1|3040782_3043251_-	methylase	NA	NA	NA	NA	NA
WP_054729029.1|3043354_3044263_-	virulence protein	NA	A0A2I6UG20	Salinibacter_virus	40.8	1.4e-06
WP_062902859.1|3044390_3045050_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	48.5	2.0e-23
WP_006954973.1|3046380_3047595_+|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_054729035.1|3051293_3051608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729038.1|3052004_3052583_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_054729042.1|3052579_3053488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158514428.1|3053570_3056504_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	25.0	2.8e-24
WP_054729048.1|3056497_3058471_+	Atxe2 family lasso peptide isopeptidase	NA	NA	NA	NA	NA
WP_145923459.1|3058377_3060156_-	asparagine synthase	NA	NA	NA	NA	NA
WP_054729052.1|3060071_3060716_-	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_145923460.1|3060781_3060910_-	benenodin family lasso peptide	NA	NA	NA	NA	NA
WP_158514429.1|3061202_3061823_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054729058.1|3061819_3062707_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
WP_054729061.1|3062718_3063327_-	autoinducer synthase	NA	NA	NA	NA	NA
WP_054729064.1|3063507_3064248_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158514430.1|3064256_3064394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729067.1|3064485_3065418_-	DUF2493 domain-containing protein	NA	NA	NA	NA	NA
WP_054729070.1|3065727_3066759_-	DNA primase	NA	A0A2I7R874	Vibrio_phage	36.8	5.7e-09
WP_082395715.1|3066770_3068633_-	methylase	NA	A0A076FMQ0	Aureococcus_anophage	31.8	3.7e-14
WP_030540398.1|3068681_3069686_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	33.9	3.5e-11
WP_030540399.1|3069682_3070597_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054725389.1|3070590_3072138_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3072207:3072334	attR	AGGAAACCTGCGCCTACCGCCGCCACGCTCGACATAAACTGCGACTGCAAAGAATACGTGTAATGTTGAGCTCAACATTACACATATTCGCGCGGCGTGATGTCGACCGACACGTCGCCCCACTCCTC	NA	NA	NA	NA
>prophage 12
NZ_CP013344	Sphingopyxis macrogoltabida strain 203N chromosome, complete genome	5380888	3079118	3102644	5380888	capsid,head,tail,protease,integrase,terminase,portal	Pseudomonas_phage(23.08%)	39	3067792:3067807	3099010:3099025
3067792:3067807	attL	CCCGTCGCCGCTTCGA	NA	NA	NA	NA
WP_054729085.1|3079118_3080345_-|integrase	site-specific integrase	integrase	Q7M297	Enterobacteria_phage	28.9	9.2e-30
WP_054729088.1|3080644_3080860_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_054729091.1|3080856_3081084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054729094.1|3081080_3081413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054729096.1|3081409_3081598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054733579.1|3081594_3081777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054729101.1|3081776_3082043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054729104.1|3082039_3082537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156344041.1|3082533_3082710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054729107.1|3082706_3083030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054729110.1|3083026_3083212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054729115.1|3083208_3084345_-	ParB N-terminal domain-containing protein	NA	Q4ZDB0	Staphylococcus_virus	26.9	2.0e-07
WP_054729118.1|3084341_3084563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054729121.1|3084559_3085423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054729124.1|3085535_3086231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082396337.1|3086227_3087484_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_054729130.1|3087483_3088614_-	ParB N-terminal domain-containing protein	NA	H9A0Q8	Staphylococcus_phage	29.9	4.8e-09
WP_145923461.1|3088610_3088961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082395719.1|3089151_3089958_-	helix-turn-helix domain-containing protein	NA	A0A0S2SYF7	Pseudomonas_phage	31.4	9.3e-15
WP_054729138.1|3089951_3090164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054733581.1|3090163_3091147_+	hypothetical protein	NA	S5M810	Pseudoalteromonas_phage	41.8	8.2e-13
WP_054729143.1|3091143_3092577_+	AAA family ATPase	NA	A0A1P8VVQ6	Streptococcus_phage	30.7	3.8e-43
WP_054729146.1|3092569_3093340_+	DUF1376 domain-containing protein	NA	B0VK15	Azospirillum_phage	44.7	3.7e-21
WP_054729150.1|3093336_3093519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145923462.1|3093511_3094165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156344042.1|3094320_3094491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729156.1|3094483_3094786_+	HNH endonuclease	NA	A8B112	Xanthomonas_virus	56.1	1.1e-13
WP_054729159.1|3094770_3095007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156344043.1|3095173_3095332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158514431.1|3095324_3095465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729162.1|3095617_3096100_+	hypothetical protein	NA	B4UTN9	Rhizobium_phage	51.2	2.5e-31
WP_054729164.1|3096182_3097682_+|terminase	terminase large subunit	terminase	K7P7T5	Enterobacteria_phage	53.2	1.7e-134
WP_145923640.1|3097684_3098920_+|portal	phage portal protein	portal	A0A0U2BXP2	Paracoccus_phage	52.8	2.7e-106
WP_054729167.1|3098916_3099774_+|protease	Clp protease ClpP	protease	A0A0U4B0J0	Pseudomonas_phage	45.5	6.2e-57
3099010:3099025	attR	CCCGTCGCCGCTTCGA	NA	NA	NA	NA
WP_054733589.1|3099902_3101111_+|capsid	phage major capsid protein	capsid	A0A0U4JIW8	Pseudomonas_phage	67.2	7.7e-146
WP_054729169.1|3101159_3101432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729172.1|3101434_3101797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158514432.1|3101793_3102300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729178.1|3102299_3102644_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
>prophage 13
NZ_CP013344	Sphingopyxis macrogoltabida strain 203N chromosome, complete genome	5380888	3208057	3215741	5380888	transposase,integrase	Ochrobactrum_phage(33.33%)	12	3205711:3205728	3219883:3219900
3205711:3205728	attL	GCGACCTGATGGACGCGT	NA	NA	NA	NA
WP_054729468.1|3208057_3210025_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1B0T6H2	Thiobacimonas_phage	42.5	1.1e-130
WP_054729471.1|3210038_3211034_+	hypothetical protein	NA	A0A0N7ACA6	Bacillus_phage	23.9	1.3e-10
WP_054729475.1|3211057_3211711_+	DUF3164 family protein	NA	M4STB6	Rhodobacter_phage	60.7	5.0e-67
WP_054729477.1|3211710_3211971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729480.1|3211967_3212369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729482.1|3212365_3212632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729485.1|3212628_3213204_+	regulatory protein GemA	NA	A0A219VHC6	Ochrobactrum_phage	39.4	5.6e-22
WP_054729488.1|3213203_3213656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729491.1|3213652_3213907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062912969.1|3213906_3214146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054729499.1|3214414_3214801_+	hypothetical protein	NA	A0A219VHE2	Ochrobactrum_phage	40.6	1.9e-13
WP_054733615.1|3215192_3215741_+	hypothetical protein	NA	A0A0D4DCJ5	Acinetobacter_phage	56.1	2.5e-51
3219883:3219900	attR	GCGACCTGATGGACGCGT	NA	NA	NA	NA
>prophage 14
NZ_CP013344	Sphingopyxis macrogoltabida strain 203N chromosome, complete genome	5380888	4359549	4405257	5380888	transposase,integrase	Mycobacterium_phage(18.18%)	40	4351938:4351952	4405672:4405686
4351938:4351952	attL	AAACGCAGAGGCGGC	NA	NA	NA	NA
WP_006954973.1|4359549_4360764_+|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_054731577.1|4361310_4362225_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054731578.1|4362367_4363261_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054731579.1|4363359_4364109_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	5.4e-17
WP_054731580.1|4364138_4364561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731581.1|4364633_4365245_+	porin family protein	NA	O11861	Bartonella_henselae_phage	26.0	2.3e-05
WP_054731582.1|4365349_4365889_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_054731583.1|4365885_4366536_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_054731584.1|4366630_4367011_+	response regulator	NA	NA	NA	NA	NA
WP_054731585.1|4367007_4369041_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_054731586.1|4369037_4370891_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_054734004.1|4371174_4372005_+	alpha/beta hydrolase	NA	A0A1D8ET90	Mycobacterium_phage	28.9	5.3e-13
WP_054731587.1|4372092_4372701_-	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_054731588.1|4372700_4373684_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054731589.1|4373795_4375010_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006954973.1|4375255_4376470_-|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_082395953.1|4377347_4379606_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_054731590.1|4379881_4382431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062912988.1|4382702_4383248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062912989.1|4384031_4385621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162493552.1|4385748_4386672_-	cyclic nucleotide-binding domain-containing protein	NA	NA	NA	NA	NA
WP_062912991.1|4386989_4387493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062912992.1|4387497_4388208_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_062912993.1|4388346_4388808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062912994.1|4388817_4391769_-	Ti-type conjugative transfer relaxase TraA	NA	NA	NA	NA	NA
WP_062913026.1|4391941_4392265_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_062912995.1|4392281_4392530_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_062912996.1|4392691_4393132_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	53.4	1.2e-27
WP_062912997.1|4393158_4394079_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_062912998.1|4394139_4394388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082831474.1|4394384_4394762_-	antirestriction protein	NA	A0A1V0EEV1	Caulobacter_phage	54.5	9.4e-18
WP_054725040.1|4394764_4395757_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	26.9	7.0e-20
WP_054725041.1|4395753_4396692_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054732971.1|4396688_4397906_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2K9VF00	Mycobacterium_phage	31.0	3.6e-10
WP_054731592.1|4397965_4398652_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.2	1.7e-25
WP_054734008.1|4399203_4399437_+	AlpA family phage regulatory protein	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	42.0	5.1e-06
WP_054731593.1|4399489_4399813_-	DUF736 family protein	NA	NA	NA	NA	NA
WP_054731594.1|4400535_4402311_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	35.3	1.9e-07
WP_054731595.1|4402804_4402972_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082395954.1|4403940_4405257_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	46.6	1.1e-97
4405672:4405686	attR	GCCGCCTCTGCGTTT	NA	NA	NA	NA
>prophage 15
NZ_CP013344	Sphingopyxis macrogoltabida strain 203N chromosome, complete genome	5380888	4414003	4425771	5380888	terminase	Enterobacter_phage(25.0%)	15	NA	NA
WP_054729130.1|4414003_4415134_-	ParB N-terminal domain-containing protein	NA	H9A0Q8	Staphylococcus_phage	29.9	4.8e-09
WP_156344054.1|4415130_4415661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054731608.1|4415693_4416335_-	helix-turn-helix transcriptional regulator	NA	A0A291AUK0	Sinorhizobium_phage	31.9	1.7e-06
WP_158514459.1|4416449_4416701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731610.1|4416753_4418187_+	AAA family ATPase	NA	W8EEZ1	Geobacillus_phage	33.5	2.9e-43
WP_054731611.1|4418183_4419002_+	YdaU family protein	NA	A0A223W0C2	Agrobacterium_phage	51.5	8.0e-22
WP_145923539.1|4419036_4419540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054731613.1|4419588_4420065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158514460.1|4420033_4420606_+	hypothetical protein	NA	R9ZXU8	Cellulophaga_phage	31.0	1.2e-08
WP_054734010.1|4420589_4422215_+|terminase	terminase	terminase	Q775B9	Bordetella_phage	50.5	1.1e-136
WP_158514461.1|4422441_4422660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158514462.1|4422715_4422895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731616.1|4423020_4424709_+	hypothetical protein	NA	A0A193GYI4	Enterobacter_phage	28.0	7.4e-54
WP_054731617.1|4424708_4424996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145923540.1|4424970_4425771_+	hypothetical protein	NA	A0A193GYS7	Enterobacter_phage	29.8	3.8e-08
>prophage 16
NZ_CP013344	Sphingopyxis macrogoltabida strain 203N chromosome, complete genome	5380888	4567132	4595897	5380888	integrase	Escherichia_phage(28.57%)	25	4592313:4592372	4595958:4596046
WP_054724983.1|4567132_4568134_-|integrase	site-specific integrase	integrase	A0A2L1IV36	Escherichia_phage	29.4	2.9e-05
WP_054724981.1|4568130_4569057_-|integrase	tyrosine-type recombinase/integrase	integrase	S5MBZ0	Brevibacillus_phage	28.6	6.7e-09
WP_158514395.1|4569053_4570046_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_082831475.1|4570335_4571244_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_054731729.1|4571327_4571651_-	DUF736 family protein	NA	NA	NA	NA	NA
WP_054734077.1|4571957_4572359_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082395989.1|4572433_4573273_+	cation transporter	NA	NA	NA	NA	NA
WP_054731730.1|4573454_4574381_+	lipid kinase	NA	NA	NA	NA	NA
WP_054731731.1|4574595_4575408_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	34.6	1.7e-32
WP_145923554.1|4575642_4576287_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_054731733.1|4576283_4577204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731734.1|4577291_4580219_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.3	4.6e-19
WP_158514466.1|4580344_4582237_+	Atxe2 family lasso peptide isopeptidase	NA	NA	NA	NA	NA
WP_054731736.1|4582328_4584041_-	asparagine synthase	NA	NA	NA	NA	NA
WP_158514467.1|4584037_4584688_-	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_054731738.1|4584982_4585621_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_145923659.1|4585617_4586478_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_054731740.1|4586542_4587160_-	autoinducer synthase	NA	NA	NA	NA	NA
WP_054731741.1|4587251_4587995_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054731742.1|4588239_4589172_-	DUF2493 domain-containing protein	NA	NA	NA	NA	NA
WP_054731743.1|4589478_4590510_-	DNA primase	NA	A0A2R4ALE6	Vibrio_phage	32.2	2.9e-08
WP_082395991.1|4590521_4592384_-	methylase	NA	A0A076FMQ0	Aureococcus_anophage	30.0	4.8e-14
4592313:4592372	attL	GACATATTCTTTGCAGTCGCAGTTTATGTCGAGCGTGGCGGCGGTAGGCGCAGGTTTCCT	NA	NA	NA	NA
WP_054725389.1|4592440_4593988_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_030540399.1|4593981_4594896_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_030540398.1|4594892_4595897_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	33.9	3.5e-11
4595958:4596046	attR	AGGAAACCTGCGCCTACCGCCGCCACGCTCGACATAAACTGCGACTGCAAAGAATATGTCTAATGTTGAGCTCAACATTACACGTATTC	NA	NA	NA	NA
>prophage 17
NZ_CP013344	Sphingopyxis macrogoltabida strain 203N chromosome, complete genome	5380888	4670454	4735382	5380888	protease,transposase,tRNA,integrase	Streptococcus_phage(14.29%)	56	4664952:4664969	4703398:4703415
4664952:4664969	attL	TCGGCGACGATCTCGATC	NA	NA	NA	NA
WP_054731801.1|4670454_4671771_+|integrase	site-specific integrase	integrase	Q7Y4M3	Streptococcus_phage	24.5	3.1e-07
WP_054734108.1|4671844_4672171_-	DUF736 family protein	NA	NA	NA	NA	NA
WP_158514468.1|4672311_4672701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731803.1|4673052_4673511_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	54.6	1.2e-27
WP_054731804.1|4674008_4674401_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_054589308.1|4674405_4674636_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_145923346.1|4674967_4675739_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.1	1.9e-25
WP_156344058.1|4676594_4676798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145923558.1|4676852_4677257_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_145923559.1|4678263_4678923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054731807.1|4679169_4679832_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_054731808.1|4679824_4681360_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_145923560.1|4681432_4687657_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_158514469.1|4687671_4687947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145923561.1|4688021_4688444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731811.1|4688965_4689532_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_054734113.1|4689561_4690644_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054731812.1|4690718_4692020_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	27.5	1.9e-33
WP_054734115.1|4692175_4693027_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054731813.1|4693145_4694102_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_082396008.1|4694055_4695081_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_156344059.1|4695142_4695841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006954973.1|4695876_4697091_-|transposase	IS256-like element ISSpma2 family transposase	transposase	NA	NA	NA	NA
WP_082396023.1|4697107_4698253_-	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	25.6	1.9e-13
WP_145923562.1|4698544_4698793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054731816.1|4699038_4699578_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_145923563.1|4699642_4699981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731818.1|4700019_4700517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731819.1|4700456_4701041_+	hypothetical protein	NA	A0A1B2LRS6	Wolbachia_phage	29.1	1.4e-12
WP_054731820.1|4701040_4701427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731821.1|4701458_4702343_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_054731822.1|4702714_4705252_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	37.6	2.1e-20
4703398:4703415	attR	GATCGAGATCGTCGCCGA	NA	NA	NA	NA
WP_054731823.1|4705254_4707435_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_054731824.1|4707362_4709153_-	asparagine synthase	NA	NA	NA	NA	NA
WP_158514470.1|4709149_4709782_-	lasso peptide biosynthesis B2 protein	NA	NA	NA	NA	NA
WP_054731826.1|4710458_4710707_+	helix-turn-helix domain-containing protein	NA	A0A2I6UI15	Bacillus_phage	39.4	7.8e-05
WP_054731827.1|4710708_4712046_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_054731828.1|4712162_4712672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731829.1|4712656_4713178_-	sulfite oxidase subunit YedZ	NA	NA	NA	NA	NA
WP_054589336.1|4713683_4713959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082396362.1|4715413_4717105_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.9	9.4e-09
WP_054731832.1|4717642_4717975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054731833.1|4718491_4720444_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054731834.1|4720467_4721262_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_054731835.1|4721261_4722245_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	22.2	3.9e-07
WP_054731836.1|4722237_4723002_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	5.4e-12
WP_062913005.1|4723362_4725309_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_082396034.1|4725413_4726643_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_145923565.1|4726668_4727811_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054731839.1|4728228_4729275_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A0P0YMS6	Yellowstone_lake_phycodnavirus	29.4	7.3e-28
WP_054734124.1|4729301_4730570_+	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	27.4	7.8e-24
WP_054731840.1|4730705_4731872_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_054731841.1|4731868_4732669_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_145923566.1|4732671_4733949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062913007.1|4734170_4734599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145923346.1|4734609_4735382_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.1	1.9e-25
>prophage 1
NZ_CP013345	Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence	421025	64729	127384	421025	transposase,holin	Klosneuvirus(30.0%)	50	NA	NA
WP_054735404.1|64729_66322_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.6	4.3e-64
WP_082396386.1|66329_67178_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_054734514.1|67208_68018_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.0	7.2e-15
WP_054734517.1|68017_68545_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_054734520.1|68773_69649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054734524.1|69676_70507_+	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_054734529.1|70543_70921_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_054734532.1|70966_72631_-	hypothetical protein	NA	A0A1V0SI18	Klosneuvirus	29.7	4.0e-52
WP_054734535.1|72755_73571_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_054734539.1|73563_75204_-	MFS transporter	NA	NA	NA	NA	NA
WP_158514493.1|75341_77711_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054734545.1|77768_78005_+	ferredoxin	NA	NA	NA	NA	NA
WP_082396389.1|78020_79196_+	cytochrome P450	NA	NA	NA	NA	NA
WP_054734551.1|79285_80761_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_145923673.1|80775_81747_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054734555.1|81751_82588_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.1	2.5e-10
WP_054734561.1|82607_83813_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_054734565.1|83846_84884_-	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_062913032.1|84892_85237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054734571.1|85303_86461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054734574.1|86478_87306_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_158514494.1|87662_88340_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_054734580.1|88545_90732_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_082396439.1|90792_92142_+	MFS transporter	NA	NA	NA	NA	NA
WP_145923348.1|92938_94116_-|transposase	IS3-like element ISSpma1 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	1.8e-35
WP_158514495.1|93959_95681_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_054734590.1|96059_97007_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054734594.1|97122_98298_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_054734598.1|98297_99428_+	CoA transferase	NA	NA	NA	NA	NA
WP_054734600.1|99460_100504_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_054734603.1|100815_101262_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_054734605.1|101309_102467_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_158514496.1|102459_103833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054734611.1|103883_104951_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_145923676.1|104995_105790_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_054734618.1|105786_106599_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_054734621.1|106602_108648_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_054734624.1|110221_111169_-	gluconolaconase	NA	NA	NA	NA	NA
WP_082396396.1|111295_112144_-	isocitrate lyase/PEP mutase family protein	NA	NA	NA	NA	NA
WP_158514497.1|112148_114023_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	30.9	5.7e-47
WP_054734634.1|114146_114956_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_054734637.1|115078_116047_-	cytochrome P450	NA	NA	NA	NA	NA
WP_006954973.1|116232_117447_+|transposase	IS256-like element ISSpma2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.9	3.2e-99
WP_054734639.1|117776_119411_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	29.2	3.1e-49
WP_006954973.1|119672_120887_-|transposase	IS256-like element ISSpma2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.9	3.2e-99
WP_145923677.1|121230_122133_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_158514498.1|122391_124647_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_082396399.1|124618_125431_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_082396400.1|125467_126196_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_006954973.1|126169_127384_-|transposase	IS256-like element ISSpma2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.9	3.2e-99
>prophage 2
NZ_CP013345	Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence	421025	391621	403305	421025	transposase,integrase	Brevibacillus_phage(16.67%)	13	390413:390427	407000:407014
390413:390427	attL	GCCCGGCGGCAACGG	NA	NA	NA	NA
WP_158514395.1|391621_392614_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.2	3.7e-13
WP_054724983.1|393534_394536_+|integrase	site-specific integrase	integrase	A0A2K9VH72	Gordonia_phage	28.0	1.1e-12
WP_054724984.1|394554_395460_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_054735346.1|395546_396059_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_145923318.1|396068_397240_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.1e-45
WP_054735349.1|397302_397734_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_158514510.1|397763_398273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145923693.1|398624_399062_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_054735357.1|399058_399670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158514511.1|399710_400178_-	antirestriction protein	NA	A0A1V0EEV1	Caulobacter_phage	48.5	3.6e-19
WP_054732971.1|400163_401381_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L4BKH1	Thermus_phage	28.6	3.6e-10
WP_054725041.1|401377_402316_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054725040.1|402312_403305_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	31.7	6.5e-10
407000:407014	attR	GCCCGGCGGCAACGG	NA	NA	NA	NA
>prophage 1
NZ_CP013346	Sphingopyxis macrogoltabida strain 203N plasmid unnamed2, complete sequence	151240	6145	69233	151240	integrase,transposase,protease	Corynebacterium_phage(18.18%)	52	9941:9955	72182:72196
WP_054735466.1|6145_7171_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_054735469.1|7526_8426_+	3'-5' exonuclease	NA	A0A223VZT3	Agrobacterium_phage	29.0	3.2e-16
WP_054735473.1|8457_10593_+	AAA family ATPase	NA	NA	NA	NA	NA
9941:9955	attL	CGATCATCACCGATC	NA	NA	NA	NA
WP_054735476.1|10594_12394_+	ATP-dependent helicase	NA	G3MA40	Bacillus_virus	22.3	1.0e-21
WP_054735480.1|12618_15012_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_145923696.1|14981_15248_-	DUF1203 domain-containing protein	NA	NA	NA	NA	NA
WP_006954973.1|15334_16549_+|transposase	IS256-like element ISSpma2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.9	3.2e-99
WP_054735482.1|16786_18352_+|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	32.1	6.3e-07
WP_054735485.1|18352_19180_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_054735488.1|19479_20850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006473457.1|21071_22427_-|transposase	IS1380-like element IS1247 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
WP_145923697.1|22514_23849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054735494.1|24180_25029_-	virulence-associated protein E	NA	NA	NA	NA	NA
WP_145923717.1|25486_26098_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	55.2	1.5e-28
WP_054735501.1|26077_26353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082396447.1|26362_27838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145923698.1|28208_28424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054590548.1|28514_28904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054590549.1|29046_29520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054590550.1|29792_30110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054136666.1|30199_30484_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_054136667.1|30485_31052_+	conjugal transfer protein TraE	NA	NA	NA	NA	NA
WP_054735510.1|31048_31849_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_054735512.1|31854_33144_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_145923699.1|33152_33998_+	DsbC family protein	NA	NA	NA	NA	NA
WP_054735515.1|33994_34705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054735517.1|34711_37285_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_145923700.1|37281_37659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054735524.1|37655_38207_+	TrbI F-type domain-containing protein	NA	NA	NA	NA	NA
WP_082396448.1|38316_38793_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_082396457.1|38891_39452_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_145923718.1|39758_40751_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_054735533.1|40761_41499_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_082396449.1|41495_43232_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_066110861.1|43235_43613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054735788.1|43609_44413_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_054735543.1|44412_45855_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_054735546.1|45867_48654_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_145923701.1|48683_48908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054735551.1|49084_49870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054735554.1|49880_50540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054735557.1|50570_50750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006954973.1|50826_52041_-|transposase	IS256-like element ISSpma2 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.9	3.2e-99
WP_054735560.1|52732_54493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054735563.1|54495_56037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054735565.1|56033_61508_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	32.0	1.0e-35
WP_082396450.1|61550_62585_+	DUF262 domain-containing protein	NA	C4MZ12	Escherichia_phage	25.4	7.5e-09
WP_006473457.1|62653_64009_+|transposase	IS1380-like element IS1247 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
WP_054735488.1|64230_65601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054735570.1|65847_66906_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_007686150.1|66684_67215_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054735573.1|67565_69233_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	27.9	7.1e-09
72182:72196	attR	CGATCATCACCGATC	NA	NA	NA	NA
