The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012744	Klebsiella pneumoniae subsp. pneumoniae strain TGH10 chromosome, complete genome	5355459	57162	76717	5355459	transposase,tail	Escherichia_phage(57.14%)	11	NA	NA
WP_001389365.1|57162_57927_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|58680_59265_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|59264_60503_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|60499_61405_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001174919.1|62499_62940_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	1.5e-51
WP_001555895.1|62911_63514_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	2.5e-97
WP_077265679.1|63513_63942_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	45.9	5.1e-20
WP_004176137.1|64664_65696_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_000422741.1|74300_74726_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|74722_75073_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080200.1|75103_76717_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
>prophage 2
NZ_CP012744	Klebsiella pneumoniae subsp. pneumoniae strain TGH10 chromosome, complete genome	5355459	674289	714100	5355459	plate,head,integrase,tail,capsid,holin,tRNA,terminase,lysis,portal	Escherichia_phage(27.5%)	48	674163:674203	707915:707955
674163:674203	attL	GGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_032454123.1|674289_675327_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	64.7	2.7e-123
WP_032454122.1|675333_675918_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	38.7	1.0e-31
WP_004195891.1|676037_676259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032454121.1|676289_676799_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	93.5	4.6e-84
WP_032454120.1|676806_677007_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	1.1e-30
WP_032454119.1|676970_677309_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.0	8.0e-53
WP_062920432.1|677377_677605_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	73.3	1.0e-19
WP_062920433.1|677604_677826_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	86.3	1.2e-28
WP_047718529.1|677826_678108_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	91.4	3.7e-43
WP_074177509.1|678256_680329_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	90.2	0.0e+00
WP_062920435.1|680470_680656_+	hypothetical protein	NA	A0A218M4I0	Erwinia_phage	73.8	1.3e-17
WP_062920436.1|681101_681587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062920437.1|681600_682692_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_191720740.1|683061_683262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032454110.1|683556_684600_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.4	4.0e-167
WP_032454109.1|684599_686369_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.8	1.8e-305
WP_032454108.1|686534_687389_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	80.6	4.8e-126
WP_062920439.1|687462_688521_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.2	8.4e-165
WP_074177506.1|688548_689268_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	79.2	8.1e-95
WP_009309691.1|689364_689871_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_019725382.1|689870_690074_+|tail	tail protein X	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
WP_019725381.1|690078_690369_+|holin	phage holin family protein	holin	A0A0M5M1H1	Salmonella_phage	79.6	5.0e-35
WP_032454106.1|690355_690853_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	87.7	8.7e-80
WP_032454105.1|690849_691281_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.9	6.2e-42
WP_032454104.1|691255_691414_+	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	74.0	4.9e-13
WP_032454103.1|691376_691844_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.2	2.0e-62
WP_032454101.1|691836_692286_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	70.1	6.5e-50
WP_062920440.1|692636_693740_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_015959011.1|693999_694641_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.5	2.0e-92
WP_014343405.1|694637_694985_+	GPW/gp25 family protein	NA	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
WP_032433553.1|694989_695898_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	72.2	5.2e-115
WP_050442664.1|696492_698757_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	41.0	5.3e-108
WP_032454098.1|698762_699491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032454097.1|699502_700579_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	43.9	2.8e-30
WP_032454096.1|700689_701871_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.9	7.9e-196
WP_014343412.1|701884_702400_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
WP_062920441.1|702460_702736_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	76.1	1.2e-30
WP_074177498.1|702768_702888_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	89.7	4.4e-14
WP_062920443.1|702880_705319_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	71.6	4.2e-292
WP_032454094.1|705335_705815_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.1	4.5e-65
WP_062920444.1|705814_706975_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.2	2.4e-173
WP_071891073.1|707023_707431_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.4	5.9e-26
WP_032454093.1|707523_707742_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	84.7	1.0e-32
WP_002917636.1|708110_708617_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
707915:707955	attR	GGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_004174339.1|708716_710558_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_004149864.1|710776_712522_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|712633_712849_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_040215074.1|713086_714100_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	1.1e-108
>prophage 3
NZ_CP012744	Klebsiella pneumoniae subsp. pneumoniae strain TGH10 chromosome, complete genome	5355459	1015479	1021837	5355459		Salmonella_phage(50.0%)	6	NA	NA
WP_062920494.1|1015479_1017822_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	39.7	8.7e-146
WP_062920495.1|1018826_1019435_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	62.3	8.2e-56
WP_062920496.1|1019435_1019741_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	58.3	1.4e-27
WP_062920497.1|1019743_1020823_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	52.0	2.0e-97
WP_062920498.1|1020826_1021168_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	55.8	8.5e-18
WP_062920499.1|1021177_1021837_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	51.1	8.9e-56
>prophage 4
NZ_CP012744	Klebsiella pneumoniae subsp. pneumoniae strain TGH10 chromosome, complete genome	5355459	1370335	1408206	5355459	integrase,tail,terminase	Salmonella_phage(41.46%)	50	1365931:1365946	1379112:1379127
1365931:1365946	attL	ATGAAACTTGATCGCG	NA	NA	NA	NA
WP_004151980.1|1370335_1371802_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1371869_1373447_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_040025481.1|1373638_1374889_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.6	1.3e-204
WP_040025484.1|1374905_1375097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040025485.1|1375093_1375687_-	adenine methylase	NA	T1SA14	Salmonella_phage	90.4	1.8e-108
WP_040025486.1|1375683_1376334_-	hypothetical protein	NA	R9VWB9	Serratia_phage	47.8	1.7e-51
WP_040025488.1|1376330_1376489_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.0	5.6e-17
WP_040025490.1|1376481_1376775_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	70.1	8.9e-32
WP_004144294.1|1376884_1377133_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_040025492.1|1377181_1378117_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	76.7	2.0e-141
WP_040025495.1|1378113_1378935_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A193GYK2	Enterobacter_phage	80.6	5.6e-132
WP_040025497.1|1378931_1379231_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	55.6	9.4e-21
1379112:1379127	attR	ATGAAACTTGATCGCG	NA	NA	NA	NA
WP_004164037.1|1379227_1379377_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_040025499.1|1379597_1380179_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	3.5e-64
WP_004152538.1|1380333_1380567_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1380713_1380923_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1380922_1381690_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_052915161.1|1381686_1382472_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.0	1.2e-131
WP_062920554.1|1382591_1382936_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	5.3e-52
WP_064144943.1|1383128_1383575_+	hypothetical protein	NA	K7P858	Enterobacteria_phage	41.8	1.1e-17
WP_062920556.1|1383571_1383778_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	97.1	5.3e-31
WP_062921080.1|1383894_1384278_+	hypothetical protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	77.5	7.0e-37
WP_062920557.1|1384278_1384659_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	94.4	1.8e-64
WP_062920559.1|1385305_1385557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064144922.1|1385553_1385748_+	hypothetical protein	NA	C6ZR26	Salmonella_phage	76.7	2.2e-10
WP_062920561.1|1386115_1386454_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.9	4.7e-45
WP_032418540.1|1386528_1386786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032457429.1|1386863_1387448_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	89.1	5.8e-91
WP_062920562.1|1387444_1388920_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.4	7.1e-279
WP_004152473.1|1388963_1389485_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_004152472.1|1390190_1390394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152471.1|1390397_1392077_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
WP_004152470.1|1392073_1392379_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_019404949.1|1392381_1393059_+	peptidase	NA	T1SAP9	Salmonella_phage	63.6	2.0e-50
WP_004197367.1|1393071_1394079_+	bbp17	NA	T1S9H9	Salmonella_phage	92.8	2.1e-181
WP_004152466.1|1394088_1394481_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004152465.1|1394473_1394752_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_004153043.1|1394800_1395412_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
WP_004152463.1|1395411_1397889_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	3.6e-267
WP_004152462.1|1397890_1398361_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
WP_004152461.1|1398353_1398851_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	40.5	5.7e-23
WP_004152460.1|1398863_1401608_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	9.1e-94
WP_004152459.1|1401607_1404997_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
WP_004152458.1|1405006_1405621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152457.1|1405895_1406294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152456.1|1406298_1406481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152455.1|1406671_1407367_-	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	52.7	4.4e-61
WP_157833602.1|1407450_1407639_-	ash family protein	NA	NA	NA	NA	NA
WP_004152454.1|1407747_1407945_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_004152453.1|1407948_1408206_-	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
>prophage 5
NZ_CP012744	Klebsiella pneumoniae subsp. pneumoniae strain TGH10 chromosome, complete genome	5355459	1997227	2053478	5355459	plate,transposase,protease	Staphylococcus_phage(18.18%)	55	NA	NA
WP_032425077.1|1997227_1997974_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_032425076.1|1998412_1999399_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004145488.1|2000230_2000353_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_004219597.1|2000650_2000794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023286625.1|2000970_2001912_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2002005_2002995_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2003020_2004352_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_032425074.1|2004379_2005588_+	propionate kinase	NA	NA	NA	NA	NA
WP_032425474.1|2005616_2007911_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	7.4e-158
WP_004225356.1|2007962_2008109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189329.1|2008398_2009457_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|2009566_2010481_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_060614333.1|2010490_2011777_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_032425073.1|2011773_2012649_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_004175491.1|2012645_2013365_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|2013370_2014264_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180410.1|2014547_2016191_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|2016240_2016717_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020801827.1|2016815_2017742_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032425072.1|2018045_2019341_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	7.4e-62
WP_020801945.1|2020120_2021020_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2021129_2021612_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004197491.1|2021802_2022501_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910652.1|2022526_2023066_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2023180_2023510_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004899025.1|2024078_2025419_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004184632.1|2025415_2026069_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032425071.1|2026072_2027770_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032425070.1|2028228_2030715_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_062920637.1|2030738_2032070_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_072198477.1|2032114_2033083_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.9e-172
WP_032425068.1|2033159_2033669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2033665_2034172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|2034266_2034419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032423970.1|2034408_2034918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032425067.1|2035211_2036567_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_004200304.1|2036567_2037077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015958632.1|2037073_2037580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160538917.1|2037655_2037847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072198474.1|2038041_2039070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015958629.1|2039093_2039399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614315.1|2039420_2040314_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	1.1e-13
WP_032410376.1|2040359_2040476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016946122.1|2040497_2041391_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_038435084.1|2041416_2041545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184615.1|2041566_2042460_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.2e-12
WP_162487910.1|2042755_2042989_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_014343198.1|2042952_2043525_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	33.3	3.9e-07
WP_072093174.1|2044262_2044448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2044745_2045012_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032411808.1|2046161_2049572_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_032411805.1|2049705_2051469_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_074442384.1|2051498_2052515_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_020806091.1|2052495_2053032_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004175538.1|2053034_2053478_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 6
NZ_CP012744	Klebsiella pneumoniae subsp. pneumoniae strain TGH10 chromosome, complete genome	5355459	2721045	2731930	5355459		Escherichia_phage(87.5%)	9	NA	NA
WP_062923782.1|2721045_2724153_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|2724207_2725473_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2725502_2726591_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_062920746.1|2726677_2726938_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	4.6e-40
WP_001620095.1|2727234_2728095_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|2728115_2728877_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2729137_2730040_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_062920747.1|2730051_2731317_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	98.8	5.6e-232
WP_002210516.1|2731309_2731930_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP012744	Klebsiella pneumoniae subsp. pneumoniae strain TGH10 chromosome, complete genome	5355459	2927164	2992108	5355459	plate,tail,holin,terminase,transposase	Klebsiella_phage(26.67%)	68	NA	NA
WP_004176418.1|2927164_2928250_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_062920772.1|2928213_2929554_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_022631448.1|2929630_2930101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040215798.1|2931183_2932782_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_153591593.1|2932778_2936285_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_020324630.1|2936233_2937442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071531917.1|2938188_2938683_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_087638354.1|2938888_2939987_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	7.4e-47
WP_071579625.1|2940179_2940701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015958252.1|2940880_2941648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062920773.1|2941634_2943653_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_071891117.1|2943688_2944051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020323827.1|2944445_2944721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039110600.1|2946437_2946986_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	95.6	6.0e-90
WP_039110598.1|2947078_2948842_+	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	85.0	6.1e-51
WP_039110597.1|2948852_2949599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087831371.1|2949685_2952820_-	SGNH/GDSL hydrolase family protein	NA	A0A1I9SEN3	Klebsiella_phage	32.3	1.7e-104
WP_039110596.1|2952914_2955983_-	kinase	NA	A0A286S259	Klebsiella_phage	97.2	0.0e+00
WP_004152651.1|2955979_2956360_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_039110595.1|2956369_2956852_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	95.6	4.1e-82
WP_039110593.1|2957032_2957497_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	1.5e-57
WP_039110591.1|2957496_2960379_-|tail	phage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.0	1.7e-98
WP_032416607.1|2960452_2960821_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	42.9	3.3e-15
WP_004217333.1|2960931_2961288_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_008807842.1|2961364_2961571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008807841.1|2961708_2962191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031591823.1|2962244_2963417_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	9.4e-24
WP_004190640.1|2963440_2963833_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_039110587.1|2963829_2964381_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	2.3e-28
WP_004217344.1|2964382_2964766_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_040246471.1|2964752_2964986_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	4.4e-10
WP_004190649.1|2964995_2965250_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_023300922.1|2965251_2965647_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
WP_129321712.1|2965687_2965960_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_004190653.1|2965968_2966922_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_032423789.1|2966932_2967718_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.7e-66
WP_004227000.1|2967831_2968008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039110586.1|2968248_2969361_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	55.1	2.5e-111
WP_008807834.1|2969344_2970745_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.3	9.2e-127
WP_004190663.1|2970744_2972052_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_008807832.1|2972029_2973022_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	35.3	1.3e-29
WP_004218558.1|2973884_2974130_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_023313108.1|2975088_2975364_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	43.8	4.7e-11
WP_039110584.1|2975360_2975708_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	69.6	1.6e-35
WP_023301209.1|2975704_2976244_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	7.4e-101
WP_031281240.1|2976240_2976540_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	98.0	1.9e-45
WP_049001106.1|2977152_2977599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805457.1|2977504_2977762_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	96.5	5.4e-41
WP_023287514.1|2978096_2978918_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
WP_020804605.1|2979033_2979390_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	63.2	3.3e-41
WP_020804598.1|2979386_2979683_-	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	74.5	1.7e-35
WP_020804595.1|2979891_2980488_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	2.2e-90
WP_004184503.1|2980866_2981100_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_062920774.1|2982058_2982406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804596.1|2982501_2982930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804600.1|2982933_2983155_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.3e-11
WP_020804604.1|2983151_2983406_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.6	1.4e-09
WP_020804603.1|2983398_2983602_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	3.8e-26
WP_039110576.1|2983598_2984384_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	4.8e-64
WP_032417027.1|2984376_2984712_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	1.3e-10
WP_032417026.1|2984719_2985469_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
WP_023286278.1|2985471_2986380_-	hypothetical protein	NA	V5URT9	Shigella_phage	54.1	1.7e-89
WP_020804480.1|2986394_2986583_-	ClpX C4-type zinc finger	NA	NA	NA	NA	NA
WP_023287506.1|2986670_2987207_-	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	70.4	2.1e-63
WP_029503646.1|2987209_2987443_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
WP_039110572.1|2987547_2987943_+	helix-turn-helix transcriptional regulator	NA	K7PM35	Enterobacteria_phage	74.0	1.4e-48
WP_136085610.1|2987960_2988059_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_074177544.1|2989597_2992108_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.2	1.1e-18
>prophage 8
NZ_CP012744	Klebsiella pneumoniae subsp. pneumoniae strain TGH10 chromosome, complete genome	5355459	3053527	3068007	5355459	integrase	Salmonella_phage(36.36%)	14	3053309:3053324	3065313:3065328
3053309:3053324	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_039110606.1|3053527_3054196_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	4.0e-80
WP_113706523.1|3054396_3055305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039110604.1|3055977_3057243_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.0	7.6e-205
WP_002901812.1|3057244_3057664_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_022631177.1|3058190_3058499_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	62.2	1.7e-25
WP_004179600.1|3058795_3058987_+	YebW family protein	NA	NA	NA	NA	NA
WP_012967861.1|3058995_3059151_+	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	75.0	1.2e-14
WP_039110567.1|3059288_3062327_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	57.0	3.0e-292
WP_062920787.1|3062339_3063449_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.4	6.5e-184
WP_071891120.1|3063489_3063729_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	68.8	2.3e-22
WP_038807825.1|3063949_3065167_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	5.6e-120
WP_004151901.1|3065313_3066204_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3065313:3065328	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3066203_3067196_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3067197_3068007_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 9
NZ_CP012744	Klebsiella pneumoniae subsp. pneumoniae strain TGH10 chromosome, complete genome	5355459	3442669	3531044	5355459	plate,head,integrase,tail,capsid,tRNA,terminase,protease,lysis,portal	Salmonella_phage(58.33%)	91	3481261:3481276	3533477:3533492
WP_002898139.1|3442669_3443962_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_032419141.1|3444052_3445396_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3445404_3446016_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_062920821.1|3446138_3450392_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3450527_3451022_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|3451554_3452523_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_062920822.1|3452637_3454404_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	26.2	1.0e-21
WP_062920823.1|3454404_3456126_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.0	9.0e-15
WP_002898014.1|3456170_3456872_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3457225_3457444_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3457563_3459843_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3459873_3460191_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3460516_3460738_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3460814_3462755_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3462751_3463867_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004176693.1|3464013_3465672_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3466091_3466787_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3466902_3467802_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_004176696.1|3467945_3469598_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_004147771.1|3469608_3470577_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_062920824.1|3470788_3471223_-	DoxX family protein	NA	NA	NA	NA	NA
WP_004176700.1|3471374_3473093_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_004176702.1|3473131_3474133_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_062920825.1|3474143_3475586_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3475673_3476687_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004209681.1|3476683_3477514_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_062920826.1|3477545_3478685_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3479562_3480078_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3480304_3481033_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3481053_3481785_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
3481261:3481276	attL	GACAGCCTGATCCCGG	NA	NA	NA	NA
WP_002896386.1|3481791_3482508_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004191163.1|3482507_3483176_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_062920827.1|3483359_3484091_+	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_019704675.1|3484177_3485650_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	1.8e-27
WP_002896380.1|3485646_3486363_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_062920828.1|3486441_3487569_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.8e-19
WP_002896376.1|3487610_3488099_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3488156_3489002_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3488998_3489952_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3489962_3491096_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_062920829.1|3491259_3492372_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3492720_3493200_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3493288_3494191_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_008805812.1|3494365_3494653_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3494855_3495119_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3495125_3495509_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_004147745.1|3495775_3497461_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3497682_3497901_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_021566199.1|3497991_3499092_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	5.5e-175
WP_000980414.1|3499088_3499574_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	1.8e-66
WP_062920830.1|3499570_3502648_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000763311.1|3502640_3502760_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3502774_3503077_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|3503131_3503647_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001555854.1|3503656_3504829_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	4.6e-204
WP_001555853.1|3504971_3505538_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	2.2e-87
WP_062923791.1|3505695_3506898_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	80.2	5.6e-173
WP_001086820.1|3506894_3507500_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_021532224.1|3507492_3508401_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.2e-143
WP_000177580.1|3508387_3508747_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_038430657.1|3508743_3509322_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	84.9	3.0e-92
WP_038431118.1|3509448_3510960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031591600.1|3511047_3511512_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.6	5.5e-60
WP_038431116.1|3511504_3511936_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	2.2e-71
WP_038431114.1|3512031_3512460_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	1.9e-59
WP_038431112.1|3512456_3512972_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.2	1.8e-88
WP_000171568.1|3512952_3513168_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_038431109.1|3513171_3513375_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	3.0e-31
WP_000673530.1|3513374_3513839_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_021563628.1|3513934_3514585_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_032427925.1|3514588_3515644_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.7e-181
WP_002895967.1|3515660_3516494_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_031591583.1|3516636_3518403_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_038431107.1|3518402_3519431_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	86.7	4.9e-170
WP_038431152.1|3519461_3521114_-	NTPase	NA	X2KLG0	Campylobacter_phage	27.8	2.1e-13
WP_016529210.1|3521315_3522158_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.5	1.3e-59
WP_016529211.1|3522157_3522376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016529212.1|3522662_3522896_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	89.6	1.1e-32
WP_001154434.1|3522906_3523095_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_038431106.1|3523248_3525663_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
WP_032291301.1|3525659_3526517_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.5	4.3e-159
WP_000145290.1|3526513_3526816_-	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
WP_000752613.1|3526812_3527040_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244228.1|3527039_3527273_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_001747374.1|3527340_3527682_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
WP_000956187.1|3527799_3528096_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.3	2.2e-22
WP_000460893.1|3528103_3528613_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188450.1|3528677_3528881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346406.1|3529026_3529596_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.2e-38
WP_000900883.1|3529611_3529803_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001763838.1|3530063_3531044_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.5	4.8e-98
3533477:3533492	attR	GACAGCCTGATCCCGG	NA	NA	NA	NA
>prophage 10
NZ_CP012744	Klebsiella pneumoniae subsp. pneumoniae strain TGH10 chromosome, complete genome	5355459	3970550	4019492	5355459	plate,tail,tRNA,terminase,lysis	uncultured_Caudovirales_phage(25.42%)	77	NA	NA
WP_062920886.1|3970550_3970868_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	1.4e-22
WP_062920887.1|3970867_3971107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062920888.1|3971539_3971761_-	hypothetical protein	NA	A0A2H4YGX6	Raoultella_phage	91.8	8.7e-32
WP_062920889.1|3971774_3973400_-	hypothetical protein	NA	A0A0C5AFR8	Klebsiella_phage	94.6	1.5e-309
WP_062920890.1|3973412_3975308_-	hypothetical protein	NA	A0A0C5ACP6	Klebsiella_phage	91.1	1.2e-249
WP_029498896.1|3975331_3975910_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	51.8	6.4e-50
WP_077265686.1|3976242_3976977_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	46.1	1.7e-31
WP_062920892.1|3976958_3977732_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	49.8	2.2e-66
WP_062920893.1|3977728_3978928_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	75.2	5.8e-162
WP_004152573.1|3978927_3979281_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_062920894.1|3979282_3979936_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	51.2	4.1e-61
WP_048322149.1|3980023_3980776_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	55.6	4.7e-61
WP_062920895.1|3980848_3981469_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	38.5	4.2e-31
WP_048322151.1|3981514_3981694_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_048322152.1|3981775_3981994_+	Arc family DNA-binding protein	NA	A0A0M5M1J2	Salmonella_phage	41.8	3.6e-06
WP_062920896.1|3982036_3982387_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	41.6	5.5e-20
WP_062920897.1|3982383_3983412_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	53.1	1.9e-97
WP_074442389.1|3983414_3983642_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.3	1.6e-20
WP_062920899.1|3983717_3984317_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	1.3e-53
WP_062920900.1|3984316_3986335_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	56.7	7.6e-207
WP_016244729.1|3986324_3986477_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_062920901.1|3986518_3986938_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	65.9	5.1e-41
WP_062920902.1|3986941_3987385_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	9.5e-62
WP_062920903.1|3987394_3988540_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.4	2.8e-166
WP_062920904.1|3988543_3988984_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.0	6.0e-40
WP_062920905.1|3989078_3989465_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	76.6	6.8e-48
WP_062920906.1|3989464_3990082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038435200.1|3990078_3990498_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	61.5	2.0e-40
WP_062920907.1|3990466_3990748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062920908.1|3990787_3991729_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	75.8	1.6e-135
WP_062920909.1|3991740_3992235_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	63.4	8.4e-51
WP_062920910.1|3992238_3993441_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.9	3.6e-111
WP_062920911.1|3993492_3994041_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	2.3e-49
WP_062920912.1|3994096_3995548_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.6	1.9e-191
WP_021312714.1|3995786_3997187_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	9.4e-188
WP_004218030.1|3997137_3997626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167875427.1|3998001_3998178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062920914.1|3998279_3998747_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	72.9	2.7e-54
WP_062920915.1|3998743_3999247_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	80.2	5.5e-74
WP_004146347.1|3999249_3999564_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_062920916.1|4000013_4000703_-	antiterminator	NA	I6PDF8	Cronobacter_phage	55.8	4.5e-58
WP_114139929.1|4000699_4001461_-	YlcG family protein	NA	M9NYX8	Enterobacteria_phage	76.1	2.6e-75
WP_062920917.1|4001453_4002122_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	80.1	1.7e-107
WP_071891127.1|4002118_4002286_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	64.8	2.1e-09
WP_062920918.1|4002285_4002741_-	YbcN family protein	NA	K7P7B8	Enterobacteria_phage	69.5	1.8e-55
WP_062920919.1|4002993_4003302_-	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	54.1	2.2e-20
WP_062920921.1|4003482_4003680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077257772.1|4004229_4004394_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_071891130.1|4004393_4004969_-	ead/Ea22-like family protein	NA	Q858D0	Salmonella_phage	54.4	2.6e-43
WP_062920923.1|4004965_4005370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062920924.1|4005366_4005876_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	32.0	1.7e-06
WP_062920925.1|4005872_4006097_-	hypothetical protein	NA	H9C169	Pectobacterium_phage	50.7	1.8e-13
WP_062920926.1|4006093_4006396_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062920927.1|4006395_4007172_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	65.4	1.4e-95
WP_023304897.1|4007168_4007897_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.0	7.8e-37
WP_004139615.1|4008030_4008252_-	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_004191589.1|4008291_4008510_-	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.4e-13
WP_021312733.1|4008618_4009278_+	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	61.5	1.9e-69
WP_160538933.1|4009632_4009791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807814.1|4009783_4009990_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_062920928.1|4010069_4011041_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	76.8	3.8e-39
WP_062920929.1|4011048_4011246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004177104.1|4011242_4011401_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	60.0	4.5e-06
WP_009483856.1|4011397_4012051_+	ERF family protein	NA	A0A1W6JP21	Morganella_phage	62.3	4.0e-64
WP_062920930.1|4012034_4012325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062920931.1|4012321_4012627_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062920932.1|4012623_4013280_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	86.9	2.3e-112
WP_009483861.1|4013276_4013495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062920933.1|4013491_4013764_+	hypothetical protein	NA	Q716F1	Shigella_phage	63.5	1.1e-23
WP_062920934.1|4013760_4014516_+	hypothetical protein	NA	R9VWB9	Serratia_phage	57.1	8.6e-71
WP_062920935.1|4014512_4014704_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	59.3	1.1e-11
WP_062920936.1|4014700_4014922_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
WP_029497251.1|4014921_4015161_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	47.4	2.4e-11
WP_071891156.1|4015173_4015509_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004143017.1|4016980_4017847_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|4017848_4018061_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4018106_4019492_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
