The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007591	Mycoplasma bovis strain HB0801-P180, complete genome	977257	77389	88750	977257	tRNA	Bodo_saltans_virus(28.57%)	8	NA	NA
WP_013954527.1|77389_78370_+	lipoyltransferase	NA	A0A2H4UVX5	Bodo_saltans_virus	27.1	3.9e-15
WP_013954528.1|78373_79195_+	alpha/beta hydrolase	NA	G9E3U1	Emiliania_huxleyi_virus	32.5	2.3e-08
WP_013954529.1|79278_80043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954530.1|80035_81016_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	40.6	8.1e-53
WP_013954531.1|81140_85517_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	31.8	6.2e-12
WP_013954532.1|85922_87146_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	35.1	1.5e-61
WP_013456569.1|87135_88101_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	40.9	3.6e-29
WP_013954533.1|88090_88750_+	uracil-DNA glycosylase	NA	A0A068EP41	Falconid_herpesvirus	36.4	1.6e-28
>prophage 2
NZ_CP007591	Mycoplasma bovis strain HB0801-P180, complete genome	977257	147596	157203	977257	transposase	Mycoplasma_phage(57.14%)	7	NA	NA
WP_013455927.1|147596_148613_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
WP_014829869.1|148940_150782_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	19.1	2.7e-17
WP_062931844.1|151043_152456_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	68.7	1.6e-81
WP_013954582.1|152439_153276_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	62.0	1.5e-87
WP_013954583.1|153268_154162_+	spermidine/putrescine ABC transporter permease	NA	Q6GZ01	Mycoplasma_phage	62.1	2.1e-92
WP_013954584.1|154148_156050_+	membrane protein	NA	Q6GZ00	Mycoplasma_phage	34.7	1.8e-80
WP_013455927.1|156186_157203_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
>prophage 3
NZ_CP007591	Mycoplasma bovis strain HB0801-P180, complete genome	977257	213263	299463	977257	integrase,tRNA,transposase	Bacillus_virus(13.33%)	58	276280:276328	285111:285159
WP_078086163.1|213263_214292_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_014829880.1|216003_216195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014829881.1|216308_217742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062931850.1|217840_218197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014829883.1|218379_219711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041323925.1|219704_222020_-	membrane protein	NA	NA	NA	NA	NA
WP_013954624.1|222194_222644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954625.1|222965_224807_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_049773792.1|225355_227071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954628.1|227214_228234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954629.1|228234_228783_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_013954630.1|229422_230820_+	colicin V production protein CvpA	NA	NA	NA	NA	NA
WP_013954631.1|230933_232850_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.9	5.7e-119
WP_013954632.1|232863_235449_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	29.6	9.8e-90
WP_013954633.1|235590_236520_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_013954635.1|237424_238399_+	DNA (cytosine-5-)-methyltransferase	NA	R4TMW4	Halovirus	38.4	1.6e-48
WP_013954636.1|238391_239099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456076.1|239568_239898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062931851.1|240818_241805_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.0	5.8e-43
WP_013954642.1|242022_242745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038582854.1|243348_244116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954646.1|244799_245744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954647.1|245842_247789_+	transketolase	NA	NA	NA	NA	NA
WP_013954648.1|247851_248406_-	inorganic pyrophosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.1	2.1e-21
WP_013456603.1|248484_248754_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_013954649.1|248867_249455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954650.1|249548_251717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954651.1|251728_253111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954652.1|253110_253446_+	HIT family protein	NA	B5LJ12	Mycobacterium_phage	33.8	3.6e-05
WP_013954653.1|253564_254263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004024364.1|254316_254469_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_013456491.1|254934_255420_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_013456378.1|255457_255694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954656.1|256814_257099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014829889.1|257120_258671_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	35.7	1.9e-80
WP_013954658.1|258673_259480_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_013456627.1|259479_261669_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	1.0e-71
WP_013456572.1|261671_261914_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_013456283.1|262256_262844_+	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	38.6	1.2e-08
WP_013456579.1|262849_263602_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_013456585.1|264628_265474_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_013455939.1|265460_266123_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_013954660.1|267057_268446_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954661.1|268614_270840_-	recombinase RecD	NA	A0A218KCE8	Bacillus_phage	27.7	3.4e-30
WP_013456112.1|270985_272419_-|transposase	transposase	transposase	NA	NA	NA	NA
276280:276328	attL	ATAATTATGTTTTCTTGTTTTATGCTTAAACTGGGAAACGTAGGAAAAT	NA	NA	NA	NA
WP_013954664.1|276434_279575_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.8	2.3e-24
WP_013954665.1|279576_281217_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_013954666.1|281203_281755_+	C-terminal truncated type I restriction modification DNA specificity domain-containing protein	NA	NA	NA	NA	NA
WP_013954667.1|281751_282444_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013954668.1|282622_283798_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013954669.1|283871_284840_+|integrase	integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.2	3.8e-31
WP_081113494.1|287325_287805_+	hypothetical protein	NA	NA	NA	NA	NA
285111:285159	attR	ATTTTCCTACGTTTCCCAGTTTAAGCATAAAACAAGAAAACATAATTAT	NA	NA	NA	NA
WP_013954672.1|288099_289257_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013954673.1|290202_291822_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	39.8	5.9e-109
WP_013954674.1|292061_294728_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	27.3	4.2e-80
WP_013954675.1|294740_295451_+	signal peptidase II	NA	NA	NA	NA	NA
WP_078086167.1|295711_297313_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013954660.1|298074_299463_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP007591	Mycoplasma bovis strain HB0801-P180, complete genome	977257	325942	417018	977257	tRNA,transposase	Enterobacteria_phage(12.5%)	53	NA	NA
WP_013954690.1|325942_327211_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_013954691.1|327236_328481_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	5.3e-09
WP_013456216.1|328922_330272_+	NADH oxidase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	1.0e-13
WP_013954692.1|330264_331875_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_013954693.1|331940_333380_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_013954694.1|333491_335579_-	peptidase S41	NA	NA	NA	NA	NA
WP_013954695.1|335542_336934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954696.1|336936_339246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954697.1|339564_340926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954698.1|341445_342279_+	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	45.7	3.6e-54
WP_013954699.1|342585_343539_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_013954700.1|343588_344485_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_013954701.1|344518_346393_-	peptidase S41	NA	NA	NA	NA	NA
WP_078086169.1|351028_352630_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013954705.1|352759_353545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954706.1|353549_355079_-	RNA polymerase sigma factor	NA	G8CLC7	Synechococcus_phage	33.7	2.0e-29
WP_013954708.1|357052_358429_-|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	32.0	3.9e-53
WP_013954710.1|360776_362132_+	alkylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013456298.1|362134_363067_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	1.3e-07
WP_013456124.1|363030_364782_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013456114.1|364888_365134_-	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_013456030.1|365214_367728_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_038582866.1|367970_369017_+	alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	26.9	1.0e-13
WP_013954712.1|369165_371004_-	type I DNA topoisomerase	NA	A0A2P1ELA0	Moumouvirus	32.1	4.8e-75
WP_013456432.1|371383_371821_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_013456362.1|371862_372261_+	single-stranded DNA-binding protein	NA	A0A0H3U4B5	Staphylococcus_phage	30.3	9.3e-08
WP_062931854.1|372315_372606_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_013954713.1|372740_374069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078086163.1|374307_375336_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.3	6.5e-21
WP_013456295.1|375678_376134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954716.1|378092_379409_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L0H9	Tupanvirus	25.1	2.7e-11
WP_013456122.1|379477_381181_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	23.1	2.0e-14
WP_013954717.1|381264_382509_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	27.0	4.1e-09
WP_013456084.1|382607_383399_-	aquaporin family protein	NA	M1HQW3	Paramecium_bursaria_Chlorella_virus	27.5	7.3e-12
WP_013954718.1|383407_384916_-	glycerol kinase	NA	NA	NA	NA	NA
WP_013456345.1|385204_386596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954719.1|386728_387730_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_062931855.1|387731_388700_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_013456470.1|388813_389557_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_013456409.1|389736_390021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456558.1|390013_391660_+	phosphatase	NA	NA	NA	NA	NA
WP_013456463.1|391666_392671_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_013456004.1|392663_393338_+	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	31.9	1.2e-18
WP_013954720.1|393411_396390_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_013954721.1|396442_397795_-	YitT family protein	NA	NA	NA	NA	NA
WP_013954722.1|397889_398726_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_013954723.1|398712_399444_-	DNA processing protein DprA	NA	NA	NA	NA	NA
WP_014829908.1|401035_401986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954727.1|405275_412307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954730.1|413019_413220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014829909.1|413339_414071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954734.1|414868_415651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078086171.1|415989_417018_-|transposase	IS30-like element ISMbov1 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	33.0	5.0e-21
