The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015020	Escherichia coli strain 28RC1 chromosome, complete genome	5561698	5983	60749	5561698	tail,protease,tRNA	Enterobacteria_phage(50.0%)	56	NA	NA
WP_077881353.1|5983_6154_+	hypothetical protein	NA	Q687F6	Enterobacteria_phage	100.0	1.6e-22
WP_033800278.1|6131_6737_+	Ig domain-containing protein	NA	Q687F6	Enterobacteria_phage	100.0	2.8e-104
WP_000479043.1|6750_7173_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|7199_7508_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918269.1|7551_10197_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|10193_10523_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|10522_11221_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_001444516.1|11231_11975_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	1.7e-148
WP_122996286.1|11920_12553_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_000514851.1|12799_16276_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_001230455.1|16343_16943_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_062946119.1|17007_18321_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	6.9e-76
WP_001023407.1|18322_18592_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_122988840.1|18702_18780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993326.1|18994_20008_+	M85 family metallopeptidase	NA	NA	NA	NA	NA
WP_001261931.1|20379_20628_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	1.2e-37
WP_000891621.1|20945_21512_-	hydrolase	NA	NA	NA	NA	NA
WP_001258685.1|21821_23594_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001300367.1|23711_24164_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|24192_24933_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|24967_25489_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024949.1|25490_26093_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_010723105.1|26163_26229_+	stress response small protein YobI	NA	NA	NA	NA	NA
WP_000580323.1|26367_26979_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|26987_27998_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571476.1|28243_29029_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|29025_29781_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001303192.1|29859_30792_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|30807_32130_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_000448391.1|32249_33221_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091169.1|33351_34794_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_001056694.1|34921_35791_-	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000301737.1|36128_37604_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001069467.1|37838_39650_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800512.1|39686_40328_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173471.1|40383_41562_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257738.1|41695_41986_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001295500.1|42052_42409_+	protein YebF	NA	NA	NA	NA	NA
WP_000024742.1|42735_43395_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936917.1|43603_45664_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944244.1|45660_46323_-	exodeoxyribonuclease X	NA	NA	NA	NA	NA
WP_000011656.1|46346_47003_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|47104_47335_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000168751.1|47473_47848_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_062946120.1|47851_48724_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976483.1|48736_49078_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812736.1|49473_50130_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	6.8e-56
WP_001296140.1|50130_50322_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|50426_50663_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001302304.1|50780_52220_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001302055.1|52300_54934_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207282.1|54902_56186_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001043882.1|56315_56813_+	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_000431368.1|56909_57608_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001055778.1|57627_59676_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000984517.1|59867_60749_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 2
NZ_CP015020	Escherichia coli strain 28RC1 chromosome, complete genome	5561698	300371	416543	5561698	holin,portal,tail,protease,transposase,head,capsid,terminase	Stx2-converting_phage(40.57%)	134	NA	NA
WP_001260835.1|300371_301193_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|301292_301376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|301468_301804_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|302200_303454_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|303560_304454_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|304588_305809_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|305933_306629_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|306581_307874_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|308031_308646_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|308688_309543_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|309544_310162_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|310172_312596_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|312656_315083_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|315281_315587_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|315694_316405_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|316407_316968_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|317002_317344_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|317478_317805_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|318793_319045_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|319117_321589_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|321681_321873_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|321869_322058_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171930.1|322626_322845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|322916_323216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|323567_323846_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|323847_324039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|324059_324431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|324528_324831_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|324827_325253_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|325275_326238_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|326244_326985_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_062946123.1|327795_328155_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	49.2	1.6e-19
WP_162829348.1|328157_329371_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000206793.1|329561_330146_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|330261_330366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|330554_330767_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|330934_331213_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_062946124.1|331214_332264_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	4.2e-108
WP_001217455.1|332276_332636_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|332632_333322_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|333958_334387_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|334865_336716_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|337155_337371_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|337375_337720_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|337770_338304_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|338574_339144_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|339143_339290_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|339517_339703_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|340127_340355_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|340396_340762_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958360.1|341051_341615_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	99.5	6.2e-90
WP_001301491.1|341611_343273_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|343336_345274_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|345318_345540_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001356761.1|345485_348065_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.0	0.0e+00
WP_000125988.1|348067_348394_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|348403_348754_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|348750_349197_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|349193_349538_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|349603_350320_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|350334_350709_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|350804_351014_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_062946125.1|351061_354304_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.7	0.0e+00
WP_000807954.1|354296_354638_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_077881354.1|354637_355075_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	99.2	1.5e-62
WP_062946126.1|355262_358739_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.3	0.0e+00
WP_001230508.1|358806_359406_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|359470_360694_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|360695_360965_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|361078_361654_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|362364_363015_+	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|363597_365136_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|365185_365533_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|365529_365910_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001120551.1|366872_367115_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|367825_369070_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|369162_369351_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|369347_369536_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|370100_370310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|370310_370949_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|370960_371113_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|371405_371744_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|372135_372378_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|372361_372787_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001356791.1|372855_373911_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	84.7	1.6e-83
WP_000139447.1|373903_374365_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|374398_375115_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|375147_375429_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|375425_375653_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|375645_375957_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|376084_376303_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|376304_376862_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|377095_377308_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|377427_377772_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191871.1|377893_378166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265229.1|378167_379217_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|379229_379535_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|379597_380152_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|380376_380574_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|380709_381423_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|381873_382305_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|382782_384633_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|385071_385287_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|385291_385636_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|385686_386220_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|386490_387060_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|387059_387206_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|387433_387619_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|388043_388271_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|388312_388678_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958392.1|388967_389531_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_001303179.1|389527_391189_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
WP_062946127.1|391252_393190_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.2	0.0e+00
WP_001063023.1|393234_393456_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125988.1|395496_395823_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007901.1|395832_396183_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|396179_396626_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001275508.1|397025_397742_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|397747_398122_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|398217_398427_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212925.1|398478_401721_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_000807954.1|401713_402055_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303180.1|402054_402753_+|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.4	2.9e-129
WP_000194720.1|402763_403507_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|403452_404085_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001230508.1|408573_409173_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268849.1|409237_410551_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.6	3.8e-82
WP_001023407.1|410552_410822_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|410935_411511_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|411583_412213_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|412294_412936_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|413097_413340_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000527769.1|414843_416304_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|416339_416543_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 3
NZ_CP015020	Escherichia coli strain 28RC1 chromosome, complete genome	5561698	687832	805096	5561698	holin,integrase,tail,portal,protease,lysis,terminase,tRNA	Enterobacteria_phage(42.45%)	137	707020:707037	752874:752891
WP_000422055.1|687832_688882_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|689101_689860_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|689856_690447_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|690486_691359_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|691571_693155_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|693182_693803_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|693799_694681_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|694818_694863_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|694954_696517_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|696516_698112_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|698112_699474_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|699485_700679_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|700678_701485_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|701865_702045_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|702130_702631_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|702676_703183_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001460318.1|703672_703819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032156508.1|704221_704806_-	protein kinase	NA	NA	NA	NA	NA
WP_001023406.1|705936_706206_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_062946132.1|706207_707521_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.9	5.5e-81
707020:707037	attL	CGGCTGCACTTTCTGCCG	NA	NA	NA	NA
WP_001230509.1|707585_708185_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_115801853.1|708252_710604_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_149016421.1|710555_711731_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	98.5	6.1e-233
WP_069905658.1|711971_712601_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_062946134.1|712546_713290_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.3	4.0e-145
WP_062946135.1|713295_713994_-|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.3	6.8e-131
WP_000847298.1|713993_714323_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001303163.1|714319_716965_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.7	0.0e+00
WP_000532075.1|717008_717317_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479059.1|717343_717766_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.9	1.3e-71
WP_000235090.1|717779_718532_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|718539_718938_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|718950_719574_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|719576_719858_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|719850_720177_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001365078.1|720264_722244_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.9	0.0e+00
WP_000974567.1|722233_723736_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_000102415.1|723735_723948_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077608.1|723944_726068_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000373407.1|726064_726541_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001082574.1|726954_727422_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	99.4	2.0e-78
WP_000539792.1|727429_727576_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_000087730.1|728417_728951_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_001072899.1|728955_729171_-|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|729248_729494_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143462.1|729534_729714_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_000142958.1|729850_731797_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.8	0.0e+00
WP_000935552.1|732300_733359_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	1.5e-206
WP_000917735.1|733509_733707_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762909.1|733933_734755_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.5e-81
WP_000904137.1|734751_735126_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_001265167.1|735138_736188_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.9e-108
WP_032156506.1|736189_736468_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.3e-11
WP_077625879.1|736537_736798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|737014_737227_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000373318.1|737580_738375_+	protein kinase	NA	A0A1S5V1U4	Saudi_moumouvirus	29.7	7.3e-12
WP_000789359.1|738358_739075_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001224661.1|739334_739508_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.2e-25
WP_000403785.1|739602_739959_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001118156.1|740031_740412_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.5	4.1e-29
WP_000450846.1|740427_741198_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.4	1.4e-84
WP_157837342.1|741231_741774_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_000020532.1|741685_742726_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.8e-90
WP_000705378.1|742697_743249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|743232_743460_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|743537_743945_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379610.1|744134_744287_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_000449192.1|744774_744963_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090196.1|744959_745151_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|745243_747715_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|747779_748028_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|748005_749136_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_001261931.1|749877_750126_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	1.2e-37
WP_122993326.1|750497_751511_-	M85 family metallopeptidase	NA	NA	NA	NA	NA
WP_122988840.1|751725_751803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023407.1|751913_752183_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_062946119.1|752184_753498_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.2	6.9e-76
752874:752891	attR	CGGCTGCACTTTCTGCCG	NA	NA	NA	NA
WP_001230455.1|753562_754162_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	8.8e-111
WP_000514851.1|754229_757706_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.7	0.0e+00
WP_122996286.1|757952_758585_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	97.6	1.0e-104
WP_001444516.1|758530_759274_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.0	1.7e-148
WP_001151105.1|759284_759983_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|759982_760312_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918269.1|760308_762954_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000532073.1|762997_763306_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|763332_763755_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|763768_764521_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|764528_764927_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|764939_765563_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|765565_765847_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|765839_766166_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|766253_768278_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|768222_769725_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|769724_769937_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077625.1|769933_772057_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|772053_772530_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_106379429.1|772562_772835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001082574.1|772984_773452_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	99.4	2.0e-78
WP_000539792.1|773459_773606_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|773605_774175_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087730.1|774446_774980_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.9	3.9e-102
WP_000284510.1|774984_775200_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290217.1|775276_775549_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000143462.1|775589_775769_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_062946136.1|775904_777851_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	97.4	0.0e+00
WP_000738080.1|778361_778631_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001365055.1|778642_779602_-	Shiga toxin Stx2d subunit A	NA	Q6DWN9	Enterobacteria_phage	100.0	1.6e-175
WP_000483505.1|779984_781043_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.0	2.9e-205
WP_000917741.1|781194_781392_-	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_001204809.1|781607_781988_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_001202271.1|782006_782996_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	8.9e-193
WP_001065352.1|783047_783305_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_062946137.1|783301_784702_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.2	1.4e-244
WP_000988196.1|784698_785577_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
WP_001247844.1|785587_786496_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	94.0	2.4e-59
WP_000621233.1|786482_786716_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	47.2	1.6e-12
WP_000587259.1|786712_787375_-	ash family protein	NA	Q8W643	Enterobacteria_phage	92.5	3.7e-110
WP_001090254.1|787483_788191_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	90.2	1.6e-114
WP_000944728.1|788272_788506_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_000800140.1|788662_789352_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.2	5.2e-115
WP_000387836.1|789500_790202_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	59.7	1.5e-37
WP_062946138.1|790198_790399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009453427.1|790597_790780_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	1.5e-08
WP_001365075.1|790785_791358_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	71.3	5.5e-78
WP_000720006.1|791727_792555_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	97.5	1.2e-129
WP_001484100.1|792595_792967_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.1	2.3e-61
WP_001193437.1|793158_793413_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063650.1|793446_794733_+	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	99.8	6.9e-254
WP_171880451.1|794737_795514_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	1.4e-71
WP_000252980.1|795566_795962_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|796002_796746_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564730.1|796742_797714_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176813.1|797878_800308_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214277.1|800332_801433_-	cytochrome c-type protein TorY	NA	NA	NA	NA	NA
WP_001185748.1|801820_802567_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001302537.1|802580_803147_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025318.1|803362_805096_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
>prophage 4
NZ_CP015020	Escherichia coli strain 28RC1 chromosome, complete genome	5561698	834498	854484	5561698	tail,transposase,integrase	Enterobacteria_phage(75.0%)	28	826412:826426	842952:842966
826412:826426	attL	TCAGCGCCCGGCGTT	NA	NA	NA	NA
WP_001300279.1|834498_835500_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|835505_835853_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|835882_836533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|836548_836953_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|837042_837180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|837251_837455_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|837476_837827_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|837837_838116_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|838127_838370_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|838366_838480_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|838572_838989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|839012_839216_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|839212_839479_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|839475_839775_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|839786_840404_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|840400_840766_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|840772_843595_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
842952:842966	attR	AACGCCGGGCGCTGA	NA	NA	NA	NA
WP_000686523.1|843671_844631_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|844635_844950_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_001310336.1|846041_846572_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000954203.1|846615_847188_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|847344_847833_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000333495.1|850635_850791_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665314.1|850799_851165_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|851219_851732_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|851731_852916_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|853073_853397_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161583.1|853347_854484_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 5
NZ_CP015020	Escherichia coli strain 28RC1 chromosome, complete genome	5561698	912064	979284	5561698	holin,integrase,tail,portal,transposase,head,capsid,terminase	Escherichia_phage(33.33%)	68	927863:927878	983629:983644
WP_001023455.1|912064_912334_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_062946140.1|912335_913649_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.3	9.7e-78
WP_001230508.1|913713_914313_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_062946141.1|914380_917860_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.7	0.0e+00
WP_071601640.1|918100_918730_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_000194801.1|918675_919419_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|919429_920128_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|920127_920457_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082464.1|920453_923033_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.2	0.0e+00
WP_000533402.1|923013_923427_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|923453_923885_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|923898_924639_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|924620_924887_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|924944_925292_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|925328_926834_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|926823_928416_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
927863:927878	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|928412_928619_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|930503_931013_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|931407_931632_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|931713_932028_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|932554_932740_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|932967_933099_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|933111_933294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|933449_933983_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|934033_934378_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_024165672.1|934382_934598_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_162829202.1|934908_936121_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000023257.1|936203_938054_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001303558.1|938531_938960_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_001059369.1|939593_940283_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|940279_940639_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|940651_941701_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|941702_941981_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|942148_942361_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|942547_942652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|942761_943325_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|943451_943763_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|943759_943912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|943944_944301_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|944297_944522_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|944543_945242_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|945276_945819_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|945730_946768_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|946836_947262_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|947258_947486_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|947583_948228_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|948502_948655_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|949135_949324_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|949320_949509_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|949604_952076_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|952134_952338_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|952337_953360_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|953595_954393_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_149016422.1|954882_962865_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_000480501.1|963126_964179_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|964492_965809_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|965910_967365_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|967707_968424_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|969049_970693_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|970810_971761_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_062946143.1|971862_972780_-	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_000986334.1|973236_974172_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|974233_975313_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|975324_976068_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|976064_976610_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|976971_977352_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|977348_977696_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|977745_979284_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
983629:983644	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 6
NZ_CP015020	Escherichia coli strain 28RC1 chromosome, complete genome	5561698	993949	1053673	5561698	holin,integrase,tail,portal,protease,transposase,head,capsid,lysis,terminase	Stx2-converting_phage(48.15%)	81	1007669:1007684	1056736:1056751
WP_001303036.1|993949_995116_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001121226.1|996439_997090_+	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000491542.1|997314_998190_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001023455.1|998330_998600_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_062946144.1|998601_999915_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.4	1.4e-81
WP_001230514.1|999979_1000579_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_062946145.1|1000646_1004126_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.8	0.0e+00
WP_122994717.1|1004364_1004997_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	3.1e-106
WP_000967278.1|1004942_1005680_-|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	3.8e-148
WP_001414206.1|1005734_1006658_-	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	99.3	3.2e-176
WP_001154345.1|1006728_1006902_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|1007009_1007330_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
1007669:1007684	attL	TTTTTTTATTCTTTTT	NA	NA	NA	NA
WP_000807954.1|1008072_1008414_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212920.1|1008406_1011649_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.6	0.0e+00
WP_001453698.1|1011700_1011910_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|1012005_1012380_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|1012385_1013102_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|1013160_1013505_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|1013501_1013948_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|1013944_1014295_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|1014304_1014631_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001303195.1|1014710_1017212_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.2	0.0e+00
WP_001063099.1|1017157_1017379_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|1017423_1019361_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|1019424_1021086_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_062946146.1|1021082_1021646_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	98.9	6.8e-89
WP_000279796.1|1021938_1022304_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|1022345_1022573_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_001283921.1|1023035_1023293_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|1023289_1023787_-	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092318.1|1023989_1024427_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|1024423_1024921_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000284515.1|1024920_1025136_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|1025212_1025485_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|1025525_1025705_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000143109.1|1025841_1027779_-	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.2	0.0e+00
WP_001303568.1|1028022_1028346_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|1028642_1028912_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649751.1|1028923_1029883_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000512807.1|1030532_1031021_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|1031011_1031683_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108004.1|1031679_1032285_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001004016.1|1032284_1033007_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_000849633.1|1033081_1033762_-	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_000208502.1|1034017_1034776_-	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_001254256.1|1035050_1035233_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|1035229_1035757_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|1035753_1036200_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|1036156_1036393_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|1036403_1036619_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|1036751_1037030_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_001248388.1|1037100_1038477_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_000539354.1|1038473_1039295_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_000166961.1|1039281_1039443_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_077881356.1|1039475_1039706_-	hypothetical protein	NA	Q37927	Escherichia_phage	87.9	2.2e-25
WP_162829202.1|1039704_1040917_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_062946147.1|1040920_1041085_-	Cro/Cl family transcriptional regulator	NA	A4KWW1	Enterobacteria_phage	90.0	6.9e-18
WP_000067727.1|1041226_1041442_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|1041517_1042213_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|1042714_1043236_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|1043804_1043987_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|1043964_1044237_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394299.1|1044295_1044547_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000065362.1|1044729_1045098_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|1045170_1045335_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|1045303_1045447_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|1045521_1045818_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001301718.1|1045823_1046609_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	99.6	2.4e-148
WP_032084544.1|1046605_1047286_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.6	3.5e-132
WP_000682306.1|1047282_1047465_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548544.1|1047437_1047629_+	DUF1382 family protein	NA	B6ETA2	Enterobacteria_phage	100.0	3.3e-27
WP_162829202.1|1047685_1048898_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000188870.1|1049018_1049234_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|1049332_1049554_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289930.1|1049550_1050498_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_001356547.1|1050499_1050676_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|1051009_1051366_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610373.1|1051362_1051713_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|1051900_1052245_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|1052322_1052514_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001007946.1|1052494_1053673_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
1056736:1056751	attR	AAAAAGAATAAAAAAA	NA	NA	NA	NA
>prophage 7
NZ_CP015020	Escherichia coli strain 28RC1 chromosome, complete genome	5561698	1139690	1253123	5561698	holin,integrase,tail,portal,protease,terminase,tRNA	Enterobacteria_phage(49.35%)	124	1193192:1193212	1250629:1250649
WP_000476014.1|1139690_1141052_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001303579.1|1141381_1141699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|1142104_1143004_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178551.1|1143085_1143865_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|1143964_1145005_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|1145052_1146408_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|1146411_1146696_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|1146726_1147179_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853846.1|1147188_1148451_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001301486.1|1148479_1149334_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|1149632_1150685_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000859148.1|1150941_1152219_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846238.1|1152215_1153220_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000011970.1|1153216_1154182_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|1154155_1154902_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301907.1|1154953_1155772_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000822268.1|1155836_1156637_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195634.1|1156633_1157422_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141034.1|1157755_1157995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836936.1|1159045_1159393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735648.1|1159402_1159717_+	outer membrane protein	NA	NA	NA	NA	NA
WP_000019944.1|1159826_1160099_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134629.1|1160219_1161071_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153070.1|1161288_1161627_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001301545.1|1161708_1162743_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000945390.1|1162753_1165234_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677408.1|1165249_1165924_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000682830.1|1166011_1166554_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010904812.1|1166845_1167127_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005448.1|1167388_1168498_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001301615.1|1168629_1170663_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000356841.1|1177620_1181250_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|1181311_1181629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1182869_1183958_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|1183968_1185498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|1185516_1186248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|1186240_1187377_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|1187373_1189377_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|1189501_1189963_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|1190004_1190475_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1190521_1191241_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|1191237_1192923_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
1193192:1193212	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261937.1|1193437_1193686_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023381.1|1194053_1194323_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_000268979.1|1194324_1195638_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.1	2.4e-76
WP_001228302.1|1195702_1196302_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_000514991.1|1196369_1199843_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_071601640.1|1200083_1200713_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_000194801.1|1200658_1201402_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|1201412_1202111_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|1202110_1202440_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918269.1|1202436_1205082_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000438877.1|1205125_1205434_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000479043.1|1205460_1205883_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|1205896_1206649_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|1206656_1207055_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|1207067_1207691_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|1207693_1207975_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|1207967_1208294_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|1208381_1210406_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|1210350_1211853_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|1211852_1212065_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000133409.1|1213557_1213839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000860403.1|1214096_1215986_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000126660.1|1216643_1217066_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001399692.1|1217062_1217308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761774.1|1217595_1219410_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.9	5.7e-129
WP_000728901.1|1219406_1219649_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000551748.1|1219845_1220439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335965.1|1220431_1220656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088136225.1|1220648_1221368_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_062946149.1|1221348_1221930_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	60.7	4.5e-51
WP_000229066.1|1221989_1222214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000114064.1|1222206_1223445_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_001077621.1|1223606_1224614_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_000348565.1|1224610_1225087_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_012816791.1|1225604_1225790_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|1226017_1226164_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|1226163_1226733_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|1227003_1227537_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|1227541_1227757_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|1227834_1228080_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|1228120_1228300_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142932.1|1228436_1230383_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_001356551.1|1231186_1231339_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|1231590_1232025_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|1232110_1232251_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|1232247_1232610_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774488.1|1232606_1232897_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224916.1|1232889_1233060_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054341.1|1233059_1233515_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_001303586.1|1233511_1233613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|1233729_1234527_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001302427.1|1234536_1235088_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|1235552_1237079_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_032102575.1|1237136_1237244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070451.1|1237335_1237668_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|1237735_1238038_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788810.1|1238034_1238736_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_000147876.1|1238732_1239752_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	4.0e-111
WP_001182899.1|1239748_1240288_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067457.1|1240357_1240588_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_000858974.1|1240692_1241382_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000380252.1|1241462_1242524_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|1242501_1242879_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|1243359_1243566_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|1243641_1243938_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|1243943_1244729_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|1244725_1245403_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|1245402_1245585_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|1245557_1245749_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_000188870.1|1245825_1246041_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|1246139_1246361_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001356547.1|1247304_1247481_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|1247814_1248171_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|1248167_1248530_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|1248617_1248860_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556581.1|1248863_1248998_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_001193437.1|1249016_1249271_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|1249304_1250591_+	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|1250611_1251313_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
1250629:1250649	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|1251372_1251480_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1251460_1252192_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|1252196_1253123_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 8
NZ_CP015020	Escherichia coli strain 28RC1 chromosome, complete genome	5561698	1497585	1503011	5561698	integrase	Enterobacteria_phage(50.0%)	6	1488036:1488052	1500000:1500016
1488036:1488052	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|1497585_1498518_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|1498829_1499987_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|1500161_1501298_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
1500000:1500016	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|1501307_1501988_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|1501974_1502442_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000950857.1|1502441_1503011_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
>prophage 9
NZ_CP015020	Escherichia coli strain 28RC1 chromosome, complete genome	5561698	1780589	1787642	5561698	tail,transposase	Enterobacteria_phage(50.0%)	7	NA	NA
WP_000162574.1|1780589_1781072_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|1781917_1782166_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001144077.1|1783442_1784093_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|1784171_1785230_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|1785359_1785782_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|1785942_1786212_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_162829202.1|1786429_1787642_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 10
NZ_CP015020	Escherichia coli strain 28RC1 chromosome, complete genome	5561698	3366011	3380676	5561698	tail,tRNA,integrase	Enterobacteria_phage(43.75%)	19	3367292:3367307	3384821:3384836
WP_000956557.1|3366011_3366545_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_000654815.1|3366741_3366915_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_001093918.1|3366962_3367244_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
3367292:3367307	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|3367588_3367786_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|3368121_3368406_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|3368402_3368753_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|3368743_3369280_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|3370601_3371201_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268962.1|3371265_3372579_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001023355.1|3372580_3372850_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|3372961_3373534_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|3373606_3374236_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|3374317_3374959_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|3375119_3375368_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|3375429_3376527_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|3376615_3377653_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|3377786_3378029_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|3378194_3379178_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|3379260_3380676_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
3384821:3384836	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 11
NZ_CP015020	Escherichia coli strain 28RC1 chromosome, complete genome	5561698	3517556	3576567	5561698	protease,transposase	Pectobacterium_phage(12.5%)	60	NA	NA
WP_000312488.1|3517556_3518816_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3518818_3519823_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3519904_3520102_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3520205_3521504_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|3521708_3522134_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|3522172_3524614_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|3524794_3525526_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|3525652_3526054_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|3526072_3526771_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|3526821_3527481_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|3527498_3527897_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|3527906_3528545_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|3528547_3529711_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|3529794_3531420_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|3531536_3531812_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|3531960_3532290_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|3532471_3533221_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|3533217_3533973_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|3534080_3535145_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001301921.1|3535499_3536897_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|3536912_3537218_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|3537227_3537692_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|3537705_3538356_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949515.1|3538365_3539220_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|3539219_3539906_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|3540034_3540310_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|3540636_3541032_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|3541038_3541353_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|3541357_3541585_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|3541626_3542076_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|3542146_3542941_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|3543563_3543995_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|3544002_3545211_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|3545345_3545984_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|3546201_3546822_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|3547130_3548543_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|3548587_3549250_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|3549357_3550323_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|3550430_3551291_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|3551379_3551760_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589487.1|3551877_3553821_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|3554010_3554751_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937659.1|3554962_3555901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175287.1|3555963_3556518_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|3556842_3557049_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|3557127_3558471_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|3558793_3559432_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|3559637_3561371_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|3561367_3565147_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|3565149_3565491_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|3565702_3565954_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|3565947_3566298_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|3566377_3566908_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|3567217_3568174_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_001301928.1|3569829_3570852_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|3570838_3571834_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|3571866_3572865_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|3573040_3574414_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|3574569_3575121_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|3575214_3576567_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 12
NZ_CP015020	Escherichia coli strain 28RC1 chromosome, complete genome	5561698	3978262	4042588	5561698	plate,transposase,tRNA	uncultured_Caudovirales_phage(25.0%)	52	NA	NA
WP_000176537.1|3978262_3979558_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|3979610_3979871_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|3979857_3980058_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|3980223_3980769_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|3980765_3981176_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|3981189_3981900_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|3982099_3982924_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|3982976_3984695_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|3984805_3985513_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|3985509_3985914_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|3986031_3986847_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|3986886_3987540_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|3987532_3988564_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|3988751_3989327_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|3995086_3995890_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|3995886_3996801_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3997041_3997842_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|3997919_3998690_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|3998737_4000096_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|4000167_4000923_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|4000956_4001679_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|4001675_4002143_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|4002207_4002939_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|4003476_4004277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|4004754_4005204_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000964776.1|4005206_4005803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002701.1|4005881_4006103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|4006123_4006603_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|4006568_4007978_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001303798.1|4007988_4011423_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|4011559_4012972_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|4012976_4013720_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614373.1|4013716_4016482_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.6	4.7e-82
WP_000343292.1|4016490_4017252_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246434.1|4017256_4018588_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|4018590_4019115_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|4019111_4020392_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|4020416_4021499_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|4021462_4023313_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|4023316_4023730_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|4023820_4025212_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|4025262_4025487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|4025521_4026022_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|4026718_4027237_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103125.1|4027446_4029588_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_062946173.1|4029663_4033905_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000995683.1|4034044_4034761_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_137056747.1|4036519_4037125_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420853.1|4037870_4039007_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000247943.1|4040971_4041235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|4041149_4041335_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|4041415_4042588_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP015020	Escherichia coli strain 28RC1 chromosome, complete genome	5561698	4061374	4078526	5561698	tail,transposase,integrase	Escherichia_phage(35.29%)	18	4067982:4067995	4083887:4083900
WP_000749881.1|4061374_4062430_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|4062717_4063821_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|4063832_4065086_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001303805.1|4066155_4066401_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_162829202.1|4066727_4067941_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_062946174.1|4067966_4068350_-	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	35.3	2.9e-06
4067982:4067995	attL	TCCGGGGCGGTTCA	NA	NA	NA	NA
WP_001274756.1|4068477_4069191_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|4069291_4069492_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|4069610_4069904_+	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000788819.1|4070855_4071167_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_001096963.1|4071166_4071961_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000805544.1|4071960_4072554_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|4072525_4072969_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_001115553.1|4072989_4073400_-|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000904979.1|4073429_4073984_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|4074041_4074815_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000246059.1|4075638_4076382_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001130487.1|4077344_4078526_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
4083887:4083900	attR	TGAACCGCCCCGGA	NA	NA	NA	NA
>prophage 14
NZ_CP015020	Escherichia coli strain 28RC1 chromosome, complete genome	5561698	4658840	4696941	5561698	holin,integrase,portal,tail,protease,lysis,terminase	Enterobacteria_phage(48.84%)	50	4648282:4648296	4680576:4680590
4648282:4648296	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_000533643.1|4658840_4659911_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|4659888_4660107_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|4660146_4660314_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|4660556_4661159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|4661369_4661591_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000188862.1|4661689_4661905_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000548536.1|4661981_4662173_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|4662145_4662328_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|4662324_4663005_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|4663702_4663885_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|4663881_4664052_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|4664044_4664665_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028854.1|4664661_4665327_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|4665538_4666498_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|4666835_4666958_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|4666972_4667662_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|4667845_4668589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|4668674_4668833_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|4668913_4669312_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|4669454_4669670_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|4669669_4670167_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|4670163_4670631_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|4670618_4670771_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|4671445_4671937_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934096.1|4671936_4674039_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_001072975.1|4674035_4674248_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|4674175_4675300_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|4675421_4675757_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136597.1|4675701_4677729_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|4677815_4678139_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|4678131_4678407_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|4678418_4678997_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|4678993_4679395_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|4679405_4680149_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|4680209_4680596_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
4680576:4680590	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|4680604_4680934_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|4680905_4683971_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|4683970_4684300_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|4684309_4685008_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|4685013_4685757_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|4685693_4686302_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515426.1|4686362_4689776_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233141.1|4689846_4690446_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741889.1|4690505_4691822_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	95.6	1.2e-70
WP_062946182.1|4691823_4692045_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.6	1.4e-34
WP_000950813.1|4692269_4693250_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|4693283_4694303_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|4694799_4694961_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951025.1|4695130_4696012_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_001247925.1|4696242_4696941_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 15
NZ_CP015020	Escherichia coli strain 28RC1 chromosome, complete genome	5561698	4913649	4983476	5561698	holin,tail,portal,protease,transposase,head,capsid	Escherichia_phage(23.81%)	75	NA	NA
WP_000156526.1|4913649_4915410_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|4915595_4916048_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|4916122_4917163_-	porin OmpA	NA	NA	NA	NA	NA
WP_062946185.1|4917519_4918029_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|4918247_4918877_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|4918839_4921002_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|4921011_4921458_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|4921580_4923635_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|4923666_4924125_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|4924220_4924883_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|4925055_4925469_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|4925513_4925831_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|4925888_4927079_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|4927173_4927452_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|4927448_4927778_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|4927868_4928528_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_000273151.1|4929919_4930162_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|4930229_4932701_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|4932794_4932986_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|4932982_4933171_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|4933744_4933930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|4934116_4934506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|4934647_4934803_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|4935080_4935368_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|4935367_4935559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|4935586_4935988_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|4936096_4936369_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|4936352_4936778_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|4936984_4937440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072141648.1|4937518_4938604_+	DNA-binding protein	NA	V5URT9	Shigella_phage	70.4	3.0e-133
WP_000788745.1|4938610_4939357_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_000450992.1|4939378_4940149_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|4940164_4940578_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|4940929_4941703_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000813263.1|4942307_4942463_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_001341388.1|4942630_4942909_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|4942910_4943960_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001217436.1|4943972_4944344_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|4944333_4944705_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|4944856_4945675_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261909.1|4946295_4947009_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|4947776_4949627_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_162829202.1|4949802_4951015_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303878.1|4951220_4951535_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|4952062_4952248_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|4952469_4952583_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|4952803_4953337_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|4953496_4953769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|4954024_4954231_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|4954981_4955257_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|4955332_4955713_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|4955709_4956057_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|4956106_4957645_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000259002.1|4959822_4960029_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|4960025_4961618_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|4961607_4963113_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|4963149_4963497_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|4963554_4963821_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|4963802_4964543_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|4964556_4964988_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|4965014_4965428_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082464.1|4965408_4967988_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.2	0.0e+00
WP_000847298.1|4967984_4968314_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|4968313_4969012_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_050946666.1|4969022_4969766_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.4	8.6e-148
WP_050546863.1|4969711_4970344_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649829.1|4970534_4971062_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_062946186.1|4971195_4974669_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.4	0.0e+00
WP_001230444.1|4974736_4975336_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268962.1|4975400_4976714_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001023352.1|4976715_4976985_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|4979257_4980376_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|4980372_4982166_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|4982184_4982892_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|4982888_4983476_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 16
NZ_CP015020	Escherichia coli strain 28RC1 chromosome, complete genome	5561698	5258139	5381170	5561698	holin,integrase,portal,tail,protease,transposase,head,capsid,lysis,terminase,tRNA	Enterobacteria_phage(37.38%)	152	5322748:5322763	5352315:5352330
WP_000952736.1|5258139_5258961_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|5259116_5260163_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|5260159_5260954_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|5261120_5262239_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|5262207_5262477_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|5262538_5262928_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|5263060_5263576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|5263690_5263843_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|5264158_5264635_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|5264759_5265083_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|5265066_5265492_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|5265560_5266598_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|5266509_5267052_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|5267085_5267802_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072140318.1|5267834_5268116_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_001310212.1|5268112_5268415_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|5268404_5268722_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|5268675_5268993_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|5268979_5269417_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|5269418_5269610_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|5269612_5270200_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|5270315_5270420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|5270608_5270821_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|5270988_5271267_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|5271268_5272318_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001217410.1|5272330_5272705_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|5272701_5273523_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000023170.1|5274601_5276539_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|5276686_5276869_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|5276906_5277176_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|5277251_5277467_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|5277471_5277816_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|5277866_5278400_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|5278670_5279240_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|5279239_5279386_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|5279613_5279820_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|5279884_5280109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|5280465_5280606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|5280735_5280921_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_065225440.1|5280962_5281328_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	98.3	3.8e-64
WP_000958416.1|5281617_5282181_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|5282177_5283839_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|5283902_5285840_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|5285884_5286106_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001356761.1|5286051_5288631_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.0	0.0e+00
WP_000125988.1|5288633_5288960_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|5288969_5289320_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|5289316_5289763_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|5289759_5290104_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|5290169_5290886_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|5290900_5291275_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453698.1|5291370_5291580_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212850.1|5291632_5294875_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.7	0.0e+00
WP_000807950.1|5294867_5295209_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_001152182.1|5295208_5295907_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|5295923_5296178_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|5296287_5296398_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|5296700_5297579_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|5297632_5298370_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|5298315_5298552_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|5298564_5298654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|5298673_5301022_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|5301612_5305014_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001303921.1|5307322_5307598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|5307658_5309020_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|5309383_5310247_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|5310230_5311367_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|5311616_5312843_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|5312891_5314013_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085256.1|5314261_5315491_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|5315855_5316044_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000226782.1|5316848_5317046_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|5317038_5317251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|5317240_5317705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|5317697_5317931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|5317936_5318236_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_062946190.1|5318232_5319633_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.9	9.6e-116
WP_000192401.1|5319833_5320085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|5320081_5320492_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|5320502_5320775_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|5320901_5321126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|5321377_5321584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|5321583_5322639_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|5322651_5322987_+|head	head decoration protein	head	NA	NA	NA	NA
5322748:5322763	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_062946191.1|5322999_5323413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|5323618_5324161_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|5324416_5324698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|5325298_5326759_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|5326758_5327430_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|5327598_5328969_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|5328972_5329614_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|5329649_5330756_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|5330809_5331271_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|5331280_5331934_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|5332105_5333356_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|5333469_5334612_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|5334601_5334838_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|5335762_5336464_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|5336460_5336763_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|5336830_5337163_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|5337227_5337350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709088.1|5337407_5338934_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|5339435_5339891_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|5339890_5340061_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|5340053_5340344_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|5340340_5340703_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|5340699_5340840_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|5340836_5341526_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|5341847_5342153_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|5342139_5342616_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|5342832_5343015_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|5343105_5343399_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_162829202.1|5343601_5344814_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000079504.1|5345003_5345414_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|5345699_5345906_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|5346070_5346265_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|5346653_5347199_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|5347173_5349099_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|5349095_5349302_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|5349298_5350900_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|5350880_5352200_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|5352209_5352542_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
5352315:5352330	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063265.1|5352597_5353623_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|5353664_5354063_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|5354074_5354428_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|5354439_5355018_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|5355014_5355410_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|5355417_5356158_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|5356173_5356596_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|5356577_5357012_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_062946192.1|5357004_5359554_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.2	0.0e+00
WP_000847331.1|5359550_5359880_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|5359879_5360578_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|5360583_5361327_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|5361263_5361896_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|5361956_5365355_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|5365421_5366021_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|5366085_5369001_+|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|5369000_5369582_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|5369701_5370592_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|5370610_5371117_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|5371153_5371654_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|5371732_5371915_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|5372412_5373081_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|5373137_5373386_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|5373461_5373842_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|5373838_5374186_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998042.1|5374235_5375774_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_001226373.1|5376076_5377561_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|5377747_5378701_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|5379199_5379784_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|5379957_5381170_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 17
NZ_CP015020	Escherichia coli strain 28RC1 chromosome, complete genome	5561698	5477299	5560859	5561698	holin,integrase,portal,tail,transposase,head,lysis,capsid,terminase	Enterobacteria_phage(42.68%)	99	5476048:5476062	5522980:5522994
5476048:5476062	attL	CCCACTACTGCCGCT	NA	NA	NA	NA
WP_000113674.1|5477299_5478430_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|5478407_5478656_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|5478720_5481192_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090196.1|5481284_5481476_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|5481472_5481661_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000920491.1|5482219_5482453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|5482430_5482838_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|5482860_5483079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|5483151_5483451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|5483714_5484122_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|5484198_5484426_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|5484409_5484961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|5484932_5485973_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|5485884_5486427_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|5486613_5487195_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|5487191_5487356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|5488054_5488813_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|5489091_5489304_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_162829202.1|5489623_5490836_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_010917803.1|5491164_5491443_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|5491444_5492491_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|5492503_5492863_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|5492871_5493402_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|5493643_5493841_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_062946194.1|5495845_5497699_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.6	0.0e+00
WP_000284517.1|5497848_5498064_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|5498068_5498413_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|5498463_5498997_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|5499267_5499837_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|5499836_5499983_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001082601.1|5499990_5500458_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_001302717.1|5500921_5501236_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|5501317_5501542_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|5501928_5502474_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|5502448_5504374_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|5504370_5504577_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|5504573_5506175_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|5506155_5507475_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|5507484_5507817_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|5507872_5508898_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|5508939_5509338_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|5509349_5509703_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|5509717_5510251_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|5510247_5510643_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|5510650_5511403_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|5511416_5511839_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|5511865_5512279_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_062946195.1|5512259_5514872_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.8	0.0e+00
WP_000847298.1|5514868_5515198_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|5515197_5515896_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_050946666.1|5515906_5516650_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.4	8.6e-148
WP_140395871.1|5516595_5517225_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	1.9e-103
WP_062946197.1|5517465_5520321_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.6	0.0e+00
WP_001228334.1|5520388_5520988_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
WP_000216534.1|5521139_5522444_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	3.9e-79
WP_001023474.1|5522445_5522715_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|5523741_5525067_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
5522980:5522994	attR	AGCGGCAGTAGTGGG	NA	NA	NA	NA
WP_106409364.1|5526664_5526787_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|5526893_5527805_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|5527870_5528440_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|5529405_5530944_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|5530993_5531341_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|5531337_5531718_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|5532057_5532336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|5532763_5532910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|5533046_5533694_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|5533877_5534468_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|5535974_5536625_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_000063650.1|5537492_5538779_-	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	99.8	6.9e-254
WP_001193437.1|5538812_5539067_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_001484100.1|5539258_5539630_-	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.1	2.3e-61
WP_000720006.1|5539670_5540498_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	97.5	1.2e-129
WP_001365075.1|5540867_5541440_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	71.3	5.5e-78
WP_009453427.1|5541445_5541628_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	1.5e-08
WP_062946138.1|5541826_5542027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387836.1|5542023_5542725_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	59.7	1.5e-37
WP_000800140.1|5542873_5543563_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.2	5.2e-115
WP_000944728.1|5543719_5543953_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_001090254.1|5544034_5544742_+	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	90.2	1.6e-114
WP_000587259.1|5544850_5545513_+	ash family protein	NA	Q8W643	Enterobacteria_phage	92.5	3.7e-110
WP_000621233.1|5545509_5545743_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	47.2	1.6e-12
WP_001247844.1|5545729_5546638_+	hypothetical protein	NA	Q8W642	Enterobacteria_phage	94.0	2.4e-59
WP_000988196.1|5546648_5547527_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
WP_062946137.1|5547523_5548924_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.2	1.4e-244
WP_001065352.1|5548920_5549178_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_001202271.1|5549229_5550219_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	8.9e-193
WP_001204809.1|5550237_5550618_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_000917741.1|5550833_5551031_+	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_000483505.1|5551182_5552241_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	98.0	2.9e-205
WP_001365055.1|5552623_5553583_+	Shiga toxin Stx2d subunit A	NA	Q6DWN9	Enterobacteria_phage	100.0	1.6e-175
WP_000738080.1|5553594_5553864_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000143462.1|5556463_5556643_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001056806.1|5558054_5558624_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|5558623_5558770_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001082574.1|5558777_5559245_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	99.4	2.0e-78
WP_187642509.1|5559339_5559669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187642506.1|5560283_5560439_+|terminase	phage terminase large subunit family protein	terminase	Q8VNN7	Enterobacteria_phage	100.0	2.5e-17
WP_187642507.1|5560395_5560698_+|terminase	phage terminase large subunit family protein	terminase	Q8VNN7	Enterobacteria_phage	100.0	3.8e-46
WP_187642508.1|5560688_5560859_+|terminase	phage terminase large subunit family protein	terminase	Q8VNN7	Enterobacteria_phage	68.1	1.2e-09
>prophage 1
NZ_CP015021	Escherichia coli strain 28RC1 plasmid p28RC1, complete sequence	81401	0	40866	81401	transposase,protease,integrase	Macacine_betaherpesvirus(40.0%)	34	19603:19617	40591:40605
WP_000612591.1|304_652_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|701_2240_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001358886.1|2885_5582_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|5668_6544_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001302177.1|6544_8512_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|8511_10017_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|10018_11242_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|11272_11707_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082929.1|11703_12258_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000173396.1|12272_12620_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|12616_13216_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|13212_14190_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|14228_15401_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|15387_15900_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|15957_16791_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|16882_17284_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
19603:19617	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217733.1|19689_22686_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|22735_24856_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|24859_26299_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_010891288.1|27042_27273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|27393_28134_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|28418_29396_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|29803_30004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|30000_30621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|30617_31301_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|31759_31978_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|31979_32285_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|32285_33092_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|33814_35028_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000772446.1|36031_37198_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|37197_38169_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|38894_39797_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|39800_40106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|40182_40866_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
40591:40605	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
>prophage 2
NZ_CP015021	Escherichia coli strain 28RC1 plasmid p28RC1, complete sequence	81401	46543	50716	81401		Thalassomonas_phage(33.33%)	6	NA	NA
WP_001302171.1|46543_47107_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_001358896.1|47192_47648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547965.1|47717_47924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290823.1|47949_48402_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000005995.1|48458_48692_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117168.1|48757_50716_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
>prophage 3
NZ_CP015021	Escherichia coli strain 28RC1 plasmid p28RC1, complete sequence	81401	68532	71911	81401		Xanthomonas_phage(33.33%)	4	NA	NA
WP_000205762.1|68532_69279_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000704522.1|69337_70198_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_001302189.1|70992_71205_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233856.1|71449_71911_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	9.4e-20
