The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015023	Escherichia coli strain SRCC 1675 chromosome, complete genome	5506801	42	80620	5506801	tail,portal,terminase,capsid,holin,head,transposase	Enterobacteria_phage(29.35%)	98	NA	NA
WP_077879945.1|42_435_+	phage antirepressor N-terminal domain-containing protein	NA	A0A1I9LJR6	Stx_converting_phage	96.9	3.3e-66
WP_001356403.1|462_606_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	97.9	9.3e-19
WP_000539792.1|605_752_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_149017362.1|759_993_+	hypothetical protein	NA	A0A1I9LJR7	Stx_converting_phage	94.0	1.2e-26
WP_012816791.1|980_1166_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1591_1819_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|1860_2226_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2514_3078_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|3074_4736_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|4799_6737_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063094.1|6781_7003_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000125984.1|9529_9856_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007911.1|9865_10216_+|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000573391.1|10212_10659_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|10655_11000_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275434.1|11068_11785_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|11799_12174_+|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|12269_12479_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212822.1|12526_15769_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.4	0.0e+00
WP_000807954.1|15761_16103_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179481.1|16102_16801_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000194720.1|16811_17555_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|17500_18133_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|18474_19650_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_001230508.1|22016_22616_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|22680_23904_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|23905_24175_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001121225.1|25574_26225_+	type III secretion system effector NleG7	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|26807_28346_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|28395_28743_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|28739_29120_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_162829202.1|30239_31452_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_010917821.1|31455_31710_-	DinI-like family protein	NA	H6WZN4	Escherichia_phage	82.5	3.4e-11
WP_000102123.1|32348_33593_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|33685_33874_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|33870_34059_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|34623_34833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|34833_35472_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|35483_35636_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|35928_36267_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|36658_36901_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|36884_37310_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|37378_38422_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|38414_38876_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|38909_39626_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|39658_39940_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|39936_40164_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|40156_40468_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|40595_40814_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|40815_41373_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|41606_41819_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|41938_42283_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|42404_42677_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|42678_43728_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|43740_44046_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|44108_44663_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|44887_45085_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|45220_45934_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|46384_46816_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|47293_49144_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|49582_49798_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|49802_50147_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|50197_50731_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|51001_51571_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|51570_51717_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|51939_52125_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|52650_52965_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|53046_53271_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867493.1|53657_54203_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	82.8	4.7e-79
WP_001027223.1|54177_56103_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|56099_56306_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|56302_57904_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|57884_59204_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|59213_59546_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|59601_60627_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|60668_61067_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|61078_61432_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|61446_61980_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|61976_62372_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|62379_63132_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|63145_63568_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|63594_64008_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|63988_66601_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|66597_66927_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|66926_67625_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|67635_68379_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|68324_68954_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_077879946.1|69194_70370_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	98.0	9.8e-231
WP_115801853.1|70321_72673_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001230508.1|72740_73340_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|73404_74628_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|74629_74899_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131658.1|75012_75588_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|75660_76290_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143808.1|76371_77013_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	96.2	8.6e-104
WP_001120551.1|77174_77417_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000527769.1|78920_80381_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|80416_80620_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 2
NZ_CP015023	Escherichia coli strain SRCC 1675 chromosome, complete genome	5506801	262587	303047	5506801	tail,terminase,capsid,holin,head	Stx2-converting_phage(44.44%)	47	NA	NA
WP_001295593.1|262587_263022_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_001143784.1|263602_264244_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001443810.1|264325_264955_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001131659.1|265027_265603_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001023992.1|265715_265985_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	95.5	4.2e-44
WP_000268955.1|265986_267300_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001230550.1|267364_267964_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	100.0	3.0e-111
WP_000515042.1|268034_271532_-	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	94.3	0.0e+00
WP_000649829.1|271665_272193_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064732755.1|272383_273016_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	90.4	3.4e-97
WP_000194763.1|272961_273705_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.2	5.4e-150
WP_001152159.1|273715_274414_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	1.3e-129
WP_000807964.1|274413_274755_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_000212768.1|274747_277828_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.3	0.0e+00
WP_001453698.1|277879_278089_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030060.1|278184_278559_-|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001275479.1|278564_279281_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|279349_279694_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|279690_280137_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007911.1|280133_280484_-|head	phage head closure protein	head	H6WZL5	Escherichia_phage	100.0	2.0e-59
WP_000125984.1|280493_280820_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063094.1|283346_283568_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000173030.1|283612_285550_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|285613_287275_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|287271_287835_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|288124_288490_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|288531_288759_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|289183_289369_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|289596_289743_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|289742_290312_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|290582_291116_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|291166_291511_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|291515_291731_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023202.1|292170_294021_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_001303509.1|294499_294928_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|295567_296257_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|296253_296613_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|296625_297675_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|297676_297955_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|298122_298335_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|298523_298628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|298743_299328_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|299384_299780_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|300590_301331_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|301337_302300_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|302322_302748_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|302744_303047_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 3
NZ_CP015023	Escherichia coli strain SRCC 1675 chromosome, complete genome	5506801	609993	667732	5506801	tail,transposase,tRNA,integrase	Enterobacteria_phage(60.0%)	63	609837:609852	667811:667826
609837:609852	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_000564730.1|609993_610965_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176813.1|611129_613559_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214277.1|613583_614684_-	cytochrome c-type protein TorY	NA	NA	NA	NA	NA
WP_001185748.1|615071_615818_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001302537.1|615831_616398_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025318.1|616613_618347_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|618523_619012_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|619131_619524_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|619523_621602_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|621594_622743_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|622944_623589_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|623599_623989_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|624003_625053_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|625055_625916_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|625934_627536_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|627581_629243_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|629385_629889_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|629909_631874_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|631878_632805_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|632801_633689_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|633815_634394_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|634396_634747_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|635526_635955_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089030.1|635961_637386_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|637360_638161_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001187819.1|639328_640843_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|640912_641902_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|642698_643202_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|643281_643533_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|643647_643734_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|643995_644319_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_000917208.1|644489_644987_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|645023_645263_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|645454_646666_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|646727_647393_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|647749_648751_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|648756_649104_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|649133_649784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|649799_650204_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|650293_650431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|650502_650706_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|650727_651078_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|651088_651367_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|651378_651621_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|651617_651731_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|651823_652240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|652263_652467_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|652463_652730_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|652726_653026_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001413181.1|653037_653655_+	ash family protein	NA	S5MQL6	Escherichia_phage	44.9	6.1e-06
WP_000599379.1|653651_654017_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|654023_656846_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686531.1|656922_657882_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	7.9e-178
WP_000211280.1|657886_658201_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_001310336.1|659292_659823_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000954203.1|659866_660439_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|660595_661084_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000333495.1|663886_664042_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665314.1|664050_664416_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|664470_664983_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|664982_666167_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|666324_666648_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161728.1|666598_667732_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	1.4e-40
667811:667826	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 4
NZ_CP015023	Escherichia coli strain SRCC 1675 chromosome, complete genome	5506801	725312	792530	5506801	tail,portal,terminase,integrase,capsid,holin,head,transposase	Escherichia_phage(33.33%)	69	741109:741124	798189:798204
WP_001023407.1|725312_725582_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268861.1|725583_726897_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001230508.1|726961_727561_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_115801853.1|727628_729980_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001356361.1|729931_731107_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	100.0	3.8e-235
WP_072147834.1|731347_731977_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|731922_732666_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001301816.1|732676_733375_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000847298.1|733374_733704_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_115801854.1|733700_734465_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	99.2	3.5e-136
WP_101975986.1|734416_736279_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.5	1.4e-268
WP_000533402.1|736259_736673_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|736699_737131_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|737144_737885_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|737866_738133_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|738190_738538_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|738574_740080_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|740069_741662_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
741109:741124	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|741658_741865_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|741848_743777_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000235436.1|743748_744258_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|744652_744877_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|744958_745273_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|745799_745985_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|746212_746344_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|746356_746539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|746694_747228_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|747278_747623_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_024165672.1|747627_747843_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_162829202.1|748153_749366_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000023257.1|749448_751299_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001303558.1|751776_752205_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_001059369.1|752838_753528_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|753524_753884_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|753896_754946_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|754947_755226_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|755393_755606_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|755792_755897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|756006_756570_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|756696_757008_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|757004_757157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|757189_757546_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|757542_757767_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|757788_758487_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|758521_759064_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|758975_760013_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|760081_760507_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|760503_760731_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|760828_761473_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|761747_761900_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|762380_762569_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|762565_762754_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|762849_765321_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|765379_765583_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|765582_766605_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|766840_767638_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000480501.1|776372_777425_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|777738_779055_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|779156_780611_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|780953_781670_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|784056_785007_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|785108_786026_-	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_000986334.1|786482_787418_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|787479_788559_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|788570_789314_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|789310_789856_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|790217_790598_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|790594_790942_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|790991_792530_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
798189:798204	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 5
NZ_CP015023	Escherichia coli strain SRCC 1675 chromosome, complete genome	5506801	895723	998274	5506801	tail,portal,terminase,tRNA,holin,protease	Enterobacteria_phage(64.29%)	119	NA	NA
WP_000476014.1|895723_897085_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001303579.1|897414_897732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|898137_899037_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178551.1|899118_899898_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|899997_901038_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|901085_902441_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|902444_902729_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|902759_903212_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853846.1|903221_904484_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001301486.1|904512_905367_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|905665_906718_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000859148.1|906974_908252_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846238.1|908248_909253_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000011970.1|909249_910215_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|910188_910935_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301907.1|910986_911805_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000822268.1|911869_912670_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195634.1|912666_913455_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141034.1|913788_914028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836936.1|915078_915426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735648.1|915435_915750_+	outer membrane protein	NA	NA	NA	NA	NA
WP_000019944.1|915859_916132_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134631.1|916252_917092_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153070.1|917309_917648_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001301545.1|917729_918764_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000945390.1|918774_921255_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677408.1|921270_921945_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000682830.1|922032_922575_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010904812.1|922866_923148_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005448.1|923409_924519_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001301615.1|924650_926684_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_000356841.1|933641_937271_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|937332_937650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|938890_939979_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|939989_941519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|941537_942269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|942261_943398_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|943394_945398_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|945522_945984_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|946025_946496_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|946542_947262_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|947258_948944_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_001261937.1|949458_949707_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023431.1|950074_950344_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	100.0	2.9e-45
WP_000268835.1|950345_951659_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	100.0	8.8e-79
WP_001228289.1|951723_952323_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_115801855.1|952390_954736_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.9	0.0e+00
WP_001356361.1|954687_955863_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	100.0	3.8e-235
WP_072147834.1|956103_956733_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000194798.1|956678_957422_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_001301816.1|957432_958131_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000847298.1|958130_958460_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918269.1|958456_961102_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000532073.1|961145_961454_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|961480_961903_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|961916_962669_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|962676_963075_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_001511932.1|963087_963711_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	99.5	9.5e-100
WP_001281350.1|963713_963995_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001511933.1|963987_964314_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	99.1	1.8e-49
WP_001114424.1|964401_966426_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|966370_967873_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|967872_968085_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077625.1|968081_970205_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|970201_970678_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001302882.1|970710_970983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|971194_971380_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|971607_971754_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|971753_972323_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|972593_973127_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|973131_973347_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|973424_973670_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|973710_973890_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000874257.1|974027_975974_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	100.0	0.0e+00
WP_000752026.1|976484_976754_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|976763_977711_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204849.1|978217_978652_-	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000144764.1|978644_978839_-	phage NinH family protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001107983.1|978835_979441_-	recombination protein NinG	NA	Q9EYC6	Enterobacteria_phage	100.0	2.3e-98
WP_001543885.1|979433_979643_-	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_000924601.1|979602_980004_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	100.0	1.4e-72
WP_001254255.1|980006_980183_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000153268.1|980179_980707_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001304104.1|980703_981150_-	recombination protein NinB	NA	A0A1I9LJP8	Stx_converting_phage	100.0	2.4e-81
WP_001281772.1|981106_981343_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103678.1|981353_981569_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001000130.1|981701_981980_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000145935.1|982050_982341_-	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_000788906.1|982337_983039_-	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000185456.1|983035_983974_-	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000035953.1|984006_984303_-	hypothetical protein	NA	Q9EYB4	Enterobacteria_phage	100.0	1.8e-48
WP_001033078.1|984417_984636_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	100.0	1.1e-34
WP_001299796.1|984744_985392_+	LexA family transcriptional regulator	NA	K7PH19	Enterobacteria_phage	100.0	1.2e-121
WP_001280993.1|985514_985796_+	hypothetical protein	NA	A4KWR2	Enterobacteria_phage	100.0	1.1e-44
WP_000990548.1|985802_986354_+	hypothetical protein	NA	A4KWR1	Enterobacteria_phage	100.0	4.1e-70
WP_000256574.1|986866_987139_+	hypothetical protein	NA	Q9EYB0	Enterobacteria_phage	100.0	2.0e-41
WP_001066169.1|987155_987737_-	superinfection exclusion B family protein	NA	Q9EYA9	Enterobacteria_phage	100.0	4.0e-100
WP_000065377.1|987997_988366_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	100.0	7.6e-65
WP_001198861.1|988438_988603_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372942.1|988571_988715_+	host cell division inhibitory peptide Kil	NA	Q9EYA7	Enterobacteria_phage	100.0	1.2e-18
WP_000995395.1|988790_989087_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000100847.1|989092_989878_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|989874_990552_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|990551_990734_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|990706_990898_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_000188870.1|990974_991190_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763383.1|991288_991510_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|991506_992454_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001304101.1|992455_992632_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	98.3	3.0e-27
WP_000207903.1|992965_993322_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|993318_993681_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|993768_994011_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|994014_994149_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|994167_994422_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|994455_995742_+	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|995762_996464_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_001216963.1|996523_996631_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|996611_997343_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|997347_998274_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 6
NZ_CP015023	Escherichia coli strain SRCC 1675 chromosome, complete genome	5506801	1243892	1249318	5506801	integrase	Enterobacteria_phage(50.0%)	6	1234343:1234359	1246307:1246323
1234343:1234359	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|1243892_1244825_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|1245136_1246294_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|1246468_1247605_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
1246307:1246323	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|1247614_1248295_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|1248281_1248749_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000950857.1|1248748_1249318_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
>prophage 7
NZ_CP015023	Escherichia coli strain SRCC 1675 chromosome, complete genome	5506801	1526896	1541647	5506801	tail,transposase,holin	Enterobacteria_phage(35.71%)	18	NA	NA
WP_000162574.1|1526896_1527379_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|1528224_1528473_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|1528974_1529565_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|1529747_1530398_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|1530476_1531535_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|1531664_1532087_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|1532247_1532517_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_162829202.1|1532734_1533947_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000612591.1|1534448_1534796_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1534792_1535173_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|1535529_1535874_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|1535878_1536094_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143068.1|1536243_1538097_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000499458.1|1538504_1538672_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|1538757_1539501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|1539753_1540377_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|1540373_1541039_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|1541035_1541647_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
>prophage 8
NZ_CP015023	Escherichia coli strain SRCC 1675 chromosome, complete genome	5506801	2041294	2125742	5506801	tail,plate,holin,transposase,head,protease	Shigella_phage(52.38%)	100	NA	NA
WP_000785722.1|2041294_2041699_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000096086.1|2041688_2041988_+	YqjK-like family protein	NA	NA	NA	NA	NA
WP_000732240.1|2042173_2042566_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000531208.1|2042635_2043622_+	glutathionyl-hydroquinone reductase YqjG	NA	NA	NA	NA	NA
WP_000384145.1|2043913_2044279_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_001198807.1|2044519_2044876_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_001041009.1|2044926_2045823_-	DNA-binding transcriptional regulator YhaJ	NA	NA	NA	NA	NA
WP_000633573.1|2045927_2046629_+	pirin family protein	NA	NA	NA	NA	NA
WP_001295544.1|2046651_2046816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460512.1|2046949_2048260_-	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_000401586.1|2048287_2049619_-	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_000622104.1|2049893_2051258_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000719990.1|2051329_2051719_-	enamine/imine deaminase	NA	NA	NA	NA	NA
WP_000861740.1|2051732_2054027_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	1.3e-157
WP_001301837.1|2054060_2055269_-	propionate kinase	NA	NA	NA	NA	NA
WP_000107723.1|2055294_2056626_-	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_000548347.1|2056647_2057637_-	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_000104211.1|2057735_2058674_-	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_000145832.1|2058862_2059207_+	DNA-binding transcriptional activator TdcR	NA	NA	NA	NA	NA
WP_000675739.1|2059462_2060002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000484640.1|2060023_2061211_+	YhaC family protein	NA	NA	NA	NA	NA
WP_001301934.1|2061839_2062985_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
WP_001303675.1|2063081_2063972_-	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_001058227.1|2064001_2064772_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_000599636.1|2064787_2066122_-	galactarate/glucarate/glycerate transporter GarP	NA	NA	NA	NA	NA
WP_001273776.1|2066496_2068068_+	galactarate dehydratase	NA	NA	NA	NA	NA
WP_001302819.1|2068216_2068552_+	type II toxin-antitoxin system antitoxin PrlF	NA	NA	NA	NA	NA
WP_000347273.1|2068551_2069016_+	type II toxin-antitoxin system ribonuclease toxin YhaV	NA	NA	NA	NA	NA
WP_000072187.1|2069070_2069880_-	aga operon transcriptional regulator AgaR	NA	NA	NA	NA	NA
WP_000681927.1|2070128_2071409_+	tagatose-bisphosphate aldolase subunit KbaZ	NA	NA	NA	NA	NA
WP_001301475.1|2071431_2071905_+	PTS N-acetylgalactosamine transporter subunit IIB	NA	NA	NA	NA	NA
WP_000406214.1|2071915_2072695_+	PTS mannose/fructose/sorbose/N-acetylgalactosamine transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295548.1|2072684_2073563_+	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_000528254.1|2073808_2074546_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	79.0	7.5e-104
WP_001444515.1|2074499_2074700_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|2074814_2075279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|2075317_2075563_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|2075598_2075781_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|2075927_2077967_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|2078066_2078627_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|2078848_2079052_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|2079131_2079653_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|2079687_2080599_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|2080598_2081159_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|2081149_2082232_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|2082231_2082669_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|2082661_2083276_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|2083265_2084390_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|2084373_2085723_-	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000113523.1|2085709_2087785_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000213225.1|2087911_2088388_-|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|2088402_2088768_-|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|2088776_2090279_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|2090275_2090521_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|2090521_2091082_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|2091078_2091498_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002057.1|2091494_2091881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|2091924_2092872_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850822.1|2092871_2093996_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_000094808.1|2094172_2094646_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000046901.1|2094767_2096099_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000532592.1|2096082_2097672_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_001057665.1|2097671_2099336_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000360581.1|2099335_2099917_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279082.1|2099919_2100210_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000270159.1|2100206_2100515_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342747.1|2100495_2100723_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|2100732_2100951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|2100934_2101363_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|2101397_2101898_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|2101969_2102395_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214366.1|2102464_2102974_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000378480.1|2102970_2103267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|2103256_2103454_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_001310453.1|2103446_2103779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|2103794_2104145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633440.1|2104159_2104471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973023.1|2104467_2105019_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000465562.1|2105022_2105538_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000578573.1|2105537_2106071_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.7	5.9e-66
WP_000323221.1|2106074_2106617_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_001129553.1|2106714_2107245_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049306.1|2107256_2107550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|2107554_2107827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|2107823_2108105_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|2108106_2108361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257930.1|2108373_2108595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|2108597_2109530_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_001512118.1|2109601_2111692_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	4.0e-166
WP_001310454.1|2111693_2111942_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_001056416.1|2112109_2112694_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
WP_001301829.1|2113301_2114435_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_001114858.1|2114785_2115940_+	AgaS family sugar isomerase	NA	NA	NA	NA	NA
WP_000022766.1|2115952_2116813_+	tagatose-bisphosphate aldolase subunit KbaY	NA	NA	NA	NA	NA
WP_000098025.1|2116979_2117456_+	PTS N-acetylgalactosamine transporter subunit IIB	NA	NA	NA	NA	NA
WP_000534351.1|2118287_2119079_+	PTS N-acetylgalactosamine transporter subunit IID	NA	NA	NA	NA	NA
WP_001045434.1|2120235_2120820_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000044758.1|2120899_2121595_+	molecular chaperone	NA	NA	NA	NA	NA
WP_001136459.1|2121623_2124140_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_162829202.1|2124529_2125742_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 9
NZ_CP015023	Escherichia coli strain SRCC 1675 chromosome, complete genome	5506801	3744182	3856286	5506801	tail,plate,integrase,tRNA,transposase,protease	Enterobacteria_phage(21.43%)	97	3820467:3820481	3856702:3856716
WP_001295561.1|3744182_3745535_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|3745564_3747997_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|3748117_3748603_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|3748606_3749632_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3749736_3750192_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565963.1|3750195_3750984_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139661.1|3750983_3752132_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569419.1|3752128_3752725_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001294772.1|3752761_3756244_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000055741.1|3756256_3757216_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020954.1|3757314_3759456_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|3759512_3759902_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176537.1|3759966_3761262_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|3761314_3761575_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|3761561_3761762_-	YaeP family protein	NA	NA	NA	NA	NA
WP_000635546.1|3762469_3762880_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|3762893_3763604_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|3763803_3764628_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|3764680_3766399_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|3766509_3767217_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|3767213_3767618_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|3767735_3768551_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|3768590_3769244_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|3769236_3770268_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|3770455_3771031_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|3776788_3777592_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|3777588_3778503_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3778743_3779544_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|3779621_3780392_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|3780439_3781798_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|3781869_3782625_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|3782658_3783381_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3783377_3783845_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|3783909_3784641_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|3785178_3785979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|3786456_3786906_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000964776.1|3786908_3787505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002701.1|3787583_3787805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|3787825_3788305_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|3788270_3789680_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001303798.1|3789690_3793125_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000088854.1|3794677_3795421_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614374.1|3795417_3798189_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.8	3.6e-82
WP_000343292.1|3798197_3798959_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246434.1|3798963_3800295_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|3800297_3800822_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|3800818_3802099_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|3802123_3803206_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|3803169_3805020_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|3805023_3805437_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|3805527_3806919_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|3806969_3807194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|3807228_3807729_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|3808425_3808944_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103107.1|3809153_3811295_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	7.0e-25
WP_000509132.1|3811370_3815585_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.0e-23
WP_001451375.1|3815653_3816205_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420837.1|3816950_3818087_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000247943.1|3820051_3820315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|3820229_3820415_-	protein YncO	NA	NA	NA	NA	NA
3820467:3820481	attL	AATAACTAAAAAGAT	NA	NA	NA	NA
WP_000027427.1|3820495_3821668_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_001118031.1|3821785_3822556_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|3822709_3823183_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973071.1|3823225_3825670_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|3825909_3826488_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001301698.1|3826592_3827360_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|3827330_3828071_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001303998.1|3828226_3828487_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729705.1|3828505_3828766_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543891.1|3828951_3829725_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_009625779.1|3830542_3832282_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000207556.1|3832226_3833012_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226188.1|3833082_3834138_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|3834189_3834483_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263495.1|3834485_3834884_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059871.1|3834893_3835346_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|3836444_3837902_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|3838162_3838621_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189536.1|3838712_3839957_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174701.1|3840014_3840416_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749881.1|3840454_3841510_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|3841797_3842901_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|3842912_3844166_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001303805.1|3845235_3845481_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_024177533.1|3845720_3846110_-	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.3	1.0e-06
WP_001274756.1|3846237_3846951_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|3847051_3847252_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|3847370_3847664_+	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000788819.1|3848615_3848927_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_001096963.1|3848926_3849721_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000805544.1|3849720_3850314_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|3850285_3850729_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_001115553.1|3850749_3851160_-|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000904979.1|3851189_3851744_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|3851801_3852575_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000246059.1|3853398_3854142_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001130487.1|3855104_3856286_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
3856702:3856716	attR	AATAACTAAAAAGAT	NA	NA	NA	NA
>prophage 10
NZ_CP015023	Escherichia coli strain SRCC 1675 chromosome, complete genome	5506801	4435492	4473589	5506801	tail,portal,terminase,integrase,lysis,holin,protease	Enterobacteria_phage(51.16%)	50	4424934:4424948	4457224:4457238
4424934:4424948	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_089625990.1|4435492_4436431_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	2.0e-173
WP_001303849.1|4436536_4436755_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|4436794_4436962_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|4437204_4437807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|4438017_4438239_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000188862.1|4438337_4438553_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000548536.1|4438629_4438821_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|4438793_4438976_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|4438972_4439653_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|4440350_4440533_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|4440529_4440700_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|4440692_4441313_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028854.1|4441309_4441975_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|4442186_4443146_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|4443483_4443606_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|4443620_4444310_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|4444493_4445237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|4445322_4445481_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|4445561_4445960_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|4446102_4446318_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|4446317_4446815_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|4446811_4447279_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|4447266_4447419_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|4448093_4448585_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934137.1|4448584_4450687_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|4450683_4450896_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|4450823_4451948_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|4452069_4452405_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136597.1|4452349_4454377_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|4454463_4454787_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|4454779_4455055_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|4455066_4455645_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|4455641_4456043_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|4456053_4456797_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|4456857_4457244_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
4457224:4457238	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|4457252_4457582_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|4457553_4460619_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|4460618_4460948_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|4460957_4461656_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|4461661_4462405_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|4462341_4462950_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515426.1|4463010_4466424_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233141.1|4466494_4467094_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741879.1|4467153_4468470_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|4468471_4468741_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|4468917_4469898_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|4469931_4470951_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|4471447_4471609_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|4471778_4472660_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|4472890_4473589_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 11
NZ_CP015023	Escherichia coli strain SRCC 1675 chromosome, complete genome	5506801	4690306	4759915	5506801	tail,portal,terminase,integrase,capsid,holin,transposase,head,protease	Escherichia_phage(23.26%)	76	4698794:4698809	4720160:4720175
WP_000156526.1|4690306_4692067_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|4692252_4692705_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|4692780_4693821_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|4694177_4694687_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|4694905_4695535_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|4695497_4697660_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|4697669_4698116_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|4698238_4700293_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
4698794:4698809	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|4700324_4700783_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|4700878_4701541_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|4701713_4702127_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|4702171_4702489_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|4702546_4703737_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|4703831_4704110_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|4704106_4704436_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|4704526_4705186_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|4705593_4706613_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|4706590_4706833_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|4706900_4709372_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|4709465_4709657_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|4709653_4709842_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|4710415_4710601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|4710787_4711177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|4711318_4711474_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|4711751_4712039_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|4712038_4712230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|4712257_4712659_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|4712767_4713040_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|4713023_4713449_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|4713655_4714111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|4714189_4715281_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|4715287_4716034_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|4716055_4716826_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|4716841_4717255_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|4717606_4718380_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000813263.1|4718984_4719140_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_001341388.1|4719307_4719586_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|4719587_4720637_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
4720160:4720175	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|4720649_4721021_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|4721010_4721382_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|4721533_4722352_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261909.1|4722972_4723686_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|4724453_4726304_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_001303878.1|4727660_4727975_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|4728502_4728688_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|4728909_4729023_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|4729243_4729777_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|4729936_4730209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|4730464_4730671_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|4731421_4731697_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|4731772_4732153_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|4732149_4732497_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|4732546_4734085_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001302857.1|4734348_4736277_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|4736260_4736467_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|4736463_4738056_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|4738045_4739551_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|4739587_4739935_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|4739992_4740259_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|4740240_4740981_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|4740994_4741426_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|4741452_4741866_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082449.1|4741846_4744426_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.5	0.0e+00
WP_000847304.1|4744422_4744752_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001151078.1|4744751_4745450_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000194760.1|4745460_4746204_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|4746149_4746782_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649830.1|4746972_4747500_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	59.9	2.0e-58
WP_000515108.1|4747633_4751107_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.5	0.0e+00
WP_001230444.1|4751174_4751774_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268862.1|4751838_4753152_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001023352.1|4753153_4753423_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|4755696_4756815_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|4756811_4758605_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|4758623_4759331_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|4759327_4759915_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 12
NZ_CP015023	Escherichia coli strain SRCC 1675 chromosome, complete genome	5506801	4790477	4855612	5506801	tail,portal,terminase,capsid,bacteriocin,holin,transposase,protease	Escherichia_phage(58.82%)	85	NA	NA
WP_000013654.1|4790477_4791788_-	DUF3596 domain-containing protein	NA	A0A1I9LJL6	Stx_converting_phage	100.0	3.2e-254
WP_001208773.1|4791840_4792125_-	excisionase family protein	NA	G9L654	Escherichia_phage	100.0	9.1e-50
WP_001303965.1|4792210_4792510_-	hypothetical protein	NA	G9L655	Escherichia_phage	100.0	2.4e-53
WP_000212746.1|4793485_4793773_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001142590.1|4793774_4793993_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_000951705.1|4793994_4794210_-	hypothetical protein	NA	A0A1I9LJM3	Stx_converting_phage	100.0	3.0e-37
WP_000797281.1|4794211_4794400_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	100.0	2.8e-31
WP_001289936.1|4794551_4795325_-	ead/Ea22-like family protein	NA	A0A0N7C1Y5	Escherichia_phage	100.0	1.7e-143
WP_000763363.1|4795321_4795543_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000188870.1|4795641_4795857_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548534.1|4795933_4796125_-	DUF1382 family protein	NA	A0A0N7C481	Escherichia_phage	100.0	4.3e-27
WP_000682306.1|4796097_4796280_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186812.1|4796276_4796957_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_001302855.1|4796953_4797739_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000995486.1|4797744_4798041_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|4798115_4798259_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|4798227_4798392_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|4798464_4798833_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|4799015_4799267_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|4799325_4799598_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|4799575_4799758_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|4800326_4800848_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|4801349_4802045_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|4802120_4802336_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000438540.1|4802477_4802774_+	hypothetical protein	NA	A0A0N7BZS9	Escherichia_phage	100.0	6.8e-48
WP_000166207.1|4802806_4802953_+	DUF2740 family protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000065666.1|4802945_4803845_+	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	100.0	1.2e-164
WP_000131484.1|4803834_4805271_+	AAA family ATPase	NA	A0A0N7C224	Escherichia_phage	100.0	6.1e-275
WP_001036032.1|4805270_4805540_+	hypothetical protein	NA	A0A0N7C059	Escherichia_phage	100.0	8.4e-45
WP_001000127.1|4805610_4805889_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|4806021_4806237_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|4806247_4806484_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|4806440_4806887_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153280.1|4806883_4807411_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254256.1|4807407_4807590_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000211422.1|4807864_4808599_+	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001004024.1|4808673_4809396_+	phage antirepressor KilAC domain-containing protein	NA	A0A0N7C231	Escherichia_phage	100.0	7.8e-130
WP_001107955.1|4809395_4810001_+	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	100.0	2.3e-98
WP_000144764.1|4809997_4810192_+	phage NinH family protein	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204880.1|4810184_4810619_+	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000649753.1|4811402_4812362_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|4812373_4812643_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_162829202.1|4814840_4816054_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000143458.1|4816515_4816695_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290212.1|4816735_4817008_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000284506.1|4817084_4817300_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|4817304_4817838_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|4818108_4818678_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|4818677_4818824_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_015971382.1|4819051_4819237_+	Rz1 protein precursor	NA	A0A0P0ZBL2	Stx2-converting_phage	100.0	1.2e-18
WP_000738505.1|4819327_4819621_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001086069.1|4820029_4820836_+|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000143988.1|4820816_4822523_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787519.1|4822522_4824667_+|portal	portal protein	portal	A0A2R2Z346	Escherichia_phage	100.0	0.0e+00
WP_000345010.1|4824824_4825832_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|4825855_4827070_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|4827125_4827515_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|4827564_4828026_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|4828009_4828573_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207924.1|4828572_4829223_+	hypothetical protein	NA	A0A1I9LJS8	Stx_converting_phage	100.0	2.7e-121
WP_000117994.1|4829219_4831157_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_001024006.1|4831158_4831428_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|4831567_4831756_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146326.1|4832050_4833676_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_000197192.1|4833672_4834941_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|4834955_4835234_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|4835239_4835857_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835360.1|4835947_4836682_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	100.0	1.3e-135
WP_000078907.1|4836914_4837055_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|4837111_4837513_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|4837606_4838263_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455644.1|4838265_4838712_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000540391.1|4838721_4838973_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012450.1|4838983_4840249_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_000331690.1|4840318_4848700_+	hypothetical protein	NA	A0A0N7C080	Escherichia_phage	100.0	0.0e+00
WP_000756595.1|4849250_4849595_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	100.0	4.6e-56
WP_000935259.1|4849714_4849927_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000426668.1|4850160_4850556_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	100.0	4.7e-68
WP_001120841.1|4850555_4850963_-	DUF551 domain-containing protein	NA	A0A1I9LJU9	Stx_converting_phage	99.3	7.1e-80
WP_001024844.1|4851440_4851725_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	100.0	3.2e-47
WP_000763353.1|4851721_4851943_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C094	Escherichia_phage	100.0	1.3e-35
WP_000203825.1|4851990_4852620_-	anti-repressor protein	NA	A0A0N6WET9	Escherichia_phage	100.0	2.6e-113
WP_001273654.1|4853578_4853686_+	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
WP_001301708.1|4853768_4855097_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	100.0	1.8e-236
WP_001028088.1|4855117_4855612_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	99.0	7.6e-52
>prophage 13
NZ_CP015023	Escherichia coli strain SRCC 1675 chromosome, complete genome	5506801	5083087	5208877	5506801	tail,portal,terminase,integrase,capsid,lysis,holin,tRNA,transposase,head,protease	Enterobacteria_phage(33.63%)	156	5073747:5073762	5212853:5212868
5073747:5073762	attL	CGACGTTATATTTTTT	NA	NA	NA	NA
WP_000952736.1|5083087_5083909_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|5084064_5085111_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|5085107_5085902_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|5086068_5087187_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|5087155_5087425_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|5087486_5087876_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|5088008_5088524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|5088638_5088791_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|5089106_5089583_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|5089707_5090031_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|5090014_5090440_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|5090508_5091546_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|5091457_5092000_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|5092033_5092750_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072140318.1|5092782_5093064_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_001310212.1|5093060_5093363_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|5093352_5093670_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|5093623_5093941_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|5093927_5094365_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|5094366_5094558_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|5094560_5095148_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|5095263_5095368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|5095556_5095769_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|5095936_5096215_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|5096216_5097266_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001217410.1|5097278_5097653_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|5097649_5098471_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000023170.1|5099549_5101487_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|5101634_5101817_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|5101854_5102124_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|5102199_5102415_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|5102419_5102764_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|5102814_5103348_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|5103618_5104188_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|5104187_5104334_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|5104561_5104768_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|5104832_5105057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|5105413_5105554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|5105683_5105869_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000279786.1|5105910_5106276_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|5106565_5107129_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|5107125_5108787_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|5108850_5110788_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|5110832_5111054_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|5110999_5113501_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|5113580_5113907_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|5113916_5114267_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|5114263_5114710_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|5114706_5115051_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275507.1|5115109_5115826_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.8e-127
WP_001030063.1|5115831_5116206_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|5116301_5116511_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_062946116.1|5116563_5119644_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.1	0.0e+00
WP_000807950.1|5119636_5119978_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_001179478.1|5119977_5120676_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000170104.1|5120692_5120947_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|5121056_5121167_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|5121469_5122348_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|5122401_5123139_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|5123084_5123321_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|5123333_5123423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|5123442_5125791_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|5126381_5129783_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001303921.1|5132091_5132367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|5132427_5133789_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|5134152_5135016_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|5134999_5136136_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|5136385_5137612_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|5137660_5138782_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085257.1|5139030_5140260_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	6.4e-132
WP_000953272.1|5140624_5140813_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_001304194.1|5140870_5141614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|5141639_5141837_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920682.1|5141829_5142015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|5142014_5142206_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000794515.1|5142195_5142438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770148.1|5142443_5142743_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761781.1|5142739_5144872_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	5.8e-173
WP_000198852.1|5145242_5145494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126692.1|5145490_5145901_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233299.1|5145911_5146184_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132080.1|5146308_5146533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137345.1|5146825_5147983_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_000504050.1|5148022_5148595_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_000267612.1|5148596_5149808_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	1.2e-188
WP_001020660.1|5149804_5150143_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.9e-30
WP_000134113.1|5150139_5150436_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145903.1|5150435_5150876_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	71.9	1.2e-61
WP_000174068.1|5150859_5151042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|5151165_5151522_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127900.1|5151505_5153167_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	9.8e-277
WP_000133425.1|5153180_5153462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|5154318_5155779_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|5155778_5156450_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|5156618_5157989_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|5157992_5158634_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|5158669_5159776_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|5159829_5160291_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|5160300_5160954_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|5161125_5162376_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|5162489_5163632_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|5163621_5163858_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|5164782_5165484_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|5165480_5165783_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|5165850_5166183_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|5166247_5166370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|5166427_5167954_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|5168455_5168911_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|5168910_5169081_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|5169073_5169364_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|5169360_5169723_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|5169719_5169860_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|5169856_5170546_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|5170867_5171173_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|5171159_5171636_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|5171852_5172035_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|5172125_5172419_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|5172710_5173121_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|5173406_5173613_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|5173777_5173972_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|5174360_5174906_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|5174880_5176806_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|5176802_5177009_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|5177005_5178607_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|5178587_5179907_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|5179916_5180249_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|5180304_5181330_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|5181371_5181770_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753014.1|5181781_5182135_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.9e-61
WP_000975100.1|5182146_5182725_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|5182721_5183117_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|5183124_5183865_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|5183880_5184303_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|5184284_5184719_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|5184711_5187261_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|5187257_5187587_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|5187586_5188285_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|5188290_5189034_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|5188970_5189603_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|5189663_5193062_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230340.1|5193128_5193728_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000268883.1|5193792_5196708_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_000885629.1|5196707_5197289_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	2.3e-100
WP_000488340.1|5197408_5198299_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|5198317_5198824_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|5198860_5199361_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|5199439_5199622_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|5200119_5200788_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|5200844_5201093_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|5201168_5201549_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|5201545_5201893_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|5201942_5203481_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|5203783_5205268_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|5205454_5206408_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|5206906_5207491_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|5207664_5208877_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
5212853:5212868	attR	CGACGTTATATTTTTT	NA	NA	NA	NA
>prophage 14
NZ_CP015023	Escherichia coli strain SRCC 1675 chromosome, complete genome	5506801	5301825	5375364	5506801	tail,portal,terminase,integrase,capsid,holin,head,transposase,protease	Stx2-converting_phage(41.51%)	80	5301662:5301689	5359836:5359863
5301662:5301689	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|5301825_5302956_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|5302933_5303182_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|5303246_5305718_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|5305810_5306002_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|5305998_5306187_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000920491.1|5306660_5306894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|5306871_5307279_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|5307301_5307520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|5307592_5307892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|5308155_5308563_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|5308639_5308867_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|5308850_5309402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|5309373_5310414_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|5310325_5310868_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|5311054_5311636_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|5311632_5311797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|5312495_5313254_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|5313532_5313745_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|5313965_5314223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|5314292_5314571_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|5314572_5315619_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|5315631_5315991_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|5315999_5316530_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|5316771_5316969_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|5317119_5318178_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000143067.1|5318974_5320828_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|5320977_5321193_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|5321197_5321542_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|5321592_5322126_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|5322396_5322966_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|5322965_5323112_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|5323339_5323525_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|5323949_5324177_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|5324218_5324584_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|5324873_5325437_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|5325433_5327095_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|5327158_5329096_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063025.1|5329140_5329362_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_064769360.1|5329307_5331809_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	97.8	0.0e+00
WP_000126019.1|5331888_5332215_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|5332224_5332575_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|5332571_5333018_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|5333014_5333359_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275507.1|5333417_5334134_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	98.3	2.8e-127
WP_001030063.1|5334139_5334514_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|5334609_5334819_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_062946116.1|5334871_5337952_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	94.1	0.0e+00
WP_000807954.1|5337944_5338286_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152128.1|5338285_5338723_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	6.5e-63
WP_000514792.1|5338910_5342387_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.3	0.0e+00
WP_001228304.1|5342454_5343054_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_000216532.1|5343205_5344519_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001023474.1|5344520_5344790_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|5345816_5347142_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|5348739_5348862_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|5348968_5349880_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|5349945_5350515_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|5351480_5353019_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|5353068_5353416_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|5353412_5353793_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|5354132_5354411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|5354838_5354985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|5355121_5355769_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|5355952_5356543_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001079499.1|5360013_5360520_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
5359836:5359863	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|5360565_5361066_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|5361151_5361331_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|5361711_5362518_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|5362517_5363711_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|5363722_5365084_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|5365084_5366680_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|5366679_5368242_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|5368333_5368378_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|5368515_5369397_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|5369393_5370014_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|5370041_5371625_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|5371837_5372710_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|5372749_5373340_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|5373336_5374095_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|5374314_5375364_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 15
NZ_CP015023	Escherichia coli strain SRCC 1675 chromosome, complete genome	5506801	5453484	5506575	5506801	tail,terminase,integrase,capsid,tRNA,holin,head,transposase	Escherichia_phage(42.0%)	60	5443364:5443379	5497221:5497236
5443364:5443379	attL	GAATTTGCCTGAATAT	NA	NA	NA	NA
WP_162829202.1|5453484_5454698_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001156434.1|5455557_5457003_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444937.1|5457002_5458313_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885454.1|5458488_5459397_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046821.1|5459726_5460290_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628061.1|5460310_5461543_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|5461797_5462781_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001625136.1|5463055_5463226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123746.1|5463258_5464632_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|5464760_5465696_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|5465747_5466983_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|5466984_5467200_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|5467299_5467488_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|5467525_5467675_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|5467730_5468540_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|5468532_5471133_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|5471234_5471510_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|5471584_5471755_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|5471754_5471976_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|5472417_5472906_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|5472902_5473058_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|5473068_5473248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|5473490_5473910_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|5473989_5474244_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|5474240_5474663_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001304174.1|5474740_5475529_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788980.1|5475535_5476282_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	81.3	5.6e-115
WP_000450712.1|5476304_5477066_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	90.5	7.0e-121
WP_001141110.1|5477081_5477504_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	3.1e-62
WP_000935420.1|5477609_5477822_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000224233.1|5478073_5478337_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208018.1|5478347_5478509_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	3.2e-15
WP_000365100.1|5478587_5478833_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	70.7	5.9e-13
WP_001100703.1|5479264_5480416_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|5480383_5481373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|5481372_5482764_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000940319.1|5483263_5483863_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247761.1|5483862_5484153_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.3e-47
WP_000640158.1|5484149_5484704_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.0e-68
WP_000466957.1|5485265_5485697_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000143079.1|5486271_5488125_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_000284522.1|5488274_5488490_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.3e-32
WP_000731221.1|5488494_5488839_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	95.6	1.8e-55
WP_000992137.1|5488889_5489423_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|5489693_5490263_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|5490262_5490409_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|5490636_5490822_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|5491246_5491474_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|5491515_5491881_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|5492170_5492734_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|5492730_5494392_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|5494455_5496393_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063094.1|5496437_5496659_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000125984.1|5499185_5499512_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
5497221:5497236	attR	ATATTCAGGCAAATTC	NA	NA	NA	NA
WP_000573391.1|5499869_5500316_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001453698.1|5501905_5502115_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_187642855.1|5502682_5503717_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	93.6	2.2e-109
WP_187642854.1|5503680_5503845_+	hypothetical protein	NA	A0A0P0ZDY0	Stx2-converting_phage	97.7	1.1e-15
WP_000807950.1|5505240_5505582_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000992137.1|5506041_5506575_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
>prophage 1
NZ_CP015022	Escherichia coli strain SRCC 1675 plasmid pSRCC 1675, complete sequence	95170	0	2218	95170		Vibrio_phage(100.0%)	3	NA	NA
WP_000273919.1|246_1149_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|1152_1458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|1534_2218_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
>prophage 2
NZ_CP015022	Escherichia coli strain SRCC 1675 plasmid pSRCC 1675, complete sequence	95170	7895	12068	95170		Thalassomonas_phage(33.33%)	6	NA	NA
WP_001302171.1|7895_8459_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_001358896.1|8544_9000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547965.1|9069_9276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290823.1|9301_9754_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000005995.1|9810_10044_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117168.1|10109_12068_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
>prophage 3
NZ_CP015022	Escherichia coli strain SRCC 1675 plasmid pSRCC 1675, complete sequence	95170	29913	33293	95170		Xanthomonas_phage(33.33%)	5	NA	NA
WP_000205762.1|29913_30660_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000704522.1|30718_31579_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000840472.1|31681_32242_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001302189.1|32374_32587_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233853.1|32831_33293_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
>prophage 4
NZ_CP015022	Escherichia coli strain SRCC 1675 plasmid pSRCC 1675, complete sequence	95170	42921	92316	95170	transposase,protease,integrase	Macacine_betaherpesvirus(50.0%)	37	42771:42785	89335:89349
42771:42785	attL	CCGGGGCGGTTCAGT	NA	NA	NA	NA
WP_001034100.1|42921_46824_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_162829202.1|47336_48550_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001302199.1|50315_51137_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|51136_52243_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|52332_54054_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|54127_55126_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001358886.1|56016_58713_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|58799_59675_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001302177.1|59675_61643_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|61642_63148_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|63149_64373_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|64403_64838_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082929.1|64834_65389_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000173396.1|65403_65751_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|65747_66347_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|66343_67321_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|67359_68532_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|68518_69031_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|69088_69922_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|70013_70415_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000839950.1|72305_72821_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000217739.1|72822_75819_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|75868_77989_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|77992_79432_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_010891288.1|80175_80406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|80526_81267_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|81551_82529_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|82936_83137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|83133_83754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|83750_84434_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|84892_85111_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|85112_85418_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|85418_86225_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_164848152.1|88079_89293_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_071526583.1|89330_89591_+	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	100.0	1.2e-40
89335:89349	attR	CCGGGGCGGTTCAGT	NA	NA	NA	NA
WP_000772446.1|90178_91345_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|91344_92316_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
