The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015126	Lactiplantibacillus plantarum strain CAUH2 chromosome, complete genome	3254946	297461	399866	3254946	protease,bacteriocin,tRNA,transposase	Staphylococcus_phage(14.29%)	97	NA	NA
WP_013355194.1|297461_298724_+|transposase	ISL3-like element ISP1 family transposase	transposase	NA	NA	NA	NA
WP_003643745.1|299008_300325_-	MFS transporter	NA	NA	NA	NA	NA
WP_003643746.1|300494_301397_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_013355164.1|301409_301610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355165.1|302292_303705_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_003641910.1|303770_304016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643749.1|304144_304708_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_013355166.1|304745_305717_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_027821525.1|305713_306028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355168.1|306188_307364_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_011100969.1|307539_308706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641920.1|309300_310116_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003641921.1|310128_311220_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	7.2e-18
WP_003641922.1|311598_311871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011100970.1|312097_312640_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011100971.1|312636_314082_+	MFS transporter	NA	NA	NA	NA	NA
WP_011100972.1|314411_315728_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.6	3.3e-33
WP_011100973.1|316222_317182_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003641927.1|317284_317554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643762.1|317784_318348_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_013355171.1|318541_319210_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_013355172.1|319367_320873_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_013355173.1|321137_321506_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|321618_322128_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_013355174.1|322158_323355_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003646440.1|323464_323935_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641935.1|323953_324409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355176.1|324512_325085_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_013355177.1|325250_326171_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_013355178.1|326307_327219_+	oxidoreductase	NA	NA	NA	NA	NA
WP_003646442.1|327965_328412_-	ribonuclease H	NA	NA	NA	NA	NA
WP_063096650.1|328649_330176_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_003641941.1|330176_331148_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_003646444.1|331225_332557_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003643773.1|333022_334540_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003641944.1|334554_336384_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003641945.1|336398_337121_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_063096651.1|337703_338198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063096856.1|339037_341386_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_063096652.1|341387_343295_+	pre-toxin TG domain-containing protein	NA	NA	NA	NA	NA
WP_003641948.1|343291_344209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641949.1|344252_344516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641950.1|344627_344906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641952.1|345285_345672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641954.1|346121_346313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114071742.1|346515_346662_+	glycohydrolase toxin TNT-related protein	NA	NA	NA	NA	NA
WP_003641956.1|346738_347146_+	immunity 63 family protein	NA	NA	NA	NA	NA
WP_003641960.1|348416_348692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641962.1|349073_349691_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003641963.1|349694_350849_-	MFS transporter	NA	NA	NA	NA	NA
WP_011100993.1|350852_351644_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003641965.1|351714_352587_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641966.1|352746_353562_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_011100994.1|354087_355464_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_011100995.1|355508_356693_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003641969.1|357077_357281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641971.1|357692_358361_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641972.1|358357_358531_-|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnK	bacteriocin	NA	NA	NA	NA
WP_003641973.1|358561_358729_-|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnJ	bacteriocin	NA	NA	NA	NA
WP_003641974.1|359590_359791_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641975.1|359918_360086_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003641976.1|360203_361403_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003641977.1|361433_362180_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641979.1|363057_363204_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_011100998.1|363394_364723_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_011100999.1|364723_365467_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003641982.1|365585_366329_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003646470.1|366633_367407_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003643811.1|367505_367664_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003641985.1|367688_367859_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_003641986.1|368125_370276_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_003641987.1|370291_371668_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_003641990.1|372514_373183_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641991.1|373269_373950_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_063096653.1|374043_374730_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641993.1|374867_375071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641994.1|375165_377475_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_063096654.1|377733_378510_+	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_003643815.1|378948_379965_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003641997.1|380372_381083_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641998.1|381155_382517_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641999.1|382523_382712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642000.1|382701_383124_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003643816.1|383346_384702_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_063096655.1|384719_386156_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
WP_003642003.1|386276_387173_+	ROK family protein	NA	NA	NA	NA	NA
WP_003642004.1|387322_388069_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003643818.1|388181_389195_+|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642006.1|389648_390782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643820.1|390786_391581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642008.1|391749_392667_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003642009.1|392712_393987_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642010.1|393979_394939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642011.1|394960_395665_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003642012.1|395664_396507_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003646492.1|397103_397493_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003643823.1|397814_399866_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
>prophage 2
NZ_CP015126	Lactiplantibacillus plantarum strain CAUH2 chromosome, complete genome	3254946	537411	630208	3254946	terminase,plate,head,tRNA,portal,tail,capsid,protease,integrase	Lactobacillus_phage(36.36%)	106	538323:538337	574438:574452
WP_063096859.1|537411_538104_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003643927.1|538293_539625_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.3	5.4e-68
538323:538337	attL	GTGCTAAAACAGTTG	NA	NA	NA	NA
WP_003640926.1|539700_540384_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_003640927.1|540392_540689_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011101073.1|540827_541364_+	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	46.4	1.1e-35
WP_003643928.1|542411_543791_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003640931.1|543806_544982_+	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003640932.1|545307_546798_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_013355229.1|547075_548488_+|tRNA	cysteine--tRNA ligase	tRNA	F1C979	Terra1_virus	27.7	1.5e-44
WP_003640934.1|548489_548900_+	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_003640935.1|548871_549657_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003640936.1|549658_550204_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_003640938.1|550710_551313_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003637768.1|551374_551524_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003640939.1|551535_551721_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003643932.1|551825_552374_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_022638154.1|552401_553289_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003640942.1|553390_553816_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003640943.1|553916_554606_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003643933.1|554804_555308_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_003637775.1|555369_555738_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_063096662.1|555889_557092_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A126GGK4	Streptococcus_phage	29.5	9.0e-38
WP_057137100.1|557471_558158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063096663.1|558332_558911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024625371.1|558960_560307_-	DUF4041 domain-containing protein	NA	A0A1B0Y697	Lactobacillus_phage	53.1	3.5e-83
WP_063096664.1|560332_560746_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	31.3	2.6e-05
WP_011101082.1|560757_561120_-	helix-turn-helix domain-containing protein	NA	A0A0U4KKM4	Exiguobacterium_phage	32.0	2.6e-09
WP_063096665.1|561594_561909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101085.1|561946_562183_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	30.7	8.5e-09
WP_011101086.1|562329_562530_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101087.1|562688_562871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101088.1|562931_563486_+	hypothetical protein	NA	O03909	Lactobacillus_phage	100.0	3.6e-98
WP_011101089.1|563491_563776_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082222627.1|564147_564534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061876077.1|564530_565418_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.0	2.5e-61
WP_061876303.1|565449_566202_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	52.6	6.3e-74
WP_011101094.1|566283_567216_+	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	44.3	1.1e-56
WP_011101095.1|567212_567500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101096.1|567496_568027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101097.1|568023_568557_+	hypothetical protein	NA	O03915	Lactobacillus_phage	51.7	4.9e-36
WP_063096667.1|568549_568969_+	RusA family crossover junction endodeoxyribonuclease	NA	A8YQM5	Lactobacillus_phage	42.3	2.8e-23
WP_063096668.1|568965_569196_+	hypothetical protein	NA	O03916	Lactobacillus_phage	57.9	1.6e-20
WP_063096669.1|569332_569728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187346375.1|569773_569932_+	hypothetical protein	NA	O03920	Lactobacillus_phage	82.7	1.6e-16
WP_063096670.1|570017_570290_+	hypothetical protein	NA	Q6J1U7	Lactobacillus_phage	47.6	2.5e-12
WP_082222628.1|570286_570754_+	DUF1642 domain-containing protein	NA	A0A2K9VC25	Lactobacillus_phage	72.9	1.3e-40
WP_082222629.1|570746_570914_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	84.8	2.0e-12
WP_063096671.1|571046_571523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063096672.1|572046_572817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162786272.1|573021_573240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063096674.1|573208_573805_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	33.8	1.5e-14
WP_061876085.1|573788_575075_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	50.6	8.8e-116
574438:574452	attR	GTGCTAAAACAGTTG	NA	NA	NA	NA
WP_162786275.1|575127_576723_+|portal	phage portal protein	portal	D2IZM0	Enterococcus_phage	34.2	1.0e-65
WP_011101113.1|576722_577667_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_063096675.1|577774_578422_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_041153519.1|578435_579506_+|capsid	phage capsid protein	capsid	A0A0S0N2Q7	Pseudomonas_phage	30.6	2.0e-33
WP_011101116.1|579520_579886_+|head,tail	phage head-tail connector protein	head,tail	H9A0V3	Staphylococcus_phage	38.2	3.0e-05
WP_011101117.1|579890_580214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101118.1|580203_580758_+|tail	tail protein	tail	NA	NA	NA	NA
WP_011101119.1|580758_581145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101120.1|581156_581744_+|tail	tail protein	tail	NA	NA	NA	NA
WP_011101121.1|581761_582274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101122.1|582342_582579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061876086.1|582578_586583_+	tape measure protein	NA	E9LUR1	Lactobacillus_phage	44.3	5.2e-82
WP_011101124.1|586576_587314_+	hypothetical protein	NA	A0A1S5SA63	Streptococcus_phage	36.6	4.1e-41
WP_063096676.1|589193_590186_+	SGNH/GDSL hydrolase family protein	NA	A0A1J0MFI8	Staphylococcus_phage	40.6	9.1e-36
WP_011101127.1|590200_590815_+|plate	phage baseplate upper protein	plate	A0A1J0MFQ3	Staphylococcus_phage	47.8	7.3e-44
WP_011101128.1|590820_591561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101129.1|591561_591882_+	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
WP_011101130.1|591881_592058_+	XkdX family protein	NA	NA	NA	NA	NA
WP_063096677.1|592035_593184_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	35.7	1.2e-50
WP_011101132.1|593184_593481_+	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	76.5	4.4e-39
WP_011101134.1|594673_594880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080315010.1|595045_595147_+	hypothetical protein	NA	C1KFN7	Lactobacillus_virus	66.7	9.1e-05
WP_041153537.1|595277_596798_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_013355232.1|597577_598555_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_013355233.1|598567_599236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022638342.1|599539_602143_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_003640949.1|602317_602893_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	41.7	6.4e-26
WP_063096679.1|602974_603985_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	60.5	3.1e-108
WP_013355235.1|604012_606178_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	63.3	2.2e-268
WP_003640952.1|606316_606547_-	redoxin NrdH	NA	X2KRY7	Enterococcus_phage	40.0	2.8e-09
WP_003640953.1|606769_607378_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003640954.1|607380_607887_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_013355236.1|608412_610110_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.0e-55
WP_003640956.1|610131_610440_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003637790.1|610455_611055_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640957.1|611069_611321_+	YaaL family protein	NA	NA	NA	NA	NA
WP_011101140.1|611718_612384_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640965.1|612380_612710_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_013355238.1|612726_613746_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640967.1|613770_614118_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_013355239.1|614216_615113_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	4.4e-82
WP_003640969.1|615116_615902_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_013355240.1|616040_617036_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.5	2.0e-51
WP_003640973.1|619113_619968_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_022638341.1|619964_620768_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_003640975.1|620757_621528_-	phosphonate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.8	4.9e-13
WP_003640976.1|621565_622618_-	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_003640977.1|622897_623623_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_063096680.1|623606_624185_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_003640979.1|624177_624633_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_011101143.1|624637_625684_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.4	1.0e-61
WP_013355247.1|626570_628553_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.2	4.4e-50
WP_003640983.1|628721_629399_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_011101144.1|629563_630208_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP015126	Lactiplantibacillus plantarum strain CAUH2 chromosome, complete genome	3254946	819903	867388	3254946	protease,integrase,transposase	Staphylococcus_virus(20.0%)	40	865670:865690	868459:868479
WP_013355290.1|819903_821460_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.8	6.6e-17
WP_063096690.1|821525_823217_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.3	1.1e-92
WP_013355292.1|823398_824574_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9I5C3	Streptococcus_phage	30.5	2.6e-37
WP_033098994.1|824579_824765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355293.1|824879_825746_-	KilA-N domain-containing protein	NA	Q4ZC41	Staphylococcus_virus	57.5	8.1e-81
WP_049787978.1|826004_826934_-	DUF4428 domain-containing protein	NA	O48432	Lactobacillus_phage	31.2	3.1e-22
WP_049787979.1|826970_828107_-	DUF4428 domain-containing protein	NA	O48432	Lactobacillus_phage	26.3	4.1e-16
WP_154813574.1|828152_828293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013355295.1|828555_828897_-	helix-turn-helix transcriptional regulator	NA	A0A059T669	Listeria_phage	53.9	6.9e-20
WP_114403795.1|829061_829277_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_114403796.1|829227_830475_-|transposase	ISL3-like element ISP1 family transposase	transposase	NA	NA	NA	NA
WP_013355297.1|830713_831307_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_003641164.1|831783_832152_-	membrane protein	NA	NA	NA	NA	NA
WP_003641165.1|832385_832754_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	42.7	5.9e-17
WP_013355298.1|833291_836255_+	DNA2/NAM7 family helicase	NA	NA	NA	NA	NA
WP_011101204.1|836556_837249_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013355299.1|837468_837813_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101206.1|837944_839243_-	MFS transporter	NA	NA	NA	NA	NA
WP_063096691.1|839516_842021_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_021355861.1|842152_842467_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	36.0	3.3e-08
WP_013355302.1|842629_845203_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_082222630.1|845343_847119_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.3	1.9e-92
WP_033098993.1|847153_847744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033098992.1|847743_848811_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_013355305.1|848877_849234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101208.1|849828_850212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641171.1|850201_852049_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.3	4.5e-20
WP_003641172.1|852289_852544_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003641173.1|852555_853101_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003641174.1|853113_853296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644046.1|853310_853733_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003641176.1|853793_854234_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_016511031.1|854437_855238_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_013355308.1|855369_856380_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_003644049.1|856741_857074_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003641180.1|857179_857752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013355309.1|857933_860468_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.3	9.3e-69
WP_011101215.1|863579_865166_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	62.9	9.3e-176
WP_063096692.1|865162_866320_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	24.8	1.1e-13
865670:865690	attL	AACCTTATCGCTGCCAATGAG	NA	NA	NA	NA
WP_013355312.1|866470_867388_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	45.0	2.7e-74
WP_013355312.1|866470_867388_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	45.0	2.7e-74
868459:868479	attR	AACCTTATCGCTGCCAATGAG	NA	NA	NA	NA
>prophage 4
NZ_CP015126	Lactiplantibacillus plantarum strain CAUH2 chromosome, complete genome	3254946	1295846	1308624	3254946		Lactobacillus_phage(70.0%)	11	NA	NA
WP_013355467.1|1295846_1297085_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	98.7	2.4e-219
WP_013355468.1|1297175_1298147_-	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	98.5	3.5e-181
WP_003643099.1|1298332_1299280_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_003643097.1|1299622_1300237_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_063096717.1|1300239_1302678_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.5	0.0e+00
WP_013355469.1|1302765_1303326_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	98.4	6.5e-100
WP_013355470.1|1303396_1303837_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	97.9	1.2e-75
WP_022638019.1|1304227_1305595_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.0	3.4e-25
WP_021356352.1|1305587_1306280_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	5.3e-35
WP_013355473.1|1306989_1307655_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_013355474.1|1307679_1308624_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	45.5	2.0e-72
>prophage 5
NZ_CP015126	Lactiplantibacillus plantarum strain CAUH2 chromosome, complete genome	3254946	2137294	2167806	3254946	terminase,head,portal,tail,capsid,protease	Oenococcus_phage(47.83%)	29	NA	NA
WP_003644665.1|2137294_2139025_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	2.6e-46
WP_003641420.1|2139248_2139641_-	YxeA family protein	NA	NA	NA	NA	NA
WP_003644667.1|2139863_2140715_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_063096755.1|2141636_2142173_-	hypothetical protein	NA	E9LUS0	Lactobacillus_phage	97.6	1.1e-35
WP_003644510.1|2142184_2142448_-	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_063096756.1|2142447_2143620_-	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	89.7	6.2e-201
WP_021732622.1|2143747_2144182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046811036.1|2144184_2144634_-	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	40.5	2.8e-21
WP_063096757.1|2144655_2149998_-	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	58.9	2.4e-143
WP_099739626.1|2150012_2150345_-	hypothetical protein	NA	V5UQS8	Oenococcus_phage	73.4	2.2e-42
WP_063096758.1|2150388_2156220_-	hypothetical protein	NA	V5URV5	Oenococcus_phage	41.1	4.1e-229
WP_063096863.1|2156235_2156499_-	hypothetical protein	NA	V9QKH3	Oenococcus_phage	65.4	1.8e-23
WP_003642826.1|2156606_2157005_-	hypothetical protein	NA	V9QJA0	Oenococcus_phage	74.8	3.0e-46
WP_063096759.1|2157104_2157581_-|tail	phage tail protein	tail	Q6SE73	Lactobacillus_prophage	58.7	1.0e-45
WP_003642824.1|2157589_2157955_-	hypothetical protein	NA	V5UQS4	Oenococcus_phage	53.4	3.0e-29
WP_063096760.1|2157954_2158506_-	HK97 gp10 family phage protein	NA	V5URV0	Oenococcus_phage	61.7	2.0e-64
WP_046947686.1|2158498_2158855_-	hypothetical protein	NA	V5US85	Oenococcus_phage	62.3	3.2e-36
WP_024971556.1|2158854_2159187_-|head,tail	phage head-tail connector protein	head,tail	V9QJ97	Oenococcus_phage	45.3	1.8e-12
WP_003642820.1|2159198_2159375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642819.1|2159387_2160410_-|capsid	major capsid protein	capsid	V5US24	Oenococcus_phage	62.5	3.7e-117
WP_021732628.1|2160429_2160780_-	hypothetical protein	NA	V5UTH9	Oenococcus_phage	63.8	4.5e-30
WP_063096761.1|2160794_2161472_-	DUF4355 domain-containing protein	NA	Q6SE80	Lactobacillus_prophage	32.1	4.6e-15
WP_063096762.1|2161644_2161851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642815.1|2161902_2162181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033609661.1|2163987_2164284_-|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	40.2	1.1e-10
WP_063096763.1|2164213_2165722_-|portal	phage portal protein	portal	V5US18	Oenococcus_phage	52.2	8.1e-137
WP_063096764.1|2165733_2166972_-|terminase	PBSX family phage terminase large subunit	terminase	M1PG09	Streptococcus_phage	61.3	2.9e-140
WP_063096765.1|2166961_2167558_-|terminase	terminase small subunit	terminase	H9A0M8	Staphylococcus_phage	42.3	1.4e-12
WP_063096766.1|2167611_2167806_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	58.0	1.7e-07
>prophage 6
NZ_CP015126	Lactiplantibacillus plantarum strain CAUH2 chromosome, complete genome	3254946	2170949	2181678	3254946		Lactobacillus_phage(63.64%)	23	NA	NA
WP_063096770.1|2170949_2171411_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	6.3e-40
WP_003642804.1|2171488_2171629_-	hypothetical protein	NA	E9LUN8	Lactobacillus_phage	100.0	6.8e-06
WP_046947681.1|2171621_2172002_-	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_063096771.1|2171998_2172517_-	hypothetical protein	NA	O03915	Lactobacillus_phage	69.1	1.2e-55
WP_063096772.1|2172521_2173244_-	phage antirepressor KilAC domain-containing protein	NA	Q8SDM9	Staphylococcus_phage	45.1	8.0e-50
WP_003642800.1|2173240_2173528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063096773.1|2173524_2174433_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_162786277.1|2174513_2175266_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	50.6	7.8e-72
WP_063096775.1|2175297_2176197_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	53.3	3.5e-63
WP_082222636.1|2176193_2176580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063096777.1|2176908_2177196_+	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	48.9	1.6e-22
WP_063096778.1|2177445_2177958_-	transcriptional regulator	NA	D6PST4	Lactobacillus_phage	45.3	1.9e-29
WP_063096779.1|2178024_2178330_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_003642792.1|2178341_2178512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046811051.1|2178536_2178833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046811052.1|2178832_2179039_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003642789.1|2179181_2179412_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	36.8	8.5e-06
WP_063096780.1|2179417_2179912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046811054.1|2180011_2180284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046811055.1|2180280_2180478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063096781.1|2180494_2180731_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003644967.1|2180881_2181250_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	44.1	5.7e-20
WP_063096782.1|2181261_2181678_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	30.6	5.9e-05
>prophage 7
NZ_CP015126	Lactiplantibacillus plantarum strain CAUH2 chromosome, complete genome	3254946	2389886	2398397	3254946		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645867.1|2389886_2390465_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
WP_013355836.1|2390457_2391483_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	40.7	5.4e-60
WP_003642591.1|2391479_2392934_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_003645864.1|2392918_2395138_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.3	4.5e-144
WP_011101895.1|2395130_2395811_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2395810_2396065_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003642587.1|2396066_2396798_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_063096803.1|2396800_2397931_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003645861.1|2397914_2398397_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
