The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015150	Bacillus thuringiensis strain Bc601, complete genome	5627121	219578	314471	5627121	head,holin,integrase,portal,transposase,protease,tRNA,terminase,capsid,tail	Bacillus_phage(50.88%)	101	252407:252424	287923:287940
WP_087942833.1|219578_220921_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
WP_000766421.1|221028_221901_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000664237.1|222342_222450_+	DUF3948 family protein	NA	NA	NA	NA	NA
WP_000654250.1|222484_222601_+	DUF3948 family protein	NA	NA	NA	NA	NA
WP_000654250.1|222635_222752_+	DUF3948 family protein	NA	NA	NA	NA	NA
WP_000654250.1|222786_222903_+	DUF3948 family protein	NA	NA	NA	NA	NA
WP_001083690.1|222946_223057_+	DUF3948 family protein	NA	NA	NA	NA	NA
WP_000810922.1|223450_224569_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_000674006.1|224635_225592_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_013141710.1|225557_226730_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000809349.1|226962_228378_+	amino acid permease	NA	NA	NA	NA	NA
WP_000799726.1|228485_229757_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	24.9	7.8e-16
WP_000161427.1|229985_231071_+	D-alanine--D-alanine ligase B	NA	NA	NA	NA	NA
WP_000595961.1|231133_232510_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_000206584.1|232815_234393_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.2	1.7e-68
WP_000961167.1|234487_235450_+	UV DNA damage repair endonuclease UvsE	NA	NA	NA	NA	NA
WP_000908522.1|235442_236015_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_000583417.1|236108_236468_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002100659.1|236624_237575_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_000390616.1|237692_238862_+	alanine racemase	NA	NA	NA	NA	NA
WP_000004570.1|239170_239458_+	antitoxin EndoAI	NA	NA	NA	NA	NA
WP_000635965.1|239462_239813_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	37.7	1.7e-13
WP_000426236.1|239880_242049_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_001143642.1|242107_242224_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_000344239.1|242419_242878_+	SprT family protein	NA	NA	NA	NA	NA
WP_000049649.1|249372_249846_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_000865756.1|249826_250519_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000367190.1|250532_250976_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000414585.1|250975_251992_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.4	1.9e-68
252407:252424	attL	ATTAAAAGAAAAAAAGAT	NA	NA	NA	NA
WP_001987845.1|252477_254457_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	2.8e-52
WP_000372699.1|254590_255220_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_001246200.1|255249_255441_-	YdiK family protein	NA	NA	NA	NA	NA
WP_000745326.1|255437_256187_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917311.1|256578_256863_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029993.1|256901_258536_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_016090299.1|258614_259793_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	62.9	8.0e-140
WP_016090298.1|259841_260426_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016090297.1|260648_260918_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016090295.1|261220_261547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090294.1|261648_264078_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	32.6	2.2e-83
WP_016090293.1|264409_264637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090291.1|264790_265987_+|portal	phage portal protein	portal	A0A1L2BY94	Clostridium_phage	35.9	5.0e-65
WP_016090290.1|265983_266562_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBP9	Clostridium_phage	30.2	2.6e-11
WP_016090289.1|266566_267829_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_016090288.1|267895_268183_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_016090287.1|268175_268466_+	HNH endonuclease	NA	R9TNN2	Paenibacillus_phage	53.2	1.6e-25
WP_016090286.1|268592_268940_+	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	43.9	3.9e-18
WP_044157420.1|268992_270585_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	52.6	2.8e-156
WP_016090284.1|270601_270931_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_016090283.1|270943_271153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743906.1|271872_273411_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_001123356.1|273476_274544_-|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	99.7	3.3e-201
WP_000654304.1|274570_275011_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2MV59	Bacillus_phage	97.9	6.5e-79
WP_000435973.1|275024_275504_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVI1	Bacillus_phage	99.4	6.9e-82
WP_001042666.1|275689_275944_+	DUF739 family protein	NA	A0A0S2MVA3	Bacillus_phage	98.8	5.5e-38
WP_000383685.1|275957_276146_+	hypothetical protein	NA	A0A0S2MV91	Bacillus_phage	100.0	4.5e-29
WP_000359729.1|276371_277187_+	hypothetical protein	NA	A0A0S2MV65	Bacillus_phage	81.6	6.1e-123
WP_000665325.1|277199_277397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000073375.1|277810_278698_+	DnaD domain protein	NA	W8CYG5	Bacillus_phage	41.7	6.8e-43
WP_000235015.1|278636_279512_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	47.2	4.3e-66
WP_000337986.1|279527_279722_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	76.6	1.0e-20
WP_000805170.1|279747_279921_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	91.2	2.6e-23
WP_000811696.1|279935_280190_+	hypothetical protein	NA	A0A1B0T6B9	Bacillus_phage	88.1	1.4e-36
WP_002134040.1|280198_280663_+	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	35.4	4.4e-17
WP_000665841.1|280689_280902_+	hypothetical protein	NA	A0A1B0T6B5	Bacillus_phage	93.5	1.5e-25
WP_002134037.1|280946_281132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000387671.1|281183_281582_+	hypothetical protein	NA	A0A068ELY9	Bacillus_phage	79.1	2.8e-57
WP_000805074.1|281606_282029_+	hypothetical protein	NA	A0A1B1P7B4	Bacillus_phage	82.9	2.3e-65
WP_000397931.1|282204_282471_+	hypothetical protein	NA	D2XR50	Bacillus_phage	42.7	2.2e-13
WP_000404182.1|282508_282907_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	75.0	1.2e-52
WP_000365653.1|283193_283412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000234108.1|283598_283781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001202682.1|284031_284235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000525861.1|284279_284561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166182.1|284874_285357_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	82.5	1.9e-71
WP_001012113.1|285356_285899_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	92.2	1.3e-89
WP_000124642.1|286574_286835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000336221.1|286976_287381_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	75.0	2.7e-47
WP_000666403.1|287377_287713_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.9	1.0e-52
WP_000124848.1|287863_288199_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	31.2	2.3e-07
287923:287940	attR	ATTAAAAGAAAAAAAGAT	NA	NA	NA	NA
WP_000615714.1|288195_289854_+|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	79.3	1.0e-257
WP_044157418.1|289919_291026_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	89.9	2.4e-186
WP_000216402.1|291009_291786_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	2.5e-57
WP_000234863.1|291806_292970_+	hypothetical protein	NA	A0A2H4JH29	uncultured_Caudovirales_phage	96.9	1.7e-211
WP_001243199.1|292982_293279_+	hypothetical protein	NA	A0A2H4JF26	uncultured_Caudovirales_phage	87.8	1.6e-41
WP_001182260.1|293280_293655_+|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	90.3	1.1e-58
WP_000818829.1|293642_294080_+	hypothetical protein	NA	A0A2H4JBV5	uncultured_Caudovirales_phage	93.1	7.4e-75
WP_000793436.1|294076_294439_+	DUF3168 domain-containing protein	NA	A0A2H4JBW1	uncultured_Caudovirales_phage	85.0	1.4e-55
WP_001251821.1|294454_295039_+|tail	tail protein	tail	A0A2H4JET9	uncultured_Caudovirales_phage	93.3	2.9e-98
WP_015382157.1|295095_295470_+	hypothetical protein	NA	A0A2H4JBU8	uncultured_Caudovirales_phage	86.8	1.8e-53
WP_001173498.1|295634_300632_+|tail	phage tail protein	tail	A0A2H4JI37	uncultured_Caudovirales_phage	80.5	0.0e+00
WP_000093847.1|300671_302141_+|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	78.3	1.1e-231
WP_015382146.1|302137_307702_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	64.1	0.0e+00
WP_015382147.1|307718_308084_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	59.0	3.7e-35
WP_000390477.1|308210_308435_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	89.2	1.1e-26
WP_000373855.1|308510_308936_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	97.2	4.8e-71
WP_063167447.1|308935_309874_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	94.7	3.3e-136
WP_000579579.1|310325_311576_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	41.9	2.7e-69
WP_000956437.1|312579_312846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002134199.1|312861_313053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000741567.1|313394_314471_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	86.6	1.2e-171
>prophage 2
NZ_CP015150	Bacillus thuringiensis strain Bc601, complete genome	5627121	360580	368956	5627121		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|360580_361888_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170544.1|361976_362696_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000278823.1|362688_362943_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666789.1|362939_363623_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055562.1|363606_365826_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.6e-163
WP_000879025.1|365810_367226_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262439.1|367331_368372_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000088589.1|368368_368956_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 3
NZ_CP015150	Bacillus thuringiensis strain Bc601, complete genome	5627121	727660	782036	5627121	head,integrase,portal,transposase,protease,terminase,capsid,tail	Bacillus_phage(92.86%)	63	737408:737426	779402:779420
WP_001252962.1|727660_730060_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_000658667.1|730378_730720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000964468.1|730741_731167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000873276.1|731087_732242_-	MFS transporter	NA	NA	NA	NA	NA
WP_000645827.1|732467_733520_+	(R,R)-butanediol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.6	3.9e-21
WP_000948209.1|733639_733984_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_087970930.1|734027_735187_-|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_000730997.1|735528_736380_+	phospholipase C	NA	NA	NA	NA	NA
WP_000676802.1|736456_737503_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	59.0	1.1e-87
737408:737426	attL	AATGATTACTCTGATCATT	NA	NA	NA	NA
WP_000262047.1|737441_738542_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	100.0	8.6e-205
WP_000466636.1|739059_740298_+	hypothetical protein	NA	I7J4K0	Bacillus_phage	100.0	8.2e-236
WP_000511082.1|740697_741042_-	helix-turn-helix transcriptional regulator	NA	I7J6V3	Bacillus_phage	100.0	4.2e-57
WP_000813892.1|741190_741427_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE0	Bacillus_phage	100.0	8.7e-38
WP_000549466.1|741459_741648_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE9	Bacillus_phage	100.0	3.2e-27
WP_015382175.1|741873_742653_+	phage regulatory protein	NA	A0A0S2GLP8	Bacillus_phage	100.0	1.6e-141
WP_000218620.1|742814_743129_+	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	100.0	1.1e-51
WP_000123128.1|743403_744051_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	100.0	1.8e-117
WP_015382176.1|744274_745291_+	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	100.0	2.8e-189
WP_002133989.1|745253_746066_+	hypothetical protein	NA	A0A0S2GLK2	Bacillus_phage	100.0	1.2e-155
WP_000436951.1|746107_746374_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_000817807.1|746445_746610_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_001025406.1|746627_746843_+	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000705118.1|746839_747139_-	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_038413787.1|747289_747589_+	hypothetical protein	NA	A0A0S2GLL5	Bacillus_phage	99.0	1.8e-51
WP_000404184.1|747942_748350_+	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	100.0	4.9e-73
WP_000965619.1|749758_750040_+	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_015382492.1|750397_750883_+	transcription regulator	NA	A0A0S2GLJ9	Bacillus_phage	100.0	7.9e-86
WP_001012176.1|750879_751422_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	100.0	3.3e-96
WP_015382178.1|751628_751874_+	hypothetical protein	NA	A0A0S2GLK0	Bacillus_phage	100.0	9.0e-38
WP_000792998.1|752245_752428_+	hypothetical protein	NA	A0A0S2GLH0	Bacillus_phage	100.0	3.1e-27
WP_001050326.1|752509_753376_+	hypothetical protein	NA	A0A0S2GLF7	Bacillus_phage	100.0	2.8e-166
WP_000443964.1|753424_753610_+	hypothetical protein	NA	A0A0S2GLH7	Bacillus_phage	100.0	8.6e-25
WP_000002720.1|753638_753878_+	hypothetical protein	NA	A0A0S2GLE8	Bacillus_phage	98.7	5.2e-22
WP_000778983.1|753894_754107_+	hypothetical protein	NA	A0A0S2GM40	Bacillus_phage	100.0	2.7e-30
WP_001198493.1|754242_754497_+	hypothetical protein	NA	A0A0S2GLL6	Bacillus_phage	100.0	3.9e-44
WP_001139459.1|754486_754864_+	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	100.0	6.8e-69
WP_000233388.1|754992_755496_+|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	100.0	8.0e-89
WP_015382179.1|755497_757192_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	100.0	0.0e+00
WP_015382180.1|757380_758634_+|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	99.8	3.5e-242
WP_015382181.1|758620_759331_+|protease	Clp protease ClpP	protease	A0A0S2GLD5	Bacillus_phage	100.0	5.5e-128
WP_015382182.1|759368_760535_+|capsid	phage major capsid protein	capsid	A0A0S2GLG0	Bacillus_phage	100.0	3.3e-210
WP_000244586.1|760555_760843_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	1.8e-45
WP_001068030.1|760829_761153_+|head	phage head closure protein	head	H0USW8	Bacillus_phage	100.0	1.1e-56
WP_000763223.1|761145_761583_+	HK97 gp10 family phage protein	NA	A0A0S2GLH3	Bacillus_phage	100.0	7.9e-77
WP_000609197.1|761579_761939_+	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	100.0	3.5e-62
WP_000896661.1|761939_762545_+|tail	tail protein	tail	A0A0S2GLI0	Bacillus_phage	100.0	9.2e-100
WP_000779042.1|762591_762909_+	hypothetical protein	NA	A0A0S2GLH2	Bacillus_phage	100.0	8.9e-54
WP_000344048.1|762938_763115_+	hypothetical protein	NA	I3WTY5	Bacillus_phage	100.0	1.1e-26
WP_038413316.1|763129_767056_+|tail	phage tail tape measure protein	tail	A0A0S2GLG8	Bacillus_phage	100.0	0.0e+00
WP_000232880.1|767067_768552_+|tail	phage tail protein	tail	A0A0S2GLF9	Bacillus_phage	100.0	9.9e-297
WP_015382189.1|768548_772574_+	minor structural protein	NA	A0A0S2GLH1	Bacillus_phage	100.0	0.0e+00
WP_000822820.1|772670_773630_+|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	99.7	3.1e-182
WP_000151530.1|773643_773925_+	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	100.0	9.1e-42
WP_001076454.1|773927_774140_+	hypothetical protein	NA	A0A0S2GM50	Bacillus_phage	100.0	1.4e-34
WP_000542506.1|774139_774958_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	100.0	3.2e-164
WP_000423300.1|774998_775328_-	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	100.0	2.4e-54
WP_000467327.1|775396_775618_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	100.0	2.9e-35
WP_000495118.1|776080_776401_+	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	100.0	1.9e-51
WP_000511371.1|776411_777578_+	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	100.0	9.4e-226
WP_000842173.1|777567_778176_+	hypothetical protein	NA	A0A0S2GLL8	Bacillus_phage	100.0	3.3e-113
WP_000730127.1|778180_779062_-	HTH domain-containing protein	NA	I7ILW0	Bacillus_phage	100.0	1.5e-159
WP_000373746.1|779559_780732_+	amino acid deaminase/aldolase	NA	NA	NA	NA	NA
779402:779420	attR	AATGATTACTCTGATCATT	NA	NA	NA	NA
WP_000948949.1|780719_782036_+	FAD-binding protein	NA	A0A2K9L0J9	Tupanvirus	22.1	5.3e-07
>prophage 4
NZ_CP015150	Bacillus thuringiensis strain Bc601, complete genome	5627121	1253748	1298486	5627121	head,holin,portal,transposase,protease,terminase,capsid,tail	Bacillus_phage(46.94%)	55	NA	NA
WP_000333967.1|1253748_1255527_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.3	1.6e-22
WP_000650392.1|1255557_1256961_-	recombinase family protein	NA	A0A2I7SDG6	Paenibacillus_phage	44.8	1.5e-113
WP_000289677.1|1257104_1257323_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000130922.1|1257338_1258022_-	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	34.2	1.3e-22
WP_000385074.1|1258171_1258444_+	helix-turn-helix transcriptional regulator	NA	A0A141E0W0	Streptococcus_phage	50.0	3.0e-10
WP_000372563.1|1258926_1259679_+	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	81.0	4.8e-106
WP_001186272.1|1259690_1259879_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	96.8	6.1e-26
WP_000453494.1|1259905_1260340_+	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	99.3	1.1e-73
WP_000178947.1|1260358_1261072_+	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	98.3	1.0e-126
WP_015382226.1|1261071_1261287_+	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	97.2	5.5e-31
WP_038413358.1|1261219_1261558_+	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	96.4	2.6e-51
WP_000510888.1|1261651_1262605_+	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	90.2	6.4e-148
WP_000933912.1|1262616_1263096_+	hypothetical protein	NA	A0A2H4J396	uncultured_Caudovirales_phage	93.7	1.3e-80
WP_000139235.1|1263088_1263319_+	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	100.0	2.5e-34
WP_015382228.1|1263342_1263900_+	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	71.4	4.0e-65
WP_001010921.1|1263938_1264373_+	hypothetical protein	NA	A0A1C8E9B0	Bacillus_phage	95.1	1.3e-76
WP_001268033.1|1264431_1264722_+	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	94.8	8.4e-51
WP_001093039.1|1264868_1265660_+	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	100.0	6.8e-143
WP_000356654.1|1265744_1265927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000389429.1|1266086_1266491_+	hypothetical protein	NA	I6TG10	Staphylococcus_virus	37.1	7.7e-10
WP_000590880.1|1266724_1267036_+	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	83.5	2.9e-41
WP_000540088.1|1267071_1267599_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	98.3	5.4e-96
WP_038413362.1|1267595_1267922_+	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	97.2	2.3e-57
WP_033676375.1|1267959_1268361_+	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	98.5	1.8e-67
WP_000711196.1|1268743_1269163_-	HicB family protein	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	79.9	7.6e-61
WP_071686481.1|1269214_1269397_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	67.2	9.4e-16
WP_000499523.1|1269693_1270887_+|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000196707.1|1271158_1271359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001051281.1|1271375_1271678_+	HNH endonuclease	NA	A0A1B0YEC6	Lactobacillus_phage	48.5	1.5e-18
WP_001149928.1|1271680_1272076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001282601.1|1272168_1272531_+	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	43.5	2.4e-18
WP_033676369.1|1272539_1274228_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	72.6	3.9e-249
WP_000522435.1|1274241_1275420_+|portal	phage portal protein	portal	A0A0A8WJ25	Clostridium_phage	61.6	5.5e-141
WP_000499523.1|1275514_1276708_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000361708.1|1277004_1277589_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2I7SBY1	Paenibacillus_phage	44.6	2.7e-32
WP_001031425.1|1277605_1278790_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	24.4	5.1e-09
WP_001016250.1|1278805_1279063_+	hypothetical protein	NA	A6XMJ7	Bacillus_virus	43.2	1.1e-06
WP_000600950.1|1279059_1279332_+	DNA-packaging protein	NA	R9TMB7	Paenibacillus_phage	53.9	3.0e-18
WP_000998123.1|1279328_1279628_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_001273706.1|1279620_1279977_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	60.7	3.0e-34
WP_000172080.1|1279973_1280303_+	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	83.5	2.9e-47
WP_001004921.1|1280303_1280897_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	93.3	6.7e-103
WP_000415929.1|1280903_1281266_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.0	6.8e-42
WP_015382231.1|1281496_1285129_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	84.1	2.4e-182
WP_000094123.1|1285170_1286640_+|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	79.6	2.8e-235
WP_015382232.1|1286636_1291481_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	83.4	0.0e+00
WP_001004976.1|1291496_1291871_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	98.4	2.7e-65
WP_000373898.1|1291908_1292334_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	100.0	2.6e-72
WP_000405773.1|1292333_1293266_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	84.2	3.3e-157
WP_000742862.1|1293431_1293998_-	hypothetical protein	NA	A6XML2	Bacillus_virus	45.7	5.9e-24
WP_001016122.1|1294137_1294356_+	hypothetical protein	NA	A0A2H4JC50	uncultured_Caudovirales_phage	90.3	3.6e-30
WP_000100788.1|1294380_1294671_+	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	90.7	9.3e-42
WP_000730207.1|1294688_1295522_-	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	81.9	2.6e-121
WP_000163133.1|1296000_1296960_+	ferrochelatase	NA	NA	NA	NA	NA
WP_001069180.1|1297019_1298486_+	catalase	NA	A0A2K9L572	Tupanvirus	47.4	1.0e-123
>prophage 5
NZ_CP015150	Bacillus thuringiensis strain Bc601, complete genome	5627121	1991739	1999890	5627121		Bacillus_phage(66.67%)	7	NA	NA
WP_000755525.1|1991739_1993020_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
WP_001194306.1|1993119_1993884_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453861.1|1994124_1995885_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	2.4e-273
WP_000612414.1|1995970_1996648_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.1e-122
WP_001231621.1|1996644_1997718_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	98.0	6.1e-187
WP_000818979.1|1998007_1998727_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_001258538.1|1999017_1999890_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.7	2.1e-65
>prophage 6
NZ_CP015150	Bacillus thuringiensis strain Bc601, complete genome	5627121	2003722	2058124	5627121	transposase,protease,integrase	Bacillus_phage(37.5%)	54	2005390:2005406	2024539:2024555
WP_000499523.1|2003722_2004916_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_001066899.1|2005319_2006615_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
2005390:2005406	attL	AAGAACATTATAAAAAA	NA	NA	NA	NA
WP_000276439.1|2006607_2007666_+	threonine synthase	NA	NA	NA	NA	NA
WP_000612105.1|2007662_2008556_+	homoserine kinase	NA	NA	NA	NA	NA
WP_001031481.1|2008687_2008897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000738151.1|2009104_2011408_+	glycoside hydrolase	NA	NA	NA	NA	NA
WP_002100920.1|2011728_2012730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001174860.1|2012895_2014143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000036070.1|2014155_2014845_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	1.4e-30
WP_000824531.1|2014841_2016200_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.3	3.7e-40
WP_000409482.1|2016301_2017123_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_000873565.1|2017137_2017794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119510.1|2017953_2018634_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	41.0	2.2e-17
WP_002100922.1|2018727_2019264_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_021728404.1|2019579_2019765_+|integrase	putative site-specific integrase/resolvase	integrase	NA	NA	NA	NA
WP_000710470.1|2019851_2021009_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q331V1	Clostridium_botulinum_C_phage	59.0	1.8e-123
WP_001163356.1|2021165_2022974_+	Petrobactin biosynthesis protein AsbA	NA	NA	NA	NA	NA
WP_000798699.1|2023700_2024453_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|2024442_2025738_-|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
2024539:2024555	attR	TTTTTTATAATGTTCTT	NA	NA	NA	NA
WP_000909581.1|2027048_2028287_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_001250558.1|2028283_2028550_+	petrobactin biosynthesis protein AsbD	NA	NA	NA	NA	NA
WP_000200704.1|2028573_2029557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877670.1|2029594_2030437_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_000113545.1|2030561_2030768_+	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	63.1	3.4e-14
WP_033667350.1|2031003_2032233_+	MFS transporter	NA	NA	NA	NA	NA
WP_001287305.1|2032286_2032901_-	amino acid transporter	NA	NA	NA	NA	NA
WP_000439399.1|2033019_2034462_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000816391.1|2034474_2034642_+	DUF3933 domain-containing protein	NA	NA	NA	NA	NA
WP_000686789.1|2034755_2035721_-	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	31.2	1.1e-25
WP_000540423.1|2035808_2035949_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_001034835.1|2036172_2036925_+	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_000520856.1|2037075_2038236_+	peptidase	NA	NA	NA	NA	NA
WP_001048102.1|2038341_2038539_+	DUF4083 domain-containing protein	NA	NA	NA	NA	NA
WP_000024999.1|2038570_2039032_+	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	35.1	8.5e-05
WP_000174901.1|2039081_2039900_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.3	1.7e-93
WP_001026002.1|2040175_2042056_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000648325.1|2042171_2042459_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	56.5	1.2e-12
WP_000099756.1|2042733_2043681_+|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	57.4	1.4e-94
WP_001259906.1|2043722_2044031_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000874082.1|2044137_2045073_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_001082497.1|2045120_2046296_+	MFS transporter	NA	NA	NA	NA	NA
WP_001101741.1|2046344_2046551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198794.1|2046694_2047057_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000162602.1|2047256_2047481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426317.1|2047565_2047913_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_001073075.1|2048818_2049871_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_000517294.1|2050071_2052054_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.0	3.5e-23
WP_000539571.1|2052250_2052556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000965059.1|2052878_2053244_+	DUF3979 domain-containing protein	NA	NA	NA	NA	NA
WP_000370203.1|2053278_2054319_-	membrane protein	NA	NA	NA	NA	NA
WP_000105199.1|2054559_2055003_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	62.1	6.2e-45
WP_000488206.1|2055105_2055561_+	DUF3939 domain-containing protein	NA	NA	NA	NA	NA
WP_000798320.1|2055776_2056721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087942833.1|2056781_2058124_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
>prophage 7
NZ_CP015150	Bacillus thuringiensis strain Bc601, complete genome	5627121	2088329	2156543	5627121	head,integrase,portal,transposase,bacteriocin,protease,terminase,coat,capsid,tail	Bacillus_phage(90.74%)	79	2108480:2108498	2156887:2156905
WP_000340535.1|2088329_2088788_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_001045960.1|2089013_2089193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861653.1|2089294_2089918_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000217338.1|2089942_2090425_-	DUF456 family protein	NA	NA	NA	NA	NA
WP_000353738.1|2090426_2091734_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000055257.1|2091942_2092812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001220524.1|2093068_2093716_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_087942842.1|2093775_2095121_-|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
WP_000839661.1|2095597_2096944_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_001263016.1|2097009_2097339_+	chaperone CsaA	NA	NA	NA	NA	NA
WP_000435828.1|2097319_2097886_+	DUF1572 domain-containing protein	NA	NA	NA	NA	NA
WP_016109792.1|2097858_2098164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000770738.1|2098168_2098465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079274.1|2098553_2099708_+	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_000617573.1|2099963_2100461_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000747647.1|2100472_2101213_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_000178288.1|2101236_2101683_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_000405394.1|2101865_2103341_+	amidase	NA	NA	NA	NA	NA
WP_001245226.1|2103390_2104608_-	MFS transporter	NA	NA	NA	NA	NA
WP_000741975.1|2104882_2105311_+	NfeD family protein	NA	NA	NA	NA	NA
WP_000226253.1|2105313_2106282_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_002004921.1|2106352_2107507_+	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_001166434.1|2107596_2108187_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
2108480:2108498	attL	ATGGTCACAGTGTTTCTTA	NA	NA	NA	NA
WP_000237493.1|2108518_2109610_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	79.8	8.1e-163
WP_000936291.1|2110349_2111570_+	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	49.5	2.2e-108
WP_000258007.1|2111969_2112314_-	helix-turn-helix domain-containing protein	NA	H0UST7	Bacillus_phage	40.6	1.2e-14
WP_000714354.1|2112489_2112696_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000549467.1|2112771_2112960_+	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	95.2	1.4e-25
WP_003284082.1|2112969_2113140_+	hypothetical protein	NA	I7J4K2	Bacillus_phage	94.1	2.8e-22
WP_015382272.1|2113185_2113929_+	phage regulatory protein	NA	A0A0S2GLP8	Bacillus_phage	76.4	2.9e-103
WP_000176230.1|2114090_2114399_+	hypothetical protein	NA	W8CYU1	Bacillus_phage	92.6	2.2e-41
WP_038415676.1|2114422_2115070_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	96.3	3.9e-112
WP_015382274.1|2115313_2116330_+	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	97.6	2.0e-187
WP_002133989.1|2116292_2117105_+	hypothetical protein	NA	A0A0S2GLK2	Bacillus_phage	100.0	1.2e-155
WP_000436951.1|2117146_2117413_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_000817807.1|2117484_2117649_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_001025406.1|2117666_2117882_+	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000705118.1|2117878_2118178_-	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_001098845.1|2118328_2118628_+	hypothetical protein	NA	A0A0S2GLL5	Bacillus_phage	100.0	2.7e-52
WP_000404184.1|2118981_2119389_+	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	100.0	4.9e-73
WP_000965619.1|2120797_2121079_+	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_000166155.1|2121436_2121922_+	ArpU family transcriptional regulator	NA	A0A0S2GLJ9	Bacillus_phage	99.4	1.8e-85
WP_000166155.1|2122931_2123417_+	ArpU family transcriptional regulator	NA	A0A0S2GLJ9	Bacillus_phage	99.4	1.8e-85
WP_001012176.1|2123413_2123956_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	100.0	3.3e-96
WP_015382276.1|2124162_2124408_+	hypothetical protein	NA	W8CYG8	Bacillus_phage	97.5	6.5e-36
WP_000017440.1|2124810_2125098_+	hypothetical protein	NA	H0USV6	Bacillus_phage	91.6	1.7e-43
WP_000464752.1|2125134_2125362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000443965.1|2125407_2125587_+	hypothetical protein	NA	W8CYF7	Bacillus_phage	98.3	6.0e-23
WP_000002725.1|2125621_2125861_+	hypothetical protein	NA	W8CZ42	Bacillus_phage	93.7	1.1e-16
WP_000773601.1|2125877_2126090_+	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	1.0e-29
WP_001139454.1|2126468_2126846_+	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	94.4	2.1e-65
WP_000233390.1|2126975_2127479_+|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	99.4	1.0e-88
WP_000621131.1|2127480_2129175_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	99.6	0.0e+00
WP_000577489.1|2129363_2130617_+|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	99.3	1.7e-241
WP_001259159.1|2130603_2131314_+|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	95.8	2.4e-123
WP_000361137.1|2131351_2132518_+|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	96.6	4.0e-208
WP_000244586.1|2132538_2132826_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	1.8e-45
WP_015382183.1|2132812_2133136_+|head	phage head closure protein	head	H0USW8	Bacillus_phage	98.1	7.4e-56
WP_015382184.1|2133128_2133563_+	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	99.3	2.3e-76
WP_015382185.1|2133559_2133919_+	DUF3168 domain-containing protein	NA	A0A2H4JAR3	uncultured_Caudovirales_phage	95.8	2.7e-59
WP_000896775.1|2133919_2134525_+|tail	tail protein	tail	A0A288WG55	Bacillus_phage	88.6	1.1e-95
WP_015382186.1|2134572_2134890_+	hypothetical protein	NA	W8CYN3	Bacillus_phage	98.1	1.3e-52
WP_001100112.1|2136264_2136444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169371.1|2136617_2137925_+	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	24.2	1.7e-10
WP_078405533.1|2138468_2138732_+	hypothetical protein	NA	I3WTY5	Bacillus_phage	88.7	5.3e-20
WP_038415467.1|2138746_2142595_+|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	88.8	0.0e+00
WP_038413466.1|2142606_2144091_+|tail	phage tail protein	tail	A0A0S2GLF9	Bacillus_phage	99.4	1.9e-295
WP_038413468.1|2144087_2148113_+	phage minor structural protein	NA	A0A0S2GLH1	Bacillus_phage	89.9	0.0e+00
WP_000822831.1|2148214_2149174_+|integrase	site-specific integrase	integrase	A0A0U3B271	Bacillus_phage	94.4	1.2e-173
WP_000499524.1|2149308_2150502_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	1.2e-23
WP_000389067.1|2150797_2151028_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	93.4	5.3e-32
WP_000751888.1|2151024_2152089_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	93.8	5.4e-196
WP_000669561.1|2152158_2152962_-	hypothetical protein	NA	A6M971	Geobacillus_virus	41.3	5.4e-23
WP_000941958.1|2152961_2153168_-	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	41.5	4.1e-07
WP_001257568.1|2153356_2153671_+	hypothetical protein	NA	H0USY0	Bacillus_phage	96.2	7.7e-50
WP_000170790.1|2153667_2153850_+	hypothetical protein	NA	A0A288WGN6	Bacillus_phage	90.0	1.1e-21
WP_000891545.1|2153965_2155147_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	93.4	1.9e-213
WP_000551102.1|2155088_2155709_+	hypothetical protein	NA	H0USY2	Bacillus_phage	96.1	8.3e-112
WP_000730123.1|2155718_2156543_-	helix-turn-helix domain-containing protein	NA	A0A2H4J969	uncultured_Caudovirales_phage	66.9	2.1e-99
2156887:2156905	attR	ATGGTCACAGTGTTTCTTA	NA	NA	NA	NA
>prophage 8
NZ_CP015150	Bacillus thuringiensis strain Bc601, complete genome	5627121	2206082	2262630	5627121	transposase,integrase	Bacillus_phage(33.33%)	53	2227331:2227347	2265069:2265085
WP_001236344.1|2206082_2207312_+|transposase	IS110-like element ISBth166 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	1.7e-84
WP_000675562.1|2207651_2208230_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_001174543.1|2208965_2209400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000754973.1|2209486_2210458_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_001236345.1|2210813_2212043_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
WP_000844984.1|2212272_2212482_-	DUF3925 domain-containing protein	NA	NA	NA	NA	NA
WP_000219434.1|2212705_2213188_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	40.6	3.5e-25
WP_002134082.1|2213271_2215500_-	DUF4129 domain-containing protein	NA	NA	NA	NA	NA
WP_000827540.1|2215496_2216711_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_001135816.1|2216710_2217673_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001236345.1|2218312_2219542_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
WP_000730783.1|2219897_2223581_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_000692704.1|2223570_2225046_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	47.3	1.2e-20
WP_001249921.1|2225065_2225596_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000969223.1|2225613_2226303_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000013866.1|2226439_2227132_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
2227331:2227347	attL	TGTAGCTTCTTTTTTAT	NA	NA	NA	NA
WP_000545028.1|2227409_2228423_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001158130.1|2228440_2229454_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000884821.1|2229497_2230787_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000616827.1|2230831_2231254_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_000573683.1|2231250_2231484_+	molybdopterin converting factor subunit 1	NA	NA	NA	NA	NA
WP_000841857.1|2231564_2232734_+	nitrate transporter NarK	NA	NA	NA	NA	NA
WP_000043362.1|2233046_2233424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000282595.1|2233614_2234088_-	precorrin-2 dehydrogenase	NA	NA	NA	NA	NA
WP_000676479.1|2234080_2234791_-	sirohydrochlorin chelatase	NA	NA	NA	NA	NA
WP_001014978.1|2234787_2236212_-	uroporphyrin-III C-methyltransferase	NA	NA	NA	NA	NA
WP_000616694.1|2236270_2236588_-	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_000746917.1|2236603_2239009_-	NADPH-nitrite reductase large subunit	NA	NA	NA	NA	NA
WP_000401358.1|2239217_2239925_-	iron-sulfur cluster repair di-iron protein	NA	NA	NA	NA	NA
WP_000025813.1|2240127_2240946_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_000395679.1|2241154_2241307_+	exosporium protein ExsG	NA	NA	NA	NA	NA
WP_000824207.1|2241523_2241733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988430.1|2241829_2242669_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001238710.1|2243200_2244802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536153.1|2244954_2245503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427801.1|2246113_2246389_+	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	41.2	2.9e-08
WP_000071989.1|2246609_2246849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000283853.1|2247016_2247472_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_003284113.1|2247733_2248042_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_000794364.1|2248338_2249127_+	hypothetical protein	NA	A0A288WG17	Bacillus_phage	51.4	2.8e-64
WP_000027993.1|2249215_2249989_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000349585.1|2250029_2250821_+	glyoxalase	NA	A0A288WG17	Bacillus_phage	68.4	6.8e-103
WP_000247457.1|2250889_2251294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001028065.1|2251286_2253296_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000477499.1|2253292_2254390_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3M2X0	Bacillus_phage	23.4	2.1e-09
WP_000109863.1|2254770_2255844_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	43.7	1.8e-74
WP_000709202.1|2255840_2255966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499723.1|2256262_2257027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000165969.1|2257136_2257784_+	HD domain-containing protein	NA	S4W232	Pandoravirus	28.3	9.5e-10
WP_000783186.1|2257780_2259676_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	25.5	2.2e-46
WP_001260655.1|2259751_2260483_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000975140.1|2260588_2260843_+	DUF4318 domain-containing protein	NA	NA	NA	NA	NA
WP_000116992.1|2261199_2262630_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
2265069:2265085	attR	ATAAAAAAGAAGCTACA	NA	NA	NA	NA
>prophage 9
NZ_CP015150	Bacillus thuringiensis strain Bc601, complete genome	5627121	4615339	4623025	5627121		Bacillus_phage(33.33%)	9	NA	NA
WP_000221066.1|4615339_4616263_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
WP_000609140.1|4616388_4617324_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	9.2e-22
WP_000018029.1|4617325_4618018_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	3.7e-36
WP_001014310.1|4618360_4618555_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255971.1|4618593_4619793_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	1.6e-71
WP_000587826.1|4620088_4620412_+	heme oxygenase	NA	NA	NA	NA	NA
WP_001086121.1|4620484_4621249_-	class B sortase	NA	NA	NA	NA	NA
WP_000403760.1|4621281_4622052_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	7.6e-14
WP_001036847.1|4622041_4623025_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.5e-17
>prophage 10
NZ_CP015150	Bacillus thuringiensis strain Bc601, complete genome	5627121	4972868	5065085	5627121	holin,head,integrase,portal,transposase,tRNA,protease,terminase,coat,capsid,tail	Bacillus_phage(77.59%)	96	4967395:4967414	5052481:5052500
4967395:4967414	attL	TTTTGTCGGTAAATCGATAT	NA	NA	NA	NA
WP_000287147.1|4972868_4974245_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.9	5.8e-49
WP_087942833.1|4974358_4975700_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
WP_001140612.1|4975755_4976139_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_000810336.1|4976234_4976978_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_001252163.1|4977028_4977622_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002097988.1|4977667_4978555_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	7.0e-80
WP_001104221.1|4978662_4980387_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.5	1.6e-176
WP_000545253.1|4980530_4981136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000487942.1|4981310_4982795_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.9	8.7e-59
WP_000920098.1|4982954_4983581_-	hypothetical protein	NA	A0A0H3UZG2	Geobacillus_virus	42.1	6.1e-14
WP_000027016.1|4983667_4983985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000415321.1|4983981_4984488_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000856612.1|4984611_4985820_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000829788.1|4986281_4987271_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	3.0e-31
WP_000815771.1|4987383_4997355_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_000902159.1|4997825_4998305_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391942.1|4998470_4999718_+	MFS transporter	NA	NA	NA	NA	NA
WP_000535259.1|4999735_5000617_-	decarboxylase	NA	NA	NA	NA	NA
WP_000635484.1|5000696_5001158_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_000710530.1|5001480_5002308_+	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.5	1.8e-101
WP_000551103.1|5002317_5002938_-	hypothetical protein	NA	H0USY2	Bacillus_phage	93.2	6.5e-109
WP_000891535.1|5002879_5004061_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	94.4	9.0e-216
WP_000170777.1|5004176_5004359_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.4e-22
WP_001257569.1|5004355_5004673_-	hypothetical protein	NA	H0USY0	Bacillus_phage	98.1	6.4e-52
WP_000649833.1|5004855_5005053_+	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	76.2	3.4e-19
WP_001137905.1|5005061_5005241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000043398.1|5005246_5005825_+	hypothetical protein	NA	H0USX9	Bacillus_phage	88.5	2.2e-95
WP_000119484.1|5005878_5006217_+	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	92.9	4.6e-48
WP_000405777.1|5008193_5008895_-	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	89.8	6.4e-121
WP_000373903.1|5008894_5009320_-|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	97.2	7.0e-70
WP_001260185.1|5009744_5013770_-	hypothetical protein	NA	H0USX5	Bacillus_phage	93.6	0.0e+00
WP_000517105.1|5013766_5015248_-|tail	phage tail protein	tail	W8CYY9	Bacillus_phage	99.6	5.4e-295
WP_015382488.1|5015262_5019186_-|tail	phage tail tape measure protein	tail	I3WTY6	Bacillus_phage	99.3	0.0e+00
WP_000344049.1|5019200_5019377_-	hypothetical protein	NA	W8CYG0	Bacillus_phage	100.0	6.7e-27
WP_015382489.1|5019406_5019724_-	hypothetical protein	NA	W8CYN3	Bacillus_phage	97.1	4.9e-52
WP_000896769.1|5019770_5020379_-|tail	tail protein	tail	W8CYT6	Bacillus_phage	94.1	1.3e-98
WP_000609194.1|5020379_5020739_-	DUF3168 domain-containing protein	NA	H0USX0	Bacillus_phage	96.6	2.5e-60
WP_000763219.1|5020735_5021170_-	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	100.0	1.8e-76
WP_015382490.1|5021162_5021486_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	99.1	3.3e-56
WP_000244586.1|5021472_5021760_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	1.8e-45
WP_000361137.1|5021780_5022947_-|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	96.6	4.0e-208
WP_001259159.1|5022984_5023695_-|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	95.8	2.4e-123
WP_000577489.1|5023681_5024935_-|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	99.3	1.7e-241
WP_000621131.1|5025123_5026818_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	99.6	0.0e+00
WP_000233390.1|5026819_5027323_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	99.4	1.0e-88
WP_001139454.1|5027452_5027830_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	94.4	2.1e-65
WP_000773601.1|5028208_5028421_-	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	1.0e-29
WP_000002725.1|5028436_5028676_-	hypothetical protein	NA	W8CZ42	Bacillus_phage	93.7	1.1e-16
WP_000443965.1|5028710_5028890_-	hypothetical protein	NA	W8CYF7	Bacillus_phage	98.3	6.0e-23
WP_000464752.1|5028935_5029163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000017440.1|5029199_5029487_-	hypothetical protein	NA	H0USV6	Bacillus_phage	91.6	1.7e-43
WP_000404184.1|5031713_5032121_-	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	100.0	4.9e-73
WP_038413787.1|5032474_5032774_-	hypothetical protein	NA	A0A0S2GLL5	Bacillus_phage	99.0	1.8e-51
WP_000705118.1|5032924_5033224_+	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_001025406.1|5033220_5033436_-	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000817807.1|5033453_5033618_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_000436951.1|5033689_5033956_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_002133989.1|5033997_5034810_-	hypothetical protein	NA	A0A0S2GLK2	Bacillus_phage	100.0	1.2e-155
WP_015382176.1|5034772_5035789_-	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	100.0	2.8e-189
WP_000123128.1|5036012_5036660_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	100.0	1.8e-117
WP_000218620.1|5036934_5037249_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	100.0	1.1e-51
WP_000960416.1|5037410_5038127_-	hypothetical protein	NA	Q3HL19	Bacillus_phage	78.2	6.4e-100
WP_000277643.1|5038444_5038633_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	2.6e-21
WP_000368216.1|5038777_5039023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000005253.1|5039270_5039600_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	97.2	5.6e-51
WP_001164934.1|5040002_5041133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000896931.1|5041300_5041531_-	hypothetical protein	NA	H0UST5	Bacillus_phage	90.8	8.5e-30
WP_000237487.1|5042493_5043555_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.9	3.5e-171
WP_000833145.1|5043643_5043997_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	39.7	4.5e-14
WP_000834606.1|5044620_5045385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087942842.1|5045810_5047155_+|transposase	IS3-like element ISBth10 family transposase	transposase	A0A1B1P773	Bacillus_phage	74.4	3.6e-112
WP_000573825.1|5047237_5047591_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.3	3.7e-16
WP_000077397.1|5047632_5048499_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000595026.1|5048767_5049007_-	YuzB family protein	NA	NA	NA	NA	NA
WP_000682077.1|5049353_5050424_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001054089.1|5050657_5050831_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_000470265.1|5050886_5051546_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.7	1.3e-22
WP_000679246.1|5051529_5052327_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000212737.1|5052547_5052889_-	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
5052481:5052500	attR	ATATCGATTTACCGACAAAA	NA	NA	NA	NA
WP_000622258.1|5053048_5053330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003285671.1|5053399_5054197_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000607080.1|5054485_5054869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000383681.1|5054905_5055160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000843107.1|5055249_5055720_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_002101500.1|5055706_5056345_+	DUF4304 domain-containing protein	NA	NA	NA	NA	NA
WP_000049707.1|5056395_5057064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002101505.1|5057186_5057981_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_000248588.1|5058033_5058342_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|5058537_5058774_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_001125494.1|5058968_5059184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000614218.1|5059245_5060247_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000665094.1|5060367_5060859_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_000351148.1|5060882_5061410_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001106091.1|5061572_5062676_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000856300.1|5062620_5063967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000241505.1|5063972_5065085_+|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
>prophage 11
NZ_CP015150	Bacillus thuringiensis strain Bc601, complete genome	5627121	5169411	5256587	5627121	holin,head,integrase,portal,transposase,tRNA,protease,terminase,capsid,tail	Bacillus_phage(47.46%)	98	5214182:5214202	5256722:5256742
WP_001021098.1|5169411_5170671_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.4	9.0e-89
WP_001057102.1|5171040_5171958_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_000573649.1|5172340_5172736_-	SET domain-containing protein	NA	NA	NA	NA	NA
WP_000455078.1|5172944_5174447_-	DUF4077 domain-containing protein	NA	NA	NA	NA	NA
WP_000714051.1|5174479_5175538_-	endonuclease	NA	NA	NA	NA	NA
WP_001986875.1|5175854_5176289_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000568580.1|5176285_5176642_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000980954.1|5176670_5176910_-	DUF3947 family protein	NA	NA	NA	NA	NA
WP_000792610.1|5176976_5177189_-	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_001293750.1|5177369_5178563_-	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	32.6	2.0e-42
WP_000054869.1|5178568_5180116_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.2	6.7e-54
WP_001071092.1|5180553_5181069_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000834708.1|5181211_5181616_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000635745.1|5181665_5182628_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_001036620.1|5183089_5184055_+	DUF4822 domain-containing protein	NA	NA	NA	NA	NA
WP_000576729.1|5184261_5185800_-	anthrolysin O/cereolysin O family cholesterol-dependent cytolysin	NA	NA	NA	NA	NA
WP_000590071.1|5186248_5187001_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000631245.1|5186997_5188062_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000042063.1|5188058_5189075_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	37.1	6.0e-59
WP_000749436.1|5189094_5190111_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000815809.1|5190438_5191116_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002101540.1|5192366_5192687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000169371.1|5193430_5194738_-	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	24.2	1.7e-10
WP_001100112.1|5194911_5195091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000915084.1|5196644_5197577_+|holin	choline-binding protein A	holin	NA	NA	NA	NA
WP_001123919.1|5198384_5198852_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.2	5.4e-47
WP_000391097.1|5198978_5201417_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.6	1.7e-91
WP_000976870.1|5201559_5202303_-	carboxylesterase	NA	NA	NA	NA	NA
WP_000557264.1|5202461_5202695_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000078304.1|5202789_5203482_-	LrgB family protein	NA	NA	NA	NA	NA
WP_000673222.1|5203478_5203847_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_001125064.1|5204199_5205150_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_000103951.1|5205201_5206497_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	75.4	1.1e-182
WP_001231158.1|5206527_5208057_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001231038.1|5208053_5208809_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001036350.1|5208841_5210026_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000161236.1|5210165_5211170_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001258185.1|5211196_5212225_-	gapA transcriptional regulator CggR	NA	NA	NA	NA	NA
WP_000869730.1|5212360_5212606_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_000647955.1|5212615_5213923_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
5214182:5214202	attL	CGCGCCCAGAGGGATTCGAAC	NA	NA	NA	NA
WP_000412580.1|5214485_5215313_+	hypothetical protein	NA	A0A1C8EA76	Bacillus_phage	90.9	7.6e-137
WP_001273481.1|5215328_5215622_-	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	87.6	2.7e-41
WP_001016121.1|5215646_5215865_-	hypothetical protein	NA	A0A2H4JC50	uncultured_Caudovirales_phage	93.1	7.3e-31
WP_000742864.1|5216008_5216575_+	hypothetical protein	NA	A6XML2	Bacillus_virus	45.7	4.8e-26
WP_000734384.1|5216753_5216972_-	hypothetical protein	NA	A0A2H4JBB8	uncultured_Caudovirales_phage	73.8	1.7e-16
WP_000993515.1|5216971_5218087_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	54.9	4.0e-109
WP_000405783.1|5218290_5219226_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	82.3	1.8e-155
WP_000499524.1|5219523_5220717_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	1.2e-23
WP_042991251.1|5220778_5221222_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	97.8	1.8e-68
WP_000499524.1|5221516_5222710_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.1	1.2e-23
WP_016090170.1|5222830_5223202_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	58.4	2.2e-35
WP_015382502.1|5223218_5227601_-	phage minor structural protein	NA	A0A0S2MVB4	Bacillus_phage	58.4	0.0e+00
WP_015382503.1|5227597_5229067_-	hypothetical protein	NA	A0A0S2MV63	Bacillus_phage	80.2	2.6e-236
WP_002133928.1|5229108_5231490_-	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	44.1	3.7e-43
WP_000897021.1|5231767_5233003_-	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	73.1	3.6e-151
WP_000415931.1|5233233_5233596_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	71.7	1.4e-42
WP_001004920.1|5233602_5234196_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	91.8	3.7e-101
WP_000219080.1|5234196_5234532_-	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	94.5	3.2e-54
WP_000997537.1|5234528_5234873_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	80.5	1.7e-45
WP_001247297.1|5234874_5235225_-|head	phage head closure protein	head	D2XR20	Bacillus_phage	87.9	3.7e-53
WP_000361981.1|5235226_5235520_-	hypothetical protein	NA	A0A2H4JG04	uncultured_Caudovirales_phage	76.3	2.7e-36
WP_000245092.1|5235532_5236699_-|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	77.7	9.6e-162
WP_000791073.1|5236725_5237451_-|protease	Clp protease ClpP	protease	A0A2H4J8Y7	uncultured_Caudovirales_phage	53.2	1.7e-44
WP_000118683.1|5237440_5238592_-|portal	phage portal protein	portal	A8AT96	Listeria_phage	51.1	1.8e-104
WP_000595321.1|5238612_5240298_-|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	85.7	5.5e-275
WP_000301150.1|5240294_5240606_-|terminase	terminase	terminase	D2XR14	Bacillus_phage	86.3	4.7e-39
WP_000666398.1|5240730_5241066_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.0	1.6e-53
WP_001177571.1|5241031_5241406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000378699.1|5241396_5241654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001177575.1|5241660_5241870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002014.1|5241938_5242373_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	61.5	9.8e-19
WP_000343502.1|5242378_5242582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000650576.1|5242595_5242820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071686389.1|5242999_5243182_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	64.9	3.9e-14
WP_000711194.1|5243233_5243653_+	HicB family protein	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	79.9	4.5e-61
WP_003308641.1|5244036_5244438_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	99.2	1.1e-67
WP_015670520.1|5244475_5244802_-	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	98.1	4.7e-58
WP_000540086.1|5244798_5245326_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	97.7	4.1e-96
WP_000590881.1|5245361_5245673_-	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	84.5	1.0e-41
WP_000858114.1|5245717_5246413_-	hypothetical protein	NA	A0A1I9S6E4	Bacillus_phage	81.5	3.2e-112
WP_000520932.1|5246448_5246703_-	hypothetical protein	NA	I7ILU4	Staphylococcus_phage	100.0	1.2e-40
WP_001268031.1|5247725_5248016_-	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	93.8	2.5e-50
WP_000775809.1|5248074_5248509_-	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	89.6	2.2e-71
WP_001245738.1|5248547_5249105_-	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	70.8	2.0e-64
WP_000139235.1|5249128_5249359_-	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	100.0	2.5e-34
WP_000933908.1|5249351_5249831_-	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	97.5	4.3e-84
WP_000510889.1|5249842_5250796_-	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	90.2	8.4e-148
WP_002133909.1|5250889_5251231_-	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	97.3	9.9e-51
WP_000355713.1|5251160_5251376_-	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	98.6	1.1e-31
WP_015382506.1|5251375_5252089_-	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	98.3	1.4e-126
WP_000453495.1|5252106_5252550_-	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	90.5	9.8e-67
WP_001187283.1|5252576_5252765_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	62.9	2.6e-13
WP_001016247.1|5252776_5253532_-	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	83.4	1.9e-110
WP_000711864.1|5253885_5254119_-	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	43.5	5.6e-05
WP_000216290.1|5254154_5254385_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002133807.1|5254549_5254942_+	helix-turn-helix transcriptional regulator	NA	A0A1Q1PVX8	Staphylococcus_phage	58.5	3.2e-13
WP_001037137.1|5254952_5255420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000135757.1|5255450_5256587_+|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	48.0	6.8e-96
5256722:5256742	attR	CGCGCCCAGAGGGATTCGAAC	NA	NA	NA	NA
>prophage 1
NZ_CP015152	Bacillus thuringiensis strain Bc601 plasmid pBTBC2, complete sequence	171171	22983	67405	171171	transposase,integrase	Bacillus_phage(50.0%)	42	48425:48484	67473:69127
WP_000538375.1|22983_25947_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	4.1e-201
WP_000382147.1|25965_26820_-	TnP I resolvase	NA	S5M9V8	Brevibacillus_phage	26.4	4.4e-23
WP_081247213.1|26889_27174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000844156.1|27310_27559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103226.1|27903_28998_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	48.8	1.5e-92
WP_016090373.1|29503_30337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065268.1|30513_30738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997955.1|31025_31775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001236345.1|32505_33735_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
WP_000790837.1|34090_34483_+	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
WP_000128275.1|34556_34775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000532004.1|34797_36102_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_001053969.1|36267_37704_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000121085.1|38976_39489_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000149389.1|39510_39861_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_001021539.1|40092_41136_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.1	1.2e-09
WP_000019020.1|41349_41676_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV8	Bacillus_phage	51.0	2.4e-22
WP_001001083.1|42157_43381_-	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	66.1	6.1e-151
WP_016090374.1|43587_45231_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000843046.1|45932_46211_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	2.3e-13
WP_014481865.1|46277_46418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031303430.1|46692_46887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043935.1|47133_47406_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	68.9	3.3e-25
WP_000914524.1|47895_48411_-	hypothetical protein	NA	NA	NA	NA	NA
48425:48484	attL	CATGCCCATCAACTTAAGGATAGAAACTCTACGGTTTTCCATTAATTGAAATGAACAAAC	NA	NA	NA	NA
WP_001053969.1|48551_49988_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000272577.1|50760_52026_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.7	4.2e-102
WP_000477499.1|52206_53304_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	30.3	6.5e-11
WP_001028065.1|53300_55310_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000247457.1|55302_55707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000349585.1|55775_56567_-	glyoxalase	NA	A0A288WG17	Bacillus_phage	68.4	6.8e-103
WP_000027993.1|56607_57381_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000794364.1|57469_58258_-	hypothetical protein	NA	A0A288WG17	Bacillus_phage	51.4	2.8e-64
WP_000238290.1|58554_58863_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_001154608.1|58911_59286_+	hypothetical protein	NA	D2XQ01	Bacillus_virus	52.5	4.8e-30
WP_000417392.1|59504_59756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000898260.1|59808_60048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000955500.1|60590_61121_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000650425.1|61124_62099_+	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_016090335.1|62527_63457_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000020440.1|63471_64059_-	flavodoxin family protein	NA	NA	NA	NA	NA
WP_000351941.1|64181_65081_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001053969.1|65968_67405_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
67473:69127	attR	GTTTGTTCATTTCAATTAATGGAAAACCGTAGAGTTTCTATCCTTAAGTTGATGGGCATGTGATACTACCCCTACTACTATTTTTTGAGGCAAGTTTATGAGTTAATAAAAGATTTATGGCAATGTAATGCTTCAAATATTACAAGGATGTTCTCTAAAAACTATGCTTTCGGGCAATATTATGGTTCAAATTGTGGCGGACTTATAATTCAAATCACAAAATAAATCGGATGCTAGAAGACCAAAATAAAGTTAATAGACCAATACTCACTGATGATACAAAAGAAAGAATCCAACGCTCTTTACAGCAATCCTTAGAATACAATGAAGAGGTATTCCTCTCTTACTACAGAAAGGGATATTTACATCACCAATACATAACAGTGACTTCTATAGATCCAGGAAACAAATTGATTCATTGTCTTGATGCTTTTAATACACATACACAATTAAAATTTGATGAATTAATTGATATTAAATAAAAAGAATGCATACACAATCGTACAATTTATTAAGAAGACTCCATTCTGAAAAAATTTAATCAAAATGGAGTCTTTTGTTAGAAATATTCATTTGTTTTTTTAAAATACTGAAAATAATTAATGCAAAATAGTTATTTAAAAGAGTTAAACCCCTAACGGTACGTTAAGAGGCTGTGATTAACAAACTCTTACTAAAAATACATGAGATTGATGAAGAAATATGATAATTGATCCCTCGCATTATAGCACTAAATTAATTTAAATTTCAACTTGATAAATTTTCGTGTGCATTCAATTTATTAAAATACGTATTATCCGTTCAAACGATACTAAAAATTTAAAATGGTATAAGCATATTTATAGACCTGTCTTTTATTGTTCATATAAAATAAAAAAGTACGAAATACCCTATTTTGTATGTGATCCTGCAAGGTAACTTGTGGGATTTTTTATTGTCATTAAATCGGAGGGATTATATGGGATACTTTAATGTTGAATTAATGAAAGCTGAAATTACTCAAGAAGAAGCTATATATAGTTACAAATTATATACAAAGGATAGCTGACAATAAGGCAGATAAATTATATGCTGCCGAAGTAATTGAGAGAGTTCATAATGAGGATAGCTCAACGAAAGATATTGATTTTATTATACGTTGTCGTAAAATGCTATAAAACAAAAAGGAACTCTGCAATATTAAAGAGTTCCTTTTTTATATTGTATTGAAAAAATTTTATGTTTCTTAAAAATGCTCTTAGAATTTCAGGATAAAGTGAGTAAAATGCATATGTAGAAAGGAGGTTTTACAATATGCAAAATCAAACAAAAACTTTTCATTTGAAAATAAAATTTTTCGGATTCAAAATAAGTATTAATTATTCCTTTTAAAAGAATCTAGCCTGTTTTTATTTGAGTACTAAAAGGTAGGATATCTCTTATTCCTATCTTTTAGTTTAACACCATTATTTTCATGAATTTTTAGACTGTAACAATTTTATTAGATCCTAAAATCTCTAAACTTTTCTCTAAAACTTTCTCATTATCAATGATAATAACATGCAATTTTTTTCTAGCTCTTGTCATCATTTGATAGAGCATTTTTGTATTATCATAATAGTAATCTTTTTTACTTGTTAGTAAATTTTTATTGTAAAAAAAGTTAGAATCTATCA	NA	NA	NA	NA
>prophage 1
NZ_CP015154	Bacillus thuringiensis strain Bc601 plasmid pBTBC4, complete sequence	82417	10020	49360	82417	integrase,transposase,protease	Bacillus_phage(33.33%)	39	26847:26884	36208:36245
WP_016097323.1|10020_10467_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_016097325.1|10856_11855_-|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	35.1	3.1e-36
WP_016097326.1|11826_12444_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	32.0	2.7e-14
WP_016097327.1|13104_13689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016097328.1|13765_14011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_090782881.1|14106_15266_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	41.6	1.5e-37
WP_016097331.1|15417_15792_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	51.3	1.5e-28
WP_016097332.1|16251_16887_+	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	28.4	8.7e-08
WP_016097333.1|17029_18145_+	transcriptional regulator	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	52.2	1.2e-92
WP_016097335.1|18989_20630_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016097336.1|20696_21422_+	hypothetical protein	NA	A0A0A7AR45	Bacillus_phage	54.9	7.8e-61
WP_016097337.1|21579_21909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016097338.1|21924_22158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016097339.1|22282_22606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016097340.1|22568_23495_-	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	35.4	1.1e-30
WP_016097341.1|24365_25907_+	replication initiation protein RepS	NA	NA	NA	NA	NA
WP_016097342.1|26109_26883_+	hypothetical protein	NA	NA	NA	NA	NA
26847:26884	attL	GGGGTACCGCCAGCATTTCGGAAAAAAACCACGCTAAG	NA	NA	NA	NA
WP_000538375.1|26912_29876_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	4.1e-201
WP_044157348.1|29894_30731_-|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	27.0	3.7e-22
WP_002133690.1|31066_31318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224533.1|31964_32588_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.7	4.4e-12
WP_001025593.1|32838_35910_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	22.3	4.3e-44
WP_016097515.1|36562_37825_+	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	53.8	2.0e-112
36208:36245	attR	CTTAGCGTGGTTTTTTTCCGAAATGCTGGCGGTACCCC	NA	NA	NA	NA
WP_016097513.1|38829_39132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097512.1|39616_40141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021729740.1|40130_40319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097511.1|40415_40907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097509.1|41287_41530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097508.1|41676_42528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097507.1|42783_43338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097505.1|43555_43783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097504.1|43799_44453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097503.1|44641_45043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097502.1|45052_45439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097500.1|45671_46121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097499.1|46122_46392_+	hypothetical protein	NA	G9J2B7	Bacillus_phage	54.0	2.0e-14
WP_016097498.1|46407_46629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016097497.1|46717_47911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236345.1|48130_49360_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
>prophage 1
NZ_CP015156	Bacillus thuringiensis strain Bc601 plasmid pBTBC6, complete sequence	89350	41699	77658	89350	integrase,transposase	Brevibacillus_phage(30.0%)	32	48284:48343	77665:80712
WP_000432938.1|41699_42626_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	34.2	2.2e-36
WP_012008596.1|43178_45833_+	type IA DNA topoisomerase	NA	NA	NA	NA	NA
WP_000946495.1|45880_46255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016099920.1|46269_46743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053969.1|46720_48157_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
48284:48343	attL	GGGGTACCGCCAGCATTTCGGAAAAAAACCACGCTAAGGATTTTTTCTATAAAAAGAGCC	NA	NA	NA	NA
WP_000538375.1|48349_51313_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	4.1e-201
WP_000382147.1|51331_52186_-	TnP I resolvase	NA	S5M9V8	Brevibacillus_phage	26.4	4.4e-23
WP_001053969.1|52522_53959_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000287770.1|54665_55778_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	47.8	3.4e-92
WP_000751784.1|55774_55909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000651963.1|56583_56769_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001004369.1|57002_57335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012008598.1|57378_57648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012008599.1|57714_58329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012008600.1|58375_58750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012008601.1|58832_59204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040120061.1|59364_59688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012008603.1|59746_60040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876891.1|60999_61551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000217377.1|61632_61947_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003272553.1|62138_62405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012008604.1|62432_62615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012008605.1|62761_63406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012008606.1|63517_64216_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012008607.1|64992_66525_+	replication protein ori43	NA	NA	NA	NA	NA
WP_016097345.1|66957_68115_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	65.8	2.9e-142
WP_000190466.1|68134_68551_+	hypothetical protein	NA	A0A2H4J4V0	uncultured_Caudovirales_phage	44.9	5.9e-29
WP_001025593.1|68660_71732_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	22.3	4.3e-44
WP_001224533.1|71982_72606_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.7	4.4e-12
WP_002133690.1|73252_73504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044157348.1|73839_74676_+|integrase	tyrosine-type recombinase/integrase	integrase	S5M9V8	Brevibacillus_phage	27.0	3.7e-22
WP_000538375.1|74694_77658_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	4.1e-201
77665:80712	attR	GGCTCTTTTTATAGAAAAAATCCTTAGCGTGGTTTTTTTCCGAAATGCTGGCGGTACCCCTTTCTTAAACTTCTGTTCCCAACATACAAATAGGCTTTTGTCTCATAAGGCTCATGTTTAAAATACGAGTAACTACCCTTAAAAATCGTTAGTTGGCGCTTCTCAGTCTGCAACAACACCCAATACTTACTTTCATCCAACACAACACCTGATACATTCTTACCACTAGGAAAATAAACCGTAATAGTATCCTCTACAGAAAATACATACTCCGTAGGCTTTTTATAATCAGCTAGTTTCATTTCCTTCGTATAGAAATCATTTGTCATAAGTAATGGATCATGCTTCACATGTGTAACATAAGATAAAGCACCCTTCATGATTGTATAGTAATTCTCTTTTTCAGTTTTAACATAAAGATAATAGGCATCTTCAGACAATAAAGTCCCTTTGATCCCCTTACCATCTTTAAATACACAACCTATCAGTTCACCAATCTCAAATACAAAGGATGTTTTCTTCTTCCCCTCGCTAAACTTAGGAGATCTTTCTTCAACAGTTGGAAACTCTTCATGCCTTATATATTTAACTTCAGAGAAATTAACTGTTACTTGATACAGAGCACCGTTCCCCTCCACATCAAGAACACAATAATACTCTTCTATTGTTGAAATTTTACCTTTTAACAAATCATCATGATTTAGTAGCTTTATATCTACAGTAGCCCCCCTCATAAATACAAAAGAGTGTCTGTAACGCCCTCTACTATCACGATCTATAGGATAATTTTTACCCAAAGTAAGCACCACCAATATTATAATTTTCTAGTAAACCTCTATAAATTTCACATACCATAATGAGTAGTTAACCCTAGTAGTATAAGACTAATCTCCAAGAATAAAAGAAACATAAACTATGTAAGGCCATAACGCTATAGCTAGCTGACCGAACCGTGTATCGTAGATATAATTATGTATTGGCAGAGTGGACAATTAAAAATTAACCGGCTGGTAGCCCTTCTAATATGCCGTATAGTGTTTCTTCTTCCGCCATAGCGTTACTTGTTTTTGCTTGTCCAAGAACATTACCCATTTGAGGGAATAGCCCTTGTAAATAGTTTAAATAGCTCTCTCTTCTTTTTCCGTTTTCCTTTAAAGCAAATGCAATTAGCATTCCTTGTGTAGATAGTCCTGTTTTTGCTGTTTTGCCTTTTCCCTCAACCGTTTTATAGATTTTTGTACTCCTTTTTAGAACCGTGTTTAATGTACTACGTGGAATGTTAAGCGCTTCGCACAGTTCTGATTGTGTAAAGTATAGCACAGGTTTATTATTTGAATTCATCGATAAGAAAGTAATAATGTCAGCTTCCCACTCGTGCCAATGACTACGCACACGATCCTTACGTTGTTTCTTATGTTTCTTCCAAAGTACAGAAGGCGCACGGAAAGCTGAAGCCTGTCCACCCACCCCATATGTTTGTAATAAACGCTCTATGTAATCTTTATGTGCTGCCTGATACTTTCCAGAGTACGCAGACATAACAATTCCTCTAACTTCAGTATGATCTAGCGGTTGCTCTAGGTTACTATTAAACTGATCCATTAAGTCCATTGTGTCTTTAATAACGTACTGACTTTGGAAACACGCTAAAGAAAGGGTGAAAATCGCATTGTTTCGCCCTGCTTTCGTTTGTTTTGGAGATACATTTGTACAACTAATCACCTGTTTGAACCATAGTTCATCCATTTGTTTTGGTTGCTCTACAGGAGCGTTTTTAGCAAAAGGACTCTCTATCACATTATGAAACTGTTCATTTCCCTTGTTGTCGTCTTGTCGCTTGCTCCACTCTTGTAACTCCTTGAATGTATACGGGGTTCAGCCGAGATACGTGTAAAAATGGGTCATAGACTGGTTTTTATTTCCATGTTATGACCCTATTATCTTTTATACAGGTATATTCTCTTCTATTGGTTGTGGAATGTTTTGTAAATCAATCACATAATCGCCAAATCGTTTTATATGTTTCGTCATATATGGACTTAACATCACCAGATCTTCTCGTGAGAATCGATAACCTTCTCTTTTGAGTTGCCATAAAATCATGGTAATATCAACGACATTTTGAAAAATGACTGCATTGGCAACGAGATCATTATATTTAATACGTTTTTCTTGTTCTACTGGATCATTTTCAGTAATAATCCCATCCCCACCAAAGAATAACCACTTTGAAAAACCATTATATGCTTCCACTTTATTTGTACTAGCTGTAATTTGCTCTCTCAATTTCATATCTGAGATATATTTAAGAAGAAATATCGTTCGAATGACTCTGCCTAGCTCTCGAAATGCTTGGTACAGTCGATTCTTTTTACTATCACTTCTCAGTTTTCTGAGAAGTGTTGAGGGTAGTATCTTTCCAGCTTTTATAGACAAAACAACTTGAAATAAATCTTGCCAATGAGTCTCAATTAACTTCCAATCGATTACATCACTAAATAAAGGATCTATATGTTTATATTGAATATGTTTGCTTGGTCTAAAGAATTTTAAGTCTTTCCAATTCCTAATTCTAGGCATTAAATTGATTCCTAATAGATAAGAAAGTGCAAAGACAGGAGTAGACTGGCCTTGTGTATCAGCATGAATCGTATCAGGTTGGATATCTGACTTATTTTTTAGCAATCCATCAATAATATAAACAGCTTCCCAAACCCCACAGGGGATAAAATGGCTAAATAAAGCAATATAATTATCCGAAACATGATGATAAGCTATTCCTCCATAGCCCCCATATCTGATGTGGTATTCTGACAGTAAGTTTTCTTCATATAAATCGTATTTTGTTCCATCAGCGGCGGCTGTTTTTCCACTCCCCCATAGTTTTGGAAGGCTAAAGAGGTTGTATTGATTTAAAATGTCTTGAATTGAGGCATCTAATTTTTGGACACTGATATGTCTACGATTCACAAAAGAAATCATATGAGGTGTTACTATATTTCGCATATGTTTAGCGGTTTGGGCTGGCCCTAAATTACAGCCATATCC	NA	NA	NA	NA
