The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014786	Lactobacillus reuteri strain ZLR003 chromosome, complete genome	2234097	9642	73200	2234097	transposase	Catovirus(20.0%)	51	NA	NA
WP_003668074.1|9642_10611_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_063164005.1|10774_11281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164006.1|11290_12247_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	3.6e-05
WP_063164007.1|12248_13313_+	EpsG family protein	NA	NA	NA	NA	NA
WP_155724282.1|13325_14387_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_063164008.1|14446_15412_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_063164009.1|15554_16538_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	36.7	2.1e-08
WP_063164010.1|16586_17543_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	36.5	1.0e-12
WP_063164011.1|17735_18968_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_063164012.1|18975_20427_+	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_063164013.1|20494_21364_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	60.4	1.9e-101
WP_003664372.1|21377_21959_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D8EQH2	Escherichia_phage	41.7	3.2e-33
WP_063164014.1|21970_23011_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	39.3	8.5e-61
WP_063164015.1|23294_24140_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	40.1	8.5e-35
WP_003672313.1|25602_25938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003672314.1|26330_26705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003672316.1|26761_26920_+	hypothetical protein	NA	A0A0A7NU07	Lactobacillus_phage	57.7	2.8e-08
WP_063164016.1|27097_28474_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	1.8e-29
WP_063164017.1|28535_30080_-|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	24.8	1.1e-16
WP_003668340.1|30150_30507_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_063164018.1|30496_30685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164019.1|31846_33343_+	group II intron reverse transcriptase domain-containing protein	NA	NA	NA	NA	NA
WP_013923736.1|33478_34609_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_063164020.1|34778_35552_+	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_063164021.1|35564_36314_+	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	33.5	5.6e-22
WP_063164585.1|36343_36964_+	sugar transferase	NA	NA	NA	NA	NA
WP_063164022.1|36960_38133_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_063164023.1|38144_39134_+	Stealth CR1 domain-containing protein	NA	NA	NA	NA	NA
WP_155724283.1|39142_40057_+	DUF1792 domain-containing protein	NA	NA	NA	NA	NA
WP_063164025.1|40056_41205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164026.1|41194_42724_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_063164027.1|42730_43471_+	hypothetical protein	NA	F2Y1U7	Organic_Lake_phycodnavirus	24.3	4.3e-06
WP_063164028.1|43467_44448_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.0	4.5e-11
WP_081120399.1|44444_45419_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_063164030.1|45432_46551_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_143447365.1|46668_46728_+	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_063164031.1|46754_48344_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_063164032.1|48426_49467_+	acyltransferase	NA	NA	NA	NA	NA
WP_081120400.1|49643_54503_+	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_003676621.1|54830_55430_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	36.2	2.8e-24
WP_117115084.1|55366_56275_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	27.6	4.0e-14
WP_016496790.1|57691_58915_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	44.7	3.0e-89
WP_063164034.1|58916_59654_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	45.4	8.7e-52
WP_063164035.1|59980_61258_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003668074.1|61492_62461_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_079376176.1|62572_67900_+	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_016496794.1|68563_69496_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_016496795.1|69488_70892_+	amino acid permease	NA	NA	NA	NA	NA
WP_016496796.1|70970_71228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041816984.1|71626_72025_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	3.0e-46
WP_063164036.1|72024_73200_+|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.7	7.8e-119
>prophage 2
NZ_CP014786	Lactobacillus reuteri strain ZLR003 chromosome, complete genome	2234097	85316	143845	2234097	integrase,transposase	unidentified_phage(44.44%)	55	93809:93868	149680:149855
WP_016496411.1|85316_86240_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.1e-33
WP_063164043.1|86322_87312_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003676686.1|87464_87920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035162210.1|87948_88440_+	hypothetical protein	NA	NA	NA	NA	NA
93809:93868	attL	TTTTTTTAGTGCGCCCGGCATGGGTATTAGCTAGGTGGTGAAAGTCCGCTATGGGCCGTA	NA	NA	NA	NA
WP_003673967.1|94069_94231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496806.1|94285_94927_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_063164044.1|95069_97376_+	DUF4968 domain-containing protein	NA	NA	NA	NA	NA
WP_003673974.1|97533_98793_+	chloride channel protein	NA	NA	NA	NA	NA
WP_063164045.1|98977_99625_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_063164046.1|99621_100440_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_016496809.1|100432_101242_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_063164047.1|101521_101827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003673982.1|101827_103729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164048.1|104112_105243_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	9.7e-34
WP_063164049.1|105523_105961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164050.1|105976_106936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164051.1|107173_108304_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.5	1.3e-35
WP_063164052.1|108362_109382_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003673988.1|109441_110218_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	8.1e-16
WP_035164271.1|110214_111210_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_063164053.1|111202_111652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035161426.1|111782_112184_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_003667715.1|112183_112429_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_035156404.1|112475_113669_+	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_063164054.1|113728_114637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164055.1|114641_115610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164056.1|115615_115888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164057.1|115984_116638_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_063164058.1|116630_117689_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_063164059.1|117839_118124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164060.1|118113_118686_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_003671870.1|118682_119174_-	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_063164061.1|119152_120370_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_063164062.1|120359_120857_-	MogA/MoaB family molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_063164063.1|120853_121873_-	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_063164064.1|122017_125683_+	nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_003663646.1|125672_127232_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	42.2	9.3e-19
WP_063164065.1|127224_127803_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_063164066.1|127795_128485_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_063164067.1|128712_129168_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.6	4.8e-16
WP_063164068.1|129319_130210_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003671859.1|130318_130966_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	30.7	4.2e-18
WP_063164069.1|130982_131837_-	patatin family protein	NA	NA	NA	NA	NA
WP_081120401.1|132282_134679_+	glycoside hydrolase family 68 protein	NA	NA	NA	NA	NA
WP_003668074.1|134752_135721_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003674018.1|135851_136010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164070.1|136081_137161_-	tyrosine recombinase XerS	NA	A0A0E3XA96	Gordonia_phage	29.6	4.0e-05
WP_003667749.1|137484_137931_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_003663667.1|138017_138464_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003674023.1|138483_139458_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003674025.1|139477_139720_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_016496830.1|139719_140670_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016496831.1|140653_141388_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	NA	NA	NA	NA
WP_003674030.1|141398_142631_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_013923736.1|142714_143845_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
149680:149855	attR	TTTTTTTAGTGCGCCCGGCATGGGTATTAGCTAGGTGGTGAAAGTCCGCTATGGGCCGTAGTAGTCGGAACCATGAGCTGAGGACAAGGGTGTCCACCGTGAGGTGGAATCTGAAGGAAGTCTAAGGCAAAGTACTGCATCGATGAACAAGAAGTAGCTATAAGGCTGAAATTAAC	NA	NA	NA	NA
>prophage 3
NZ_CP014786	Lactobacillus reuteri strain ZLR003 chromosome, complete genome	2234097	249148	256320	2234097	transposase	Staphylococcus_phage(57.14%)	8	NA	NA
WP_063164092.1|249148_249874_+	potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	45.4	5.6e-27
WP_035157468.1|249919_250378_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.0	2.3e-26
WP_063164093.1|250385_251567_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.9	6.2e-92
WP_063164094.1|251566_252169_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.0	3.3e-33
WP_063164095.1|252161_253229_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	32.4	2.6e-41
WP_063164096.1|253563_254508_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_063164097.1|254746_255922_-|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.4	1.0e-118
WP_041816984.1|255921_256320_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	3.0e-46
>prophage 4
NZ_CP014786	Lactobacillus reuteri strain ZLR003 chromosome, complete genome	2234097	304847	312912	2234097	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_063164117.1|304847_305690_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.1	6.1e-17
WP_003666062.1|305868_306513_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_063164118.1|306501_306990_-	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	40.8	9.6e-23
WP_063164119.1|307005_307968_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	61.2	4.3e-115
WP_063164120.1|307986_309897_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.2	8.9e-56
WP_003674237.1|309898_311110_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	39.7	3.8e-36
WP_003674239.1|311235_312501_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003666054.1|312636_312912_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	68.5	2.6e-25
>prophage 5
NZ_CP014786	Lactobacillus reuteri strain ZLR003 chromosome, complete genome	2234097	323343	433267	2234097	portal,transposase,integrase,capsid,tRNA,head,plate,terminase,tail,holin,protease	Lactobacillus_phage(47.62%)	111	315315:315330	423139:423153
315315:315330	attL	TTGTAATTCAGCAAAT	NA	NA	NA	NA
WP_003674256.1|323343_324237_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	24.6	2.5e-21
315315:315330	attL	TTGTAATTCAGCAAAT	NA	NA	NA	NA
WP_003674257.1|324236_325118_-	S1 RNA-binding protein	NA	NA	NA	NA	NA
WP_003665875.1|325259_326681_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_003674259.1|326866_330214_-	DNA polymerase III subunit alpha	NA	R4TB75	Streptomyces_phage	33.6	2.2e-150
WP_041821711.1|330296_330542_+	YjzD family protein	NA	NA	NA	NA	NA
WP_003674261.1|330584_331835_-	peptidase T	NA	NA	NA	NA	NA
WP_003674263.1|331859_332684_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_079376002.1|332670_333387_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_003674266.1|333475_334660_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003674268.1|334855_335998_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	36.6	2.5e-37
WP_016496915.1|335999_337865_-	DNA primase	NA	I6P4U6	Helicobacter_phage	34.2	1.0e-48
WP_063164122.1|337999_340075_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
338852:338867	attR	TTGTAATTCAGCAAAT	NA	NA	NA	NA
WP_003665860.1|340076_341063_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
338852:338867	attR	TTGTAATTCAGCAAAT	NA	NA	NA	NA
WP_003674276.1|341323_342109_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003674278.1|342124_343030_-	GTPase Era	NA	NA	NA	NA	NA
WP_003665857.1|343041_343437_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_003665856.1|343420_343900_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_003674280.1|343899_344907_-	PhoH family protein	NA	H6X2N1	Pseudomonas_phage	48.4	8.6e-50
WP_003674282.1|345006_345978_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_003674284.1|345983_346556_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_063164123.1|346683_348069_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_003674287.1|349449_350427_-	choloylglycine hydrolase family protein	NA	A0A2K9L5Y5	Tupanvirus	24.8	1.4e-17
WP_003665848.1|351631_352078_-	GatB/YqeY domain-containing protein	NA	A0A248SJP2	Salicola_phage	27.8	4.0e-07
WP_003674289.1|352137_352329_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_035161407.1|352628_354140_+	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_171945903.1|354141_354870_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.0	9.0e-33
WP_003674291.1|354930_356733_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016496924.1|357114_357963_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_003665822.1|358163_358601_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_063164124.1|358611_360849_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1V0SJX2	Klosneuvirus	41.7	1.1e-12
WP_003674298.1|360867_361203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003674300.1|361281_362022_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016496927.1|362022_362982_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_020843066.1|363059_363365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003668154.1|363561_363741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003674305.1|363848_364808_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003674306.1|364891_365068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164125.1|365143_366220_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_003674309.1|366292_367708_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_063164126.1|368460_369663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164087.1|369776_370742_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_063164127.1|370863_371973_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A075KJD2	Lactobacillus_phage	43.6	5.0e-43
WP_063164128.1|371975_372380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164129.1|372363_372783_-|holin	phage holin family protein	holin	A0A097BY69	Enterococcus_phage	41.2	1.8e-17
WP_063164130.1|372838_373540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164131.1|373642_374233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081120405.1|374452_374605_-	XkdX family protein	NA	NA	NA	NA	NA
WP_063164132.1|374601_374961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923736.1|375208_376339_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_081120406.1|376366_378691_-|plate	BppU family phage baseplate upper protein	plate	O03968	Lactobacillus_phage	48.7	5.5e-60
WP_063164133.1|379047_381567_-|tail	phage tail protein	tail	E9LUJ4	Lactobacillus_phage	44.8	4.3e-167
WP_063164134.1|381594_382437_-|tail	phage tail family protein	tail	E9LUJ3	Lactobacillus_phage	56.0	6.2e-86
WP_063164135.1|382440_386952_-|tail	phage tail tape measure protein	tail	E9LUJ2	Lactobacillus_phage	60.4	9.5e-274
WP_063164136.1|387119_388088_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_063164087.1|388176_389142_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003663707.1|389280_389637_-	hypothetical protein	NA	E9LUJ0	Lactobacillus_phage	43.6	3.9e-13
WP_063164137.1|389689_390319_-|tail	phage tail protein	tail	E9LUI9	Lactobacillus_phage	72.9	1.5e-76
WP_003663709.1|390318_390738_-	hypothetical protein	NA	D2KRB3	Lactobacillus_phage	53.7	2.6e-40
WP_003663710.1|390734_391109_-	HK97 gp10 family phage protein	NA	E9LUI7	Lactobacillus_phage	63.2	5.8e-36
WP_035170394.1|391092_391446_-|head	phage head closure protein	head	E9LUI6	Lactobacillus_phage	64.9	3.8e-37
WP_063164138.1|391348_391762_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUI5	Lactobacillus_phage	63.8	1.8e-30
WP_003663713.1|391903_393046_-|capsid	phage major capsid protein	capsid	D2KRA9	Lactobacillus_phage	66.2	4.4e-135
WP_063164139.1|393046_393700_-|head,protease	HK97 family phage prohead protease	head,protease	D2KRA8	Lactobacillus_phage	70.3	1.1e-61
WP_063164140.1|393638_394898_-|portal	phage portal protein	portal	D2KRA7	Lactobacillus_phage	75.0	1.3e-177
WP_081120407.1|394904_395060_-	DUF1056 family protein	NA	NA	NA	NA	NA
WP_063164141.1|395037_395439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164142.1|395419_397129_-|terminase	terminase large subunit	terminase	E9LUI0	Lactobacillus_phage	83.3	2.2e-287
WP_063164143.1|397125_397593_-|terminase	phage terminase small subunit P27 family	terminase	E9LUH9	Lactobacillus_phage	65.4	5.4e-47
WP_035170397.1|397776_398571_-	HNH endonuclease	NA	E9LUN5	Lactobacillus_phage	71.2	1.2e-112
WP_172397134.1|398643_398814_-	hypothetical protein	NA	U3PIS2	Lactobacillus_phage	50.9	1.3e-06
WP_063164144.1|399181_399595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016497154.1|399756_400680_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.1e-33
WP_063164145.1|401676_402150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003663725.1|402230_402374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172397146.1|402442_402781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003663729.1|402740_402959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164147.1|403088_403325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035152792.1|403336_403519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003663736.1|403518_404265_-	hypothetical protein	NA	A0A1L2JZ42	Aeribacillus_phage	42.9	1.6e-37
WP_155724284.1|404268_404994_-|integrase	phage integrase SAM-like domain-containing protein	integrase	A0A097BY30	Enterococcus_phage	45.3	2.8e-18
WP_063164148.1|405000_405909_-	DnaD domain protein	NA	E9LUM6	Lactobacillus_phage	42.4	7.5e-37
WP_063164149.1|405920_406136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164150.1|406179_406359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164151.1|406355_406559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035152807.1|406696_406978_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063164152.1|407036_407240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164153.1|407217_407478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155724285.1|407540_407711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164154.1|407878_408094_-	helix-turn-helix transcriptional regulator	NA	W6LP64	Streptococcus_phage	42.4	1.7e-08
WP_063164155.1|408251_408908_+	helix-turn-helix domain-containing protein	NA	U3PIS7	Lactobacillus_phage	46.2	6.0e-44
WP_063164156.1|408970_409612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155724286.1|409644_409818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155724287.1|409835_409973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164157.1|410040_411009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164158.1|411334_412495_+|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	43.9	9.4e-85
WP_003665812.1|412645_414481_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	2.5e-23
WP_003665811.1|414611_415763_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.1	1.3e-30
WP_003674311.1|415891_417757_-	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	46.6	1.1e-135
WP_003674313.1|417781_418354_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_003674314.1|418366_419419_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003674316.1|419539_419911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164159.1|419972_420920_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_003674319.1|420932_421838_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003665800.1|422031_422391_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_063164160.1|422410_424669_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.8	3.9e-18
WP_003665798.1|424682_424994_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003668183.1|424980_425283_-	YlxR family protein	NA	NA	NA	NA	NA
WP_003674322.1|425311_426499_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003674323.1|426519_426993_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_063164161.1|427126_431458_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	29.7	3.5e-15
WP_063164162.1|431533_433267_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	22.0	1.1e-07
>prophage 6
NZ_CP014786	Lactobacillus reuteri strain ZLR003 chromosome, complete genome	2234097	513709	568738	2234097	tRNA,transposase	Acinetobacter_phage(14.29%)	50	NA	NA
WP_142490569.1|513709_514561_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	25.2	8.9e-16
WP_016497187.1|514557_515271_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	36.1	3.8e-28
WP_003674411.1|515358_516333_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	8.6e-39
WP_063164180.1|516402_518880_-	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	28.6	5.0e-51
WP_003666783.1|518901_519585_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_063164181.1|519597_520254_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003668307.1|520390_521524_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_063164182.1|521631_521970_-	DUF1831 domain-containing protein	NA	NA	NA	NA	NA
WP_003674420.1|521971_523126_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_003668310.1|523145_523841_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_003668311.1|523856_524126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666776.1|524118_524670_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003666775.1|524682_524886_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_063164595.1|524999_527795_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	26.6	1.1e-83
WP_003666773.1|528092_528833_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_003674424.1|528854_529640_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_003674426.1|529662_529923_-	YggT family protein	NA	NA	NA	NA	NA
WP_003666769.1|529941_530358_-	cell division protein SepF	NA	NA	NA	NA	NA
WP_003666768.1|530428_531676_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_003674427.1|531693_533067_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_003674429.1|533187_534036_-	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_003674430.1|534063_535176_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_003674431.1|535177_536548_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_003674433.1|536560_537532_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_063164183.1|537556_539716_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_016496967.1|539715_540087_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_003674437.1|540094_541051_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_003666752.1|541066_541495_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_063164184.1|541639_541993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003666746.1|542121_542241_+	DUF4044 domain-containing protein	NA	NA	NA	NA	NA
WP_003674440.1|542302_544633_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.7	1.6e-83
WP_003674441.1|544654_545164_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_003674442.1|545335_546193_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_003674443.1|546307_547336_+	lactonase family protein	NA	NA	NA	NA	NA
WP_013923981.1|547763_547952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668340.1|547941_548298_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_063164185.1|548420_549386_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_063164186.1|549444_550989_+|transposase	IS66 family transposase	transposase	S5VLC8	Leptospira_phage	24.8	6.6e-17
WP_004562436.1|556949_557855_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_004562434.1|557854_558667_-	NAD kinase	NA	NA	NA	NA	NA
WP_003672237.1|558670_559324_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_016496972.1|559488_560127_+	DsbA family protein	NA	NA	NA	NA	NA
WP_063164187.1|560193_561570_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_004562428.1|561571_562606_-	competence protein CoiA	NA	NA	NA	NA	NA
WP_004562427.1|562688_563360_-	adaptor protein MecA	NA	NA	NA	NA	NA
WP_003665672.1|563485_563887_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_003666876.1|564134_564626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668074.1|564940_565909_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_143455706.1|566003_567290_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_081120409.1|567343_568738_-|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP014786	Lactobacillus reuteri strain ZLR003 chromosome, complete genome	2234097	652403	719393	2234097	integrase,transposase	unidentified_phage(18.75%)	59	701234:701248	722308:722322
WP_063164205.1|652403_654107_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	39.7	7.1e-97
WP_003667588.1|654258_655593_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.0	1.3e-48
WP_003676102.1|655821_657153_-	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_003676103.1|657145_658876_-	oxalyl-CoA decarboxylase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.6	2.9e-29
WP_003666612.1|659986_660730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003676105.1|660754_661162_+	VOC family protein	NA	NA	NA	NA	NA
WP_003676107.1|661625_662114_+	YueI family protein	NA	NA	NA	NA	NA
WP_003676109.1|662117_663422_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	47.7	1.7e-98
WP_003666604.1|663732_664029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003666602.1|664112_664601_+	universal stress protein	NA	NA	NA	NA	NA
WP_063164206.1|664711_665809_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063164207.1|665801_666644_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.0	1.9e-55
WP_003676116.1|666732_667302_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003666596.1|667388_668810_-	L-arabinose isomerase	NA	NA	NA	NA	NA
WP_003676120.1|668863_669592_-	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_063164208.1|669595_671218_-	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_050802161.1|671230_672655_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	29.8	1.4e-34
WP_035162055.1|673097_673697_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143447369.1|673633_674539_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	24.6	2.8e-07
WP_003676130.1|674644_675490_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_013923736.1|676758_677889_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_003676132.1|678097_679234_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_003676134.1|679366_679660_-	glycine cleavage system protein H	NA	NA	NA	NA	NA
WP_003676135.1|679672_680866_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_003666580.1|680914_681139_-	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_072575104.1|681162_681399_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_003666578.1|681404_682397_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_063164211.1|682503_683820_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_003667560.1|683838_684102_-	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_003666575.1|684303_684735_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_003666573.1|684746_686174_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_003666570.1|686200_687145_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_003666568.1|687180_688710_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_063164212.1|688741_689284_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_003666564.1|689273_689792_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_003666561.1|689834_690053_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_003666558.1|690077_690785_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016497011.1|691098_692370_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.3	2.8e-66
WP_003676146.1|692529_693303_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_003676148.1|693299_694415_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_063164213.1|694516_696244_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_003676152.1|696375_697011_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003676154.1|697103_698339_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.8	7.9e-98
WP_003676155.1|698452_699481_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	39.8	1.2e-54
WP_063164214.1|699486_700353_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003676159.1|700345_701428_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	44.6	4.0e-05
701234:701248	attL	TTCATCATCACTAAT	NA	NA	NA	NA
WP_003667548.1|701449_702025_-	thymidine kinase	NA	A0A249XZX5	Enterococcus_phage	52.4	1.3e-47
WP_063164215.1|702289_703417_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	6.0e-36
WP_003666538.1|703544_704882_+	Mur ligase family protein	NA	NA	NA	NA	NA
WP_003676161.1|704881_705589_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_003676163.1|705971_707378_-	amino acid permease	NA	NA	NA	NA	NA
WP_016497016.1|707426_708848_-	amino acid permease	NA	NA	NA	NA	NA
WP_003666533.1|708868_709330_-	arginine repressor	NA	NA	NA	NA	NA
WP_063164216.1|709440_710673_-	arginine deiminase	NA	NA	NA	NA	NA
WP_003676169.1|710880_711900_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003676171.1|712093_712693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496411.1|712727_713651_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.1e-33
WP_063164217.1|717214_718084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164218.1|718304_719393_-|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	49.7	2.7e-81
722308:722322	attR	TTCATCATCACTAAT	NA	NA	NA	NA
>prophage 8
NZ_CP014786	Lactobacillus reuteri strain ZLR003 chromosome, complete genome	2234097	876434	948889	2234097	tRNA,transposase,protease	Bacillus_virus(20.0%)	58	NA	NA
WP_063164262.1|876434_877571_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	29.7	2.6e-26
WP_003675928.1|877713_878907_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_003666300.1|879083_879776_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_003666299.1|879868_880294_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_003667346.1|880433_880994_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_003675931.1|881093_881270_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_003666293.1|881281_881431_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_063164263.1|881496_882246_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_003670544.1|882235_882649_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_003675935.1|882660_884073_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.6	2.1e-54
WP_081120414.1|884446_885598_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003675938.1|885616_886990_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003675940.1|887015_887552_-	hypothetical protein	NA	J9PV85	Bacillus_phage	49.1	2.8e-39
WP_003675942.1|887690_887987_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003666281.1|887998_888682_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_016497087.1|888710_890051_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.8	1.4e-71
WP_003675946.1|890158_890950_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003675947.1|890965_891715_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	1.2e-24
WP_003675949.1|891720_892422_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_063164265.1|892448_893591_-	PLP-dependent transferase	NA	A0A0B5JD48	Pandoravirus	26.4	1.4e-19
WP_016497089.1|893868_894735_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003667318.1|894709_895459_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003675955.1|895589_897359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675957.1|897456_898416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164266.1|898399_900286_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	33.5	1.5e-92
WP_003675961.1|900589_901042_-	SprT family protein	NA	NA	NA	NA	NA
WP_016497091.1|901034_903212_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_016497092.1|903283_904111_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.7	4.7e-78
WP_016497093.1|904123_905590_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.0	7.4e-111
WP_003666262.1|905651_906353_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003666260.1|906507_907227_-	amino acid racemase	NA	NA	NA	NA	NA
WP_041821766.1|907260_908910_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_003675971.1|909000_910401_-	MFS transporter	NA	NA	NA	NA	NA
WP_063164267.1|910518_911163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003675973.1|911521_912352_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003675974.1|912411_913911_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.1	1.6e-68
WP_172381020.1|914123_914825_-	DUF3642 domain-containing protein	NA	NA	NA	NA	NA
WP_035162004.1|916504_916834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164268.1|916946_917315_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003675988.1|917602_918103_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_003675989.1|918513_919695_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	26.6	2.9e-25
WP_003674676.1|925731_927144_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_063164269.1|927171_928149_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_063164270.1|928389_930636_-	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_003676621.1|930802_931402_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	36.2	2.8e-24
WP_117115084.1|931338_932247_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	27.6	4.0e-14
WP_081120415.1|932358_932499_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_035161508.1|932488_932677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081120416.1|932927_937235_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_063164271.1|937876_938836_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_063164272.1|939117_940086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164273.1|940078_940768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164274.1|940751_941279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164275.1|942109_943636_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	41.9	3.4e-90
WP_003674674.1|943656_944658_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003674673.1|944765_945686_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_035161528.1|945776_947885_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	48.4	4.6e-106
WP_063164276.1|948010_948889_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP014786	Lactobacillus reuteri strain ZLR003 chromosome, complete genome	2234097	1005090	1298382	2234097	tRNA,integrase,transposase,protease	Bacillus_phage(15.94%)	236	1048794:1048813	1068685:1068704
WP_063164280.1|1005090_1007118_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.2	1.7e-89
WP_003674578.1|1007195_1008044_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_016497131.1|1008493_1009192_-	NAD-dependent protein deacylase	NA	S5M4R0	Bacillus_phage	30.0	2.7e-18
WP_003674570.1|1009197_1010157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164281.1|1010149_1011412_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003674567.1|1011404_1012346_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_063164282.1|1012490_1013513_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003674562.1|1013790_1014750_+	site-specific DNA-methyltransferase	NA	A0A0H3UZ66	Geobacillus_virus	28.2	2.5e-14
WP_003665559.1|1014801_1015245_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	44.4	8.4e-26
WP_063164283.1|1015332_1017651_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003674558.1|1017663_1018833_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_172794552.1|1019115_1020477_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	25.4	2.7e-22
WP_035161517.1|1020439_1021912_-	amino acid permease	NA	NA	NA	NA	NA
WP_003674553.1|1022209_1022851_+	endonuclease III	NA	NA	NA	NA	NA
WP_003674551.1|1022862_1023153_+	FMN-binding protein	NA	NA	NA	NA	NA
WP_003674549.1|1023234_1024431_-	tetracycline resistance MFS efflux pump	NA	A0A2H4UVM2	Bodo_saltans_virus	20.4	2.0e-05
WP_155724289.1|1024545_1025832_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003674547.1|1026098_1027031_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003671339.1|1027554_1028406_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003674545.1|1028418_1029483_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	1.9e-23
WP_003665503.1|1029475_1030165_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003674542.1|1030183_1031329_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_035161516.1|1031675_1033013_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_003674537.1|1033164_1033593_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_003674534.1|1033664_1034303_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003674533.1|1034295_1035066_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	4.3e-25
WP_003674531.1|1035040_1035706_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003674529.1|1035772_1036672_-	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013924000.1|1036807_1038226_-|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003674526.1|1038400_1038856_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_072575172.1|1038858_1039713_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003674522.1|1039928_1041119_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_003674520.1|1041222_1043031_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.9	1.3e-69
WP_003674517.1|1043488_1044223_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003668074.1|1044331_1045300_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003674515.1|1045377_1046082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003667139.1|1046191_1046512_-	membrane protein	NA	NA	NA	NA	NA
WP_063164286.1|1046798_1048154_+	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	52.0	3.7e-125
WP_003667137.1|1048280_1048568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923736.1|1048705_1049836_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
1048794:1048813	attL	TTGCGACTTTAAAGTCGCAA	NA	NA	NA	NA
WP_063164287.1|1049921_1052771_-	DEAD/DEAH box helicase	NA	A0A0A1ENT0	Lactobacillus_phage	26.8	3.3e-22
WP_003674507.1|1052791_1053292_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016497157.1|1053291_1054245_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.7	1.2e-13
WP_003665466.1|1054520_1055291_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_016497158.1|1055422_1055824_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_003674501.1|1055835_1056378_+	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_063164288.1|1058351_1059770_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003674499.1|1059915_1060149_+	cytochrome b5	NA	NA	NA	NA	NA
WP_003674496.1|1060214_1060865_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003674494.1|1060943_1061171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003674492.1|1061278_1062019_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	38.2	6.0e-08
WP_003674491.1|1062182_1063508_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_003674489.1|1064232_1064802_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_063164289.1|1064943_1065804_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003674487.1|1065995_1066220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003674484.1|1066340_1066829_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_003674482.1|1066879_1067218_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_003674480.1|1067220_1068219_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_013923736.1|1068596_1069727_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
1068685:1068704	attR	TTGCGACTTTAAAGTCGCAA	NA	NA	NA	NA
WP_003668074.1|1075537_1076506_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_016497165.1|1076691_1077942_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.5	7.8e-85
WP_003675881.1|1078465_1079515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003665449.1|1079682_1080369_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_003675884.1|1080464_1081724_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_003675891.1|1083863_1084901_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	39.9	1.1e-60
WP_003675893.1|1084905_1086360_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	1.4e-56
WP_003675894.1|1086335_1088564_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.8	2.3e-148
WP_003675896.1|1088567_1089248_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003675897.1|1089248_1089497_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_063164290.1|1089497_1090217_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
WP_003675901.1|1090439_1091735_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.3	9.4e-17
WP_035161928.1|1091806_1092961_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016497168.1|1092923_1093409_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.4	1.8e-21
WP_003675907.1|1093590_1094307_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_003675908.1|1094323_1096003_-	acetolactate synthase AlsS	NA	G8DDL3	Micromonas_pusilla_virus	22.9	8.7e-31
WP_003675909.1|1096187_1097849_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_003665417.1|1098017_1099061_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003675910.1|1099232_1100408_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003670368.1|1100665_1101328_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	46.0	1.8e-40
WP_063164291.1|1101386_1102046_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_063164292.1|1102117_1102759_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_019253190.1|1102755_1103502_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_003665409.1|1103483_1104410_-	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_063164293.1|1104409_1105702_-	dihydroorotase	NA	NA	NA	NA	NA
WP_003675915.1|1105715_1106645_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	36.9	5.0e-28
WP_035161933.1|1106989_1107871_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013924000.1|1108487_1109906_+|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003669691.1|1110305_1110650_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_004562439.1|1110652_1111561_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_016497176.1|1111696_1112836_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.7	4.8e-33
WP_004562441.1|1112867_1113557_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	1.1e-37
WP_004562442.1|1113736_1114879_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	33.1	3.6e-60
WP_016496411.1|1114982_1115906_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.1e-33
WP_016497177.1|1116021_1116954_-	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003665392.1|1117062_1117773_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_016497178.1|1117793_1119092_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	52.7	2.3e-119
WP_004562445.1|1119120_1120314_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_003665386.1|1120366_1121041_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016497179.1|1121256_1122027_-	DUF1129 domain-containing protein	NA	NA	NA	NA	NA
WP_003669674.1|1122059_1123157_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_003665382.1|1123240_1123438_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_016497180.1|1123451_1124336_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	29.9	4.2e-16
WP_004562448.1|1124322_1125093_-	ParA family protein	NA	Q8JL10	Natrialba_phage	31.9	3.7e-29
WP_016497182.1|1125105_1126074_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHY8	Gordonia_phage	30.4	2.9e-10
WP_016497183.1|1126091_1126817_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004562451.1|1126993_1127878_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_004562452.1|1127980_1128889_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_041821947.1|1128969_1130175_-	nucleoside permease	NA	NA	NA	NA	NA
WP_016497185.1|1131133_1132483_-	amino acid permease	NA	NA	NA	NA	NA
WP_003665372.1|1132786_1133530_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	4.5e-32
WP_004562456.1|1133531_1134995_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_003665370.1|1135261_1136569_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.3	6.0e-96
WP_016496957.1|1136921_1137773_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	25.2	2.6e-15
WP_016497187.1|1137769_1138483_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	36.1	3.8e-28
WP_016497188.1|1138582_1139602_-	serine hydrolase	NA	NA	NA	NA	NA
WP_004562462.1|1139815_1140352_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	24.2	1.4e-06
WP_003668074.1|1140670_1141639_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_004562467.1|1142991_1143138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004562468.1|1143184_1143838_-	glucose-6-phosphate 1-dehydrogenase family protein	NA	NA	NA	NA	NA
WP_016497191.1|1143934_1144258_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_004562469.1|1144244_1144937_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_016497194.1|1146483_1148055_-	amidohydrolase	NA	NA	NA	NA	NA
WP_004562472.1|1148553_1148694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164294.1|1148697_1149561_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	28.5	2.5e-26
WP_004562474.1|1149711_1150206_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003665211.1|1150243_1150849_-	signal peptidase I	NA	NA	NA	NA	NA
WP_004562475.1|1151141_1152386_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_004562476.1|1152403_1153954_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_004562477.1|1154094_1156014_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1X9VNR2	Mimivirus	28.9	5.7e-18
WP_063164295.1|1156212_1158156_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_063164296.1|1158167_1159556_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_016497198.1|1159712_1160480_-	Jag N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004562481.1|1160575_1161409_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_003665224.1|1161412_1161766_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_003665227.1|1161904_1162039_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_063164297.1|1162534_1163857_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004562483.1|1164032_1165175_+	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	31.2	1.1e-13
WP_003665230.1|1166304_1166526_+	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_004562485.1|1166534_1167659_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003669489.1|1167655_1169605_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.7	2.0e-140
WP_063164298.1|1169647_1172152_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	37.2	2.1e-113
WP_003665235.1|1172352_1172649_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_004562487.1|1172686_1173250_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	71.1	9.7e-43
WP_003665240.1|1173283_1173520_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_004562493.1|1173735_1175754_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003665243.1|1175759_1176212_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_004562494.1|1176245_1177637_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.5	3.4e-121
WP_016496342.1|1177758_1178961_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	31.9	1.6e-42
WP_004562496.1|1178973_1179300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004562497.1|1179398_1180283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004562498.1|1181016_1181754_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	46.2	7.9e-53
WP_010011610.1|1181952_1182831_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.0e-42
WP_003688751.1|1182854_1183142_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_063164136.1|1186154_1187123_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003675553.1|1187598_1189248_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.8	4.1e-110
WP_003675551.1|1189592_1190300_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.6	4.3e-40
WP_003675548.1|1190313_1192179_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	34.7	5.5e-34
WP_063164301.1|1192156_1193452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675544.1|1193464_1194307_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_016496352.1|1194324_1195131_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.1	5.6e-36
WP_063164302.1|1195234_1196515_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	6.2e-21
WP_003669518.1|1196606_1197116_+	phosphatidylglycerophosphatase A	NA	A0A291I9Q0	Lactobacillus_phage	51.9	8.2e-41
WP_003675538.1|1197424_1198411_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_035161733.1|1198879_1199359_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_003675532.1|1199502_1199721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675530.1|1199788_1200331_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003675528.1|1200549_1201722_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_019251835.1|1201789_1202566_-	VOC family protein	NA	NA	NA	NA	NA
WP_063164303.1|1202567_1203380_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_063164304.1|1203680_1205054_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003675522.1|1205229_1206312_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003675520.1|1206313_1207012_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	2.6e-37
WP_063164305.1|1206998_1208234_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_063164233.1|1208529_1209663_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	2.0e-34
WP_041821552.1|1210558_1211953_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_063164306.1|1213162_1214137_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_016496838.1|1214372_1215659_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003669548.1|1215798_1216227_-	OsmC family protein	NA	NA	NA	NA	NA
WP_063164307.1|1216294_1217290_-	D-2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	30.2	1.4e-31
WP_063164308.1|1217291_1218479_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003670244.1|1218984_1219206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164309.1|1219323_1221561_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.8	1.6e-120
WP_081120419.1|1221720_1223139_-|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_063164311.1|1223269_1225189_-	tetracycline resistance ribosomal protection protein Tet(W)	NA	E4ZFJ7	Streptococcus_phage	99.7	0.0e+00
WP_081120419.1|1225570_1226989_-|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_063164312.1|1227903_1230798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081120420.1|1230882_1231509_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016496373.1|1231606_1233070_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_063164314.1|1233184_1236967_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_063164315.1|1236966_1241145_+	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.0	2.1e-17
WP_003675501.1|1241145_1242081_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_063164316.1|1242144_1243323_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_081120421.1|1243623_1245042_+|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003670259.1|1245212_1246562_+	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_029507514.1|1246650_1248903_+	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_003670263.1|1248921_1249584_+	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_016496378.1|1249660_1250146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496379.1|1250230_1250854_+	GTP pyrophosphokinase	NA	NA	NA	NA	NA
WP_003670268.1|1250855_1251521_+	response regulator transcription factor	NA	A0A1J0GWE0	Alteromonas_phage	25.2	1.3e-06
WP_079375844.1|1251514_1252780_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003675491.1|1252782_1253964_+	chloride channel protein	NA	NA	NA	NA	NA
WP_016496383.1|1255420_1256149_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_003675482.1|1256266_1257133_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	3.3e-58
WP_003665339.1|1257144_1257441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164318.1|1257535_1259323_+	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	NA	NA	NA	NA
WP_003675477.1|1259375_1259873_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_063164319.1|1260141_1261491_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003675474.1|1261542_1262517_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	67.5	6.0e-133
WP_003675472.1|1262712_1264011_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	36.4	2.5e-70
WP_063164320.1|1264120_1264906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003670286.1|1265078_1265615_+	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_003675470.1|1265709_1266096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003675467.1|1266810_1267008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164321.1|1266995_1267496_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016496411.1|1267479_1268403_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.1e-33
WP_003665350.1|1268574_1268979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164322.1|1269098_1270658_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_003675461.1|1270659_1272162_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016496386.1|1272273_1273974_+	fibrinogen-binding adhesin SdrG C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003675459.1|1274157_1275840_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_003675458.1|1277319_1280490_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_016496388.1|1280482_1281571_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_003665359.1|1281950_1283318_-	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_063164323.1|1283478_1284489_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003675451.1|1284630_1286034_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	36.2	2.2e-80
WP_003675448.1|1286289_1286862_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	46.2	1.3e-42
WP_016496391.1|1286861_1288112_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	44.5	1.0e-39
WP_003675444.1|1288114_1289041_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_063164324.1|1289216_1290185_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003675442.1|1290467_1290719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164325.1|1290815_1291496_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.8	1.9e-29
WP_016496396.1|1291492_1292824_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	3.4e-22
WP_003675438.1|1292928_1293579_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_063164326.1|1295739_1296060_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003675433.1|1296185_1296779_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063164327.1|1297413_1298382_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP014786	Lactobacillus reuteri strain ZLR003 chromosome, complete genome	2234097	1305984	1435001	2234097	tRNA,transposase	unidentified_phage(16.67%)	107	NA	NA
WP_003668074.1|1305984_1306953_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003670156.1|1307005_1308007_+	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_003675421.1|1308065_1309055_-	asparaginase	NA	NA	NA	NA	NA
WP_016496405.1|1311105_1311684_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063164330.1|1312916_1313561_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003669411.1|1313666_1314038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003669410.1|1314139_1314811_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_016496409.1|1314883_1315684_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_016496411.1|1316094_1317018_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.1e-33
WP_003668074.1|1318024_1318993_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003675410.1|1319252_1319933_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003675409.1|1320001_1321300_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.5	1.3e-55
WP_016496414.1|1321319_1322330_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.4	5.5e-65
WP_016496415.1|1322706_1323267_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_016496416.1|1323489_1326021_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.2	2.4e-64
WP_003675401.1|1326167_1326809_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003675399.1|1327025_1328348_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	31.0	1.5e-65
WP_003675396.1|1328497_1329673_+	MFS transporter	NA	NA	NA	NA	NA
WP_016496417.1|1329684_1330998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496420.1|1331508_1332111_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003675391.1|1332208_1332520_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003675390.1|1332647_1333304_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_003675387.1|1333484_1333922_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003669379.1|1334050_1334284_+	cytochrome b5	NA	NA	NA	NA	NA
WP_003665104.1|1334419_1334638_+	cytochrome b5	NA	NA	NA	NA	NA
WP_003675383.1|1334650_1334896_+	cytochrome b5	NA	NA	NA	NA	NA
WP_016496424.1|1334953_1336090_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	45.5	6.0e-84
WP_003675378.1|1336850_1337807_+	ketopantoate reductase family protein	NA	NA	NA	NA	NA
WP_080637861.1|1337990_1339385_-	amino acid permease	NA	NA	NA	NA	NA
WP_143456168.1|1339697_1341353_+	MFS transporter	NA	NA	NA	NA	NA
WP_142499017.1|1342660_1343512_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	25.2	5.2e-16
WP_011953599.1|1343585_1345391_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	32.1	7.8e-86
WP_016496430.1|1345719_1346403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171945898.1|1346668_1348309_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003665087.1|1348833_1349844_+	zinc-dependent alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.8	3.1e-07
WP_003675363.1|1350105_1350618_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003675361.1|1350628_1351687_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016496431.1|1351704_1352391_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.0	5.5e-32
WP_016496432.1|1352489_1354472_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	40.7	1.9e-32
WP_003675355.1|1354701_1354938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675352.1|1355040_1355358_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063164599.1|1355521_1357219_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	39.6	2.7e-24
WP_016496411.1|1357270_1358194_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.1e-33
WP_081120438.1|1358200_1358278_-	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_003675348.1|1358705_1359650_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.5	4.4e-16
WP_003675345.1|1359781_1359967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003675343.1|1360192_1360813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675341.1|1360814_1362011_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	34.8	3.4e-53
WP_003675339.1|1362332_1363610_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016496435.1|1363731_1364226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016496436.1|1364329_1364968_-	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_003675334.1|1365165_1366551_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_013924000.1|1368790_1370209_-|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_063164332.1|1370283_1371399_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	6.6e-35
WP_003669331.1|1371513_1372170_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_063164333.1|1372368_1372950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013923736.1|1373703_1374834_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_016496813.1|1376420_1377797_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	39.5	3.0e-29
WP_063164334.1|1378097_1379219_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_003675322.1|1379375_1381505_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.7	1.6e-159
WP_003665058.1|1381630_1381894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003675320.1|1382025_1382679_+	phosphoglycerate mutase family protein	NA	NA	NA	NA	NA
WP_003675317.1|1384442_1385852_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_016496446.1|1386163_1387492_-	purine permease	NA	Q9KX94	Enterobacteria_phage	30.8	3.5e-35
WP_016496447.1|1387858_1389292_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_063164335.1|1389442_1391185_+|transposase	IS1182 family transposase	transposase	A0A146ICT8	Staphylococcus_phage	39.7	1.5e-97
WP_003675307.1|1391275_1392193_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003675305.1|1392339_1393260_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	26.0	6.1e-10
WP_003665044.1|1393278_1394034_+	TerC family protein	NA	S5MAL1	Bacillus_phage	41.8	2.4e-41
WP_003675303.1|1394035_1394353_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	37.8	2.7e-18
WP_003675301.1|1394421_1395744_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_063164336.1|1396098_1399599_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003675296.1|1399657_1399990_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016496452.1|1400034_1400598_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_003669785.1|1400663_1401428_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	30.2	2.3e-10
WP_003675292.1|1401420_1402320_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003675290.1|1402316_1403312_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_063164337.1|1403686_1404712_-	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	44.9	4.2e-12
WP_063164338.1|1405108_1405333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668074.1|1405611_1406580_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_041821572.1|1406749_1407052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003675286.1|1407271_1408813_+	ABC-F family ATP-binding cassette domain-containing protein	NA	Q6DMX7	Streptococcus_phage	26.3	9.7e-37
WP_003675283.1|1408853_1409633_+	putative ABC transporter permease	NA	NA	NA	NA	NA
WP_003675281.1|1409709_1410303_+	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	49.0	3.4e-30
WP_003668074.1|1410323_1411292_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003675279.1|1411454_1412840_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_003675277.1|1413195_1414431_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_063164339.1|1414566_1415646_+	phosphoesterase	NA	NA	NA	NA	NA
WP_003675272.1|1416053_1416338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035161689.1|1417620_1418571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003665009.1|1418601_1418922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675266.1|1418927_1419611_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003675264.1|1419613_1419787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675263.1|1420082_1420463_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_003675261.1|1420522_1421155_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_003675259.1|1421158_1422304_+	AAA family ATPase	NA	A0A097PAJ8	Delftia_phage	27.0	3.7e-09
WP_063164341.1|1422300_1423593_+	peptidase	NA	A0A172JHT2	Bacillus_phage	25.8	2.6e-27
WP_016496461.1|1423596_1423890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164342.1|1423963_1425868_+	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.4	8.8e-72
WP_016496462.1|1426011_1426650_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM8	Bacillus_phage	41.5	8.8e-08
WP_003675249.1|1426649_1427153_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	47.1	2.5e-34
WP_003675246.1|1427253_1428414_+	MFS transporter	NA	NA	NA	NA	NA
WP_063164343.1|1428489_1429983_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_013923736.1|1430429_1431560_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_063164344.1|1432139_1433063_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.1	3.2e-112
WP_016496467.1|1433068_1433896_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_016496361.1|1434041_1435001_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.2	9.7e-19
>prophage 11
NZ_CP014786	Lactobacillus reuteri strain ZLR003 chromosome, complete genome	2234097	1513371	1576283	2234097	tRNA,transposase	Streptococcus_phage(17.65%)	59	NA	NA
WP_003675129.1|1513371_1514637_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_003675128.1|1514626_1515544_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_003675126.1|1515549_1516521_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_003675123.1|1516540_1517836_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_003669952.1|1517897_1518488_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_003675121.1|1518496_1519258_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_003669956.1|1519254_1519845_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003675119.1|1519858_1520569_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003669958.1|1520570_1521623_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_063164361.1|1521829_1522228_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	62.9	5.0e-46
WP_063164362.1|1522227_1523403_+|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.4	2.5e-117
WP_003669961.1|1523909_1524287_+	DUF4430 domain-containing protein	NA	NA	NA	NA	NA
WP_003669962.1|1524292_1524832_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_063164363.1|1525007_1525193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035161748.1|1525450_1526473_-	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	35.3	2.4e-52
WP_003669968.1|1526668_1527217_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003675111.1|1527213_1528956_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.6	2.1e-40
WP_003675109.1|1528939_1530769_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	1.2e-57
WP_003675107.1|1530841_1533046_-	ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent	NA	R9R4J2	Mycobacterium_phage	32.6	3.1e-84
WP_063164364.1|1533184_1534621_-	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_063164365.1|1534699_1535206_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_003675099.1|1535337_1536069_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063164366.1|1536337_1538749_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_003675095.1|1538925_1540281_+	APC family permease	NA	NA	NA	NA	NA
WP_063164367.1|1540315_1541062_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016496497.1|1541195_1542548_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_003675090.1|1542573_1543476_+	ROK family protein	NA	NA	NA	NA	NA
WP_016496498.1|1543535_1545464_-	TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein	NA	D0R0F5	Streptococcus_phage	30.7	3.0e-67
WP_003664906.1|1545475_1545943_-	universal stress protein	NA	NA	NA	NA	NA
WP_003675087.1|1546143_1547157_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_003669993.1|1547441_1547849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003669080.1|1547845_1548304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003664891.1|1548671_1549841_-	MFS transporter	NA	NA	NA	NA	NA
WP_003675084.1|1549995_1551408_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_003675082.1|1551453_1552440_+	zinc-binding dehydrogenase	NA	A0A2P1EIJ9	Megavirus	22.9	1.7e-05
WP_003675081.1|1552494_1553352_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003664887.1|1553362_1553776_-	helix-turn-helix transcriptional regulator	NA	A0A0H4ITV7	Staphylococcus_phage	44.3	1.6e-07
WP_041821590.1|1553909_1554878_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_063164368.1|1554891_1555260_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003668074.1|1555325_1556294_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_063164369.1|1556443_1557574_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.9	8.7e-35
WP_063164370.1|1557666_1559628_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_003664882.1|1559871_1560213_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_003675074.1|1560254_1560908_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016496502.1|1560897_1562280_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.9	6.5e-16
WP_003675070.1|1562284_1562845_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_003675068.1|1563110_1563896_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016496503.1|1563957_1564713_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.5e-22
WP_003675066.1|1565004_1565967_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_016496504.1|1566132_1567131_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	40.5	3.0e-15
WP_072575295.1|1567127_1567307_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_171945905.1|1567400_1568303_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	31.9	1.5e-21
WP_016496506.1|1568227_1568941_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.2	3.2e-27
WP_003675059.1|1569096_1569453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035161647.1|1569552_1570209_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_003675057.1|1570340_1571693_+	APC family permease	NA	NA	NA	NA	NA
WP_003675056.1|1571820_1572288_-	DNA starvation/stationary phase protection protein	NA	A0A291I9P0	Lactobacillus_phage	31.3	4.1e-15
WP_016496508.1|1572430_1575094_-	HAD-IC family P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	28.7	8.6e-65
WP_063164327.1|1575314_1576283_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP014786	Lactobacillus reuteri strain ZLR003 chromosome, complete genome	2234097	1614128	1660942	2234097	transposase	Planktothrix_phage(20.0%)	35	NA	NA
WP_016497145.1|1614128_1615094_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_016496526.1|1615496_1616111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003664767.1|1617218_1617695_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_003675003.1|1617810_1618674_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013923776.1|1618939_1620358_+|transposase	ISLre2-like element ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_003675000.1|1622489_1623671_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003664757.1|1623927_1624485_+	elongation factor P	NA	NA	NA	NA	NA
WP_063164372.1|1624833_1625802_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_016496534.1|1625824_1626535_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_063164373.1|1626660_1627533_+	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_063164374.1|1627537_1628437_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_016496536.1|1628436_1629318_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_016496537.1|1629328_1630084_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	4.3e-14
WP_016496538.1|1630094_1630799_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_016496539.1|1631970_1632834_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_013923866.1|1634151_1635327_+|transposase	transposase	transposase	A0A0P0ICY9	Lactobacillus_phage	55.7	2.7e-119
WP_016496544.1|1636148_1637288_+	glycoside hydrolase	NA	NA	NA	NA	NA
WP_041821602.1|1637284_1638049_-	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016496411.1|1638072_1638996_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.1e-33
WP_016496546.1|1639196_1640969_-	oleate hydratase	NA	NA	NA	NA	NA
WP_016496547.1|1641123_1642467_+	potassium uptake protein	NA	NA	NA	NA	NA
WP_016496548.1|1642459_1643128_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_016496549.1|1643145_1643691_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016496550.1|1643948_1645253_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_016496551.1|1645255_1646188_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016496552.1|1646495_1647410_+	cysteine synthase family protein	NA	A0A1X9I5K7	Streptococcus_phage	41.8	8.8e-62
WP_063164375.1|1648226_1649255_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_063164376.1|1649434_1650151_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_063164377.1|1650245_1651715_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	24.9	5.3e-24
WP_063164378.1|1651977_1652922_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_063164379.1|1654587_1655922_+	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_003674956.1|1656217_1657435_+	MFS transporter	NA	NA	NA	NA	NA
WP_003668877.1|1657455_1658913_+	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_003674954.1|1659065_1659863_-	serine hydrolase	NA	NA	NA	NA	NA
WP_063164380.1|1659973_1660942_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP014786	Lactobacillus reuteri strain ZLR003 chromosome, complete genome	2234097	1687936	1747414	2234097	integrase,transposase,protease	Lactobacillus_phage(18.18%)	52	1719240:1719261	1725499:1725520
WP_003668074.1|1687936_1688905_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_035157252.1|1689067_1689955_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003674936.1|1690010_1691378_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003674935.1|1691390_1692044_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
WP_003674934.1|1692120_1693680_+	MFS transporter	NA	NA	NA	NA	NA
WP_003674933.1|1693728_1694712_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_063164385.1|1694724_1695297_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_016496581.1|1695358_1697944_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_063164386.1|1698249_1699122_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003668834.1|1699332_1700061_-	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_003668833.1|1700060_1701569_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003668831.1|1701701_1702148_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003668828.1|1702226_1702574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003674925.1|1702849_1704706_+	ribonuclease J	NA	NA	NA	NA	NA
WP_063164387.1|1704852_1706040_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003674923.1|1706087_1706741_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003674922.1|1706753_1707392_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003674921.1|1707391_1708222_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_171945906.1|1708234_1708969_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.2	1.8e-33
WP_003668816.1|1709252_1709729_+	universal stress protein	NA	NA	NA	NA	NA
WP_003664611.1|1709932_1710616_+	VIT family protein	NA	NA	NA	NA	NA
WP_003674919.1|1710630_1711323_+	VIT family protein	NA	NA	NA	NA	NA
WP_003674918.1|1711386_1712307_-	cation transporter	NA	NA	NA	NA	NA
WP_016496586.1|1712489_1713164_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_003664604.1|1713310_1713511_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	73.8	2.1e-21
WP_016496587.1|1713619_1714375_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003674915.1|1714386_1714860_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_003668803.1|1714915_1715590_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_063164388.1|1715659_1716115_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003674909.1|1716454_1717930_+	amino acid permease	NA	NA	NA	NA	NA
WP_003668798.1|1718028_1718670_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	51.4	2.7e-57
1719240:1719261	attL	GTTCAAATCTTGTAATTCCGAT	NA	NA	NA	NA
WP_063164389.1|1719409_1720561_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	30.8	6.0e-39
WP_063164390.1|1720624_1721236_-	helix-turn-helix transcriptional regulator	NA	L0P7E1	Lactobacillus_phage	51.5	9.9e-09
WP_063164391.1|1721368_1721554_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063164392.1|1721566_1721902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164393.1|1721992_1722265_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063164394.1|1722507_1723389_+	hypothetical protein	NA	Q9AZA0	Lactobacillus_prophage	50.7	8.3e-33
WP_063164395.1|1723629_1723812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164396.1|1724319_1724550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019253138.1|1724570_1724993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003674904.1|1726906_1727935_+	alcohol dehydrogenase AdhP	NA	A0A2K9L7I1	Tupanvirus	29.7	5.9e-30
1725499:1725520	attR	GTTCAAATCTTGTAATTCCGAT	NA	NA	NA	NA
WP_003664589.1|1728100_1728568_+	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003674903.1|1728582_1731075_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CXH0	Yersinia_phage	39.7	9.0e-125
WP_003664584.1|1731362_1731965_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063164398.1|1732192_1735810_+	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.8	2.3e-52
WP_016496592.1|1735853_1739489_+	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.5	3.1e-65
WP_003668074.1|1739557_1740526_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003674896.1|1740637_1741813_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_003664576.1|1742792_1743212_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003668788.1|1743232_1743703_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003674892.1|1743841_1745929_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.4	9.7e-64
WP_143455706.1|1746127_1747414_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP014786	Lactobacillus reuteri strain ZLR003 chromosome, complete genome	2234097	1764616	1814881	2234097	tRNA,transposase	Bacillus_phage(14.29%)	46	NA	NA
WP_063164403.1|1764616_1765387_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_003672672.1|1765492_1765936_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_003668771.1|1765943_1766345_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_013923736.1|1766577_1767708_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_003668074.1|1769096_1770065_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003674862.1|1770338_1771112_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_172794555.1|1771219_1771885_+	glucosaminidase domain-containing protein	NA	S5M633	Brevibacillus_phage	47.9	2.3e-27
WP_003668074.1|1771961_1772930_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_063164405.1|1772985_1773561_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003674858.1|1773577_1774711_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_003664509.1|1774868_1777142_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	43.2	5.5e-137
WP_063164406.1|1777160_1779203_+	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	34.5	1.8e-99
WP_016496599.1|1779206_1780322_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_003664503.1|1780473_1780791_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_063164407.1|1780790_1782263_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003664499.1|1782264_1783689_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003668753.1|1783699_1784713_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.0	1.0e-18
WP_035161602.1|1784746_1786180_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	53.1	5.5e-135
WP_003674844.1|1786346_1786763_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_063164408.1|1786762_1789711_+	DEAD/DEAH box helicase	NA	Q6NDX2	Leptospira_phage	29.2	5.4e-28
WP_063164409.1|1789864_1790242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164410.1|1790312_1791269_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003674838.1|1791498_1793400_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.4	1.1e-87
WP_003671691.1|1793426_1793657_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_003674835.1|1793656_1794202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003674833.1|1794221_1794857_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_016496616.1|1796737_1797568_-	alpha/beta hydrolase	NA	A0A220T682	Eptesipox_virus	26.7	4.0e-21
WP_003674828.1|1797589_1798138_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	42.5	5.7e-32
WP_063164411.1|1798139_1799582_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	42.7	2.1e-97
WP_003674824.1|1799699_1800407_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_063164087.1|1800632_1801598_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_016496618.1|1801599_1802205_-	ATPase	NA	NA	NA	NA	NA
WP_003674822.1|1802308_1802632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003674821.1|1802959_1803511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003674819.1|1803556_1803997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081120425.1|1805478_1806810_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.8	4.5e-30
WP_063164413.1|1806963_1807677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003674813.1|1807768_1808308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164414.1|1808919_1809378_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	54.9	7.4e-17
WP_063164415.1|1809428_1810511_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003674806.1|1810755_1811679_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	36.0	9.1e-14
WP_003674803.1|1811686_1812133_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_003664437.1|1812129_1812564_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003674801.1|1812710_1813220_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_063164416.1|1813280_1813847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164136.1|1813912_1814881_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP014786	Lactobacillus reuteri strain ZLR003 chromosome, complete genome	2234097	1858428	1868704	2234097	transposase	Escherichia_phage(42.86%)	8	NA	NA
WP_063164434.1|1858428_1860747_+	glycoside hydrolase family 73 protein	NA	A0A249Y0X5	Enterococcus_phage	39.8	1.5e-33
WP_172395798.1|1860924_1861197_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_003676198.1|1862503_1863241_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	45.8	3.0e-52
WP_063164437.1|1863667_1864795_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.6e-34
WP_063164438.1|1865201_1866071_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	60.1	8.3e-102
WP_003664372.1|1866084_1866666_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D8EQH2	Escherichia_phage	41.7	3.2e-33
WP_063164439.1|1866677_1867718_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	39.3	1.1e-60
WP_063164440.1|1867864_1868704_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.8	1.2e-33
>prophage 16
NZ_CP014786	Lactobacillus reuteri strain ZLR003 chromosome, complete genome	2234097	2003039	2092348	2234097	tRNA,integrase,transposase	unidentified_phage(26.09%)	85	2053739:2053758	2082893:2082912
WP_003675718.1|2003039_2004086_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.2	1.7e-29
WP_063164467.1|2004092_2006510_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_063164468.1|2006695_2007334_+	C40 family peptidase	NA	M9MUG9	Rhodococcus_phage	33.3	6.1e-09
WP_003668449.1|2007446_2008103_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.1	2.7e-36
WP_003664064.1|2008166_2008643_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_003675710.1|2009551_2009941_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_003675709.1|2010008_2012624_-	YfhO family protein	NA	NA	NA	NA	NA
WP_051111512.1|2012833_2014933_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003664049.1|2015071_2015221_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003675704.1|2015357_2015912_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_003668441.1|2016461_2016701_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_003675699.1|2016725_2017697_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_003672480.1|2017710_2018130_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003675697.1|2018290_2018467_-	DUF3042 family protein	NA	NA	NA	NA	NA
WP_003675695.1|2018581_2019505_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003675693.1|2019674_2021018_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016496715.1|2021259_2022765_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L0I5	Tupanvirus	31.9	1.7e-09
WP_003675687.1|2024494_2025346_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_063164469.1|2025627_2026758_+|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.6	5.5e-29
WP_063164469.1|2027327_2028458_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.6	5.5e-29
WP_063164471.1|2028586_2028919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143449698.1|2029071_2029233_+	replication domain protein	NA	A0A286QS97	Streptococcus_phage	61.5	3.0e-05
WP_063164473.1|2029432_2030809_+	tetracycline efflux MFS transporter Tet(L)	NA	NA	NA	NA	NA
WP_045025295.1|2031613_2032744_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	1.1e-34
WP_003671670.1|2032797_2033556_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	48.2	1.9e-62
WP_063164190.1|2033560_2034772_-|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	45.9	1.9e-91
WP_063164474.1|2035264_2035822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668074.1|2035807_2036776_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_003664118.1|2037421_2037880_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	37.0	3.9e-18
WP_063164475.1|2038337_2039747_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_063164476.1|2039889_2040294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164477.1|2040393_2041578_-|integrase	site-specific integrase	integrase	A9D9I9	Lactobacillus_prophage	37.9	1.7e-60
WP_063164478.1|2041628_2042096_-	hypothetical protein	NA	D6PSS8	Lactobacillus_phage	27.8	2.4e-07
WP_063164479.1|2042153_2042570_-	helix-turn-helix domain-containing protein	NA	Q9G039	Staphylococcus_virus	47.8	1.3e-12
WP_063164480.1|2042706_2042946_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PDH8	Staphylococcus_phage	42.3	1.1e-08
WP_063164481.1|2043067_2043316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081120428.1|2043327_2043573_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_063164483.1|2043603_2043888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164484.1|2043902_2045231_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_063164485.1|2045564_2045765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164486.1|2045775_2046111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164487.1|2046313_2046682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164488.1|2046705_2047044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164489.1|2047067_2047382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164490.1|2047395_2048604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164491.1|2048620_2049016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155724292.1|2049288_2049456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164493.1|2049474_2049819_+	hypothetical protein	NA	S5MAA0	Brevibacillus_phage	34.6	1.3e-05
WP_003668074.1|2049895_2050864_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_063164494.1|2050927_2051263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164495.1|2051306_2051840_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_063164496.1|2051836_2052856_+	hypothetical protein	NA	NA	NA	NA	NA
2053739:2053758	attL	ATTTTGGCGAAACTTTGAAA	NA	NA	NA	NA
WP_063164498.1|2054003_2054312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164499.1|2054313_2054769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164500.1|2054796_2055234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164501.1|2055460_2055997_+	type III toxin-antitoxin system ToxN/AbiQ family toxin	NA	NA	NA	NA	NA
WP_063164502.1|2056117_2058130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164503.1|2058214_2058397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081120429.1|2058415_2058544_+	type II toxin-antitoxin system YoeB family toxin	NA	NA	NA	NA	NA
WP_063164504.1|2058668_2059133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164469.1|2059160_2060291_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	30.6	5.5e-29
WP_063164505.1|2060688_2061027_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A9D9Y1	Lactobacillus_prophage	47.7	7.3e-22
WP_063164506.1|2061092_2061365_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001159903.1|2061785_2062022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000163792.1|2062028_2063981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868795.1|2064052_2064550_-	trimethoprim-resistant dihydrofolate reductase DfrG	NA	G3MBI7	Bacillus_virus	49.1	4.0e-40
WP_063164507.1|2064914_2066282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164508.1|2066354_2068673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153706031.1|2068710_2068884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164509.1|2069032_2069470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496411.1|2069592_2070516_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.3	5.1e-33
WP_191980873.1|2072155_2073475_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_063164511.1|2073558_2074233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164513.1|2074617_2075052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164514.1|2075048_2075462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164515.1|2075732_2077589_+	N-6 DNA methylase	NA	A0A1W6JNK1	Staphylococcus_phage	37.1	2.6e-92
WP_063164164.1|2077654_2078620_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_155724293.1|2078783_2079794_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_063164516.1|2079876_2080797_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	45.6	1.3e-73
WP_155724294.1|2081069_2081906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164518.1|2082124_2082739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063164519.1|2082974_2090228_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
2082893:2082912	attR	ATTTTGGCGAAACTTTGAAA	NA	NA	NA	NA
WP_063164520.1|2090400_2090895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164521.1|2090878_2091109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164522.1|2091217_2092348_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	6.0e-36
>prophage 17
NZ_CP014786	Lactobacillus reuteri strain ZLR003 chromosome, complete genome	2234097	2098757	2148186	2234097	tRNA,transposase,protease	unidentified_phage(22.22%)	50	NA	NA
WP_063164530.1|2098757_2100593_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	36.7	1.7e-83
WP_063164531.1|2100614_2100911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164532.1|2101011_2101329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164533.1|2101458_2103927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164534.1|2104087_2105161_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_063164535.1|2105264_2108204_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_063164536.1|2108207_2110919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164537.1|2111042_2111387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164538.1|2111376_2112048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164539.1|2112062_2113991_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_063164540.1|2113990_2114239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164541.1|2114254_2115454_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	46.5	2.4e-27
WP_063164542.1|2115472_2116051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164543.1|2116052_2116694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164544.1|2116709_2117027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003668074.1|2117028_2117997_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_063164545.1|2118163_2118463_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_155724296.1|2119355_2119499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164546.1|2119988_2121263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164547.1|2121322_2121922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013923736.1|2122170_2123301_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	8.7e-35
WP_063164548.1|2123340_2123574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063164549.1|2123634_2124405_+	Fic family protein	NA	NA	NA	NA	NA
WP_063164550.1|2124627_2125155_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_003675685.1|2125157_2125472_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_016496718.1|2125780_2126668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016496719.1|2126657_2127686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675678.1|2127715_2128222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003675677.1|2128893_2129526_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003664009.1|2129742_2130051_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003664008.1|2130066_2130390_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003664006.1|2130415_2130697_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_003675674.1|2130822_2131530_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003675672.1|2131542_2132619_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_003675670.1|2132620_2133295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003663867.1|2133384_2133822_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003663865.1|2133823_2134240_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_063164551.1|2134370_2135231_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	41.3	1.5e-34
WP_003675664.1|2135223_2136561_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	34.3	4.1e-39
WP_003675663.1|2136562_2136844_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_003675661.1|2136862_2137735_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003668402.1|2137746_2138568_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_003675659.1|2138586_2139039_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003675657.1|2139054_2140734_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_063164262.1|2141169_2142306_-|transposase	IS30 family transposase	transposase	H7BW47	unidentified_phage	29.7	2.6e-26
WP_003663856.1|2142633_2143254_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	33.0	6.5e-24
WP_063164552.1|2143250_2143469_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_003675656.1|2143579_2144785_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.7	2.1e-42
WP_063164553.1|2144785_2147215_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_003675652.1|2147232_2148186_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	31.6	5.7e-11
