The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014621	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 chromosome, complete genome	4883499	1154688	1160492	4883499		Enterobacteria_phage(100.0%)	8	NA	NA
WP_021000674.1|1154688_1157022_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
WP_000743150.1|1157036_1157357_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001604623.1|1157353_1157581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243884.1|1157577_1158129_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_001604627.1|1158125_1158392_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_039500098.1|1158929_1159667_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	63.6	3.2e-78
WP_000984211.1|1159663_1159909_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|1159925_1160492_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 2
NZ_CP014621	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 chromosome, complete genome	4883499	1164031	1227126	4883499	tRNA,lysis,plate,terminase,tail,portal,capsid,head,integrase	Salmonella_phage(90.91%)	64	1163859:1163905	1198069:1198115
1163859:1163905	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_006493480.1|1164031_1165258_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	65.4	3.6e-151
WP_006493482.1|1165264_1166281_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.0	5.0e-191
WP_023136550.1|1166282_1166915_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	96.7	5.8e-113
WP_000102106.1|1167034_1167277_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_006493486.1|1167309_1167819_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	3.5e-84
WP_000794278.1|1167905_1168181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001528723.1|1168265_1168460_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	84.1	5.3e-25
WP_000963476.1|1168423_1168765_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	84.1	6.0e-48
WP_001178763.1|1168832_1169060_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	64.0	8.1e-17
WP_000785514.1|1169059_1169287_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	66.7	5.4e-21
WP_006493488.1|1169283_1170141_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	69.8	4.6e-113
WP_006493489.1|1170137_1172531_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	88.8	0.0e+00
WP_001749759.1|1172550_1172778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749760.1|1172915_1173104_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	91.7	5.7e-24
WP_006493490.1|1173434_1174637_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	37.1	5.6e-64
WP_006493491.1|1174599_1175517_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_006493493.1|1175563_1176598_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	94.8	4.1e-188
WP_006493495.1|1176597_1178364_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.6	0.0e+00
WP_006493498.1|1178506_1179340_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	97.1	1.1e-127
WP_000730754.1|1179356_1180424_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.0	2.8e-192
WP_000059169.1|1180427_1181078_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	98.6	1.6e-113
WP_000673541.1|1181171_1181636_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.8	7.9e-83
WP_000868184.1|1181635_1181839_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1181842_1182058_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_006493502.1|1182038_1182548_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.6	3.2e-93
WP_000871620.1|1182552_1182927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001648763.1|1182923_1183352_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	95.0	2.6e-64
WP_001039964.1|1183447_1183879_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	95.1	4.0e-73
WP_000343939.1|1183871_1184318_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.7	3.8e-66
WP_000993750.1|1184386_1184965_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.5e-107
WP_006493507.1|1184961_1185321_+|plate	baseplate assembly protein W	plate	E5G6N7	Salmonella_phage	92.4	6.3e-56
WP_006493508.1|1185307_1186216_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.7	7.2e-157
WP_001086802.1|1186208_1186814_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	1.1e-116
WP_023214802.1|1186810_1188619_+	Fels-2 prophage Pin	NA	A0A1B0V7G4	Salmonella_phage	82.2	7.3e-209
WP_001287104.1|1188625_1189033_+|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	85.2	6.7e-62
WP_006501158.1|1189036_1189654_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	84.1	1.6e-94
WP_077908780.1|1189623_1190469_-	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	84.4	1.1e-114
WP_006501163.1|1190438_1190996_+	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	98.9	9.4e-99
WP_006501164.1|1191098_1192271_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	3.7e-222
WP_001207653.1|1192280_1192796_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280962.1|1192850_1193153_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763316.1|1193167_1193287_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_006501165.1|1193279_1196087_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	98.3	0.0e+00
WP_000980409.1|1196083_1196569_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_006501166.1|1196565_1197666_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	95.6	9.0e-194
WP_000980498.1|1197734_1197953_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_072101134.1|1198504_1199668_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1198069:1198115	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_023244174.1|1199675_1201856_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_023243957.1|1201852_1203262_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_038389487.1|1203326_1214801_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1215420_1215903_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1216052_1216529_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1216518_1216809_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1216974_1217313_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001525072.1|1217461_1219123_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1219208_1220087_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1220209_1220800_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_023243603.1|1220834_1221440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1221560_1222847_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1222866_1223658_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1223823_1225185_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1225498_1225747_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1225765_1226314_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|1226358_1227126_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP014621	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 chromosome, complete genome	4883499	1717277	1726448	4883499	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1717277_1718225_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1718208_1718940_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1718920_1719028_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1719087_1719819_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|1720041_1721727_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|1721723_1722443_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1722489_1722957_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1723013_1723544_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1723715_1724174_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1724414_1726448_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP014621	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 chromosome, complete genome	4883499	1796672	1802969	4883499		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|1796672_1798076_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1798253_1799147_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1799523_1800609_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|1800608_1801508_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|1801555_1802434_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|1802438_1802969_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 5
NZ_CP014621	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 chromosome, complete genome	4883499	1910189	1921574	4883499	integrase	Stenotrophomonas_phage(25.0%)	12	1901479:1901493	1919146:1919160
1901479:1901493	attL	TTCCGTTGCGCTGCC	NA	NA	NA	NA
WP_023244267.1|1910189_1911452_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.3	1.5e-75
WP_023243861.1|1912097_1912388_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	1.8e-08
WP_000598920.1|1912759_1913557_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000500830.1|1914037_1914199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243860.1|1914325_1914745_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1914747_1916016_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1916470_1916683_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1916693_1916882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|1917141_1918335_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|1918983_1919295_+	hypothetical protein	NA	NA	NA	NA	NA
1919146:1919160	attR	GGCAGCGCAACGGAA	NA	NA	NA	NA
WP_023243859.1|1919374_1920070_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|1920143_1921574_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP014621	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 chromosome, complete genome	4883499	2024842	2084715	4883499	integrase,tail,head,lysis	Salmonella_phage(19.64%)	83	2072144:2072157	2087120:2087133
WP_000856224.1|2024842_2025073_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2025210_2025585_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|2025585_2026461_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2026477_2026831_+	YebY family protein	NA	NA	NA	NA	NA
WP_046722458.1|2027204_2028284_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	55.2	1.2e-105
WP_031603794.1|2028264_2028537_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.7	1.8e-10
WP_077944168.1|2028597_2028834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001524360.1|2029124_2029304_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	62.1	4.3e-13
WP_063267783.1|2029851_2030277_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	83.8	5.2e-65
WP_063267784.1|2030280_2030754_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.8	7.3e-68
WP_063267849.1|2030753_2031140_-	ead/Ea22-like family protein	NA	C6ZR30	Salmonella_phage	78.4	1.9e-37
WP_063267785.1|2031142_2031457_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	59.0	1.0e-33
WP_063267786.1|2031492_2032323_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_063267787.1|2032315_2035006_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	71.8	5.2e-118
WP_000799629.1|2035146_2035482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|2035557_2035764_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000103933.1|2035768_2036044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024135672.1|2036304_2036484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574209.1|2036914_2037313_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_001033909.1|2037411_2037666_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
WP_046722454.1|2037652_2038147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046722453.1|2038194_2039202_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	70.2	3.2e-129
WP_161490513.1|2039113_2039656_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	76.8	5.8e-69
WP_052909347.1|2039668_2040064_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	37.8	1.7e-17
WP_052909348.1|2040060_2040333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024150652.1|2040539_2040692_+	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_133177248.1|2040884_2041190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052909349.1|2041253_2041853_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.4	1.1e-97
WP_021000145.1|2041849_2042044_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
WP_000861020.1|2042040_2042322_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	1.7e-35
WP_042847930.1|2042318_2042873_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	64.6	2.8e-63
WP_023220365.1|2043118_2043295_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	60.3	1.2e-12
WP_052909352.1|2043345_2043753_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	62.2	4.0e-38
WP_001525456.1|2043902_2044205_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001525444.1|2044182_2044722_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	70.6	1.3e-76
WP_046722451.1|2044822_2045293_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	79.2	2.9e-61
WP_046722450.1|2045366_2045570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063267789.1|2045649_2046042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133177249.1|2046082_2046433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046722447.1|2046761_2046962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046722446.1|2046965_2047595_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.6	1.5e-108
WP_052909356.1|2047597_2049217_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	81.0	5.6e-261
WP_001525458.1|2049216_2050737_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.1	1.3e-105
WP_001525462.1|2050777_2051467_+|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.0	4.5e-58
WP_063267790.1|2051463_2052810_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.4	3.2e-68
WP_046722443.1|2052811_2053294_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	2.4e-26
WP_001031913.1|2053293_2054322_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_063267791.1|2054325_2054673_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	39.2	1.7e-10
WP_000537613.1|2054679_2055135_+	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	46.0	9.6e-17
WP_001525439.1|2055128_2055713_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	7.2e-17
WP_001048640.1|2055709_2056075_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	2.0e-20
WP_001525438.1|2056059_2056605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001525460.1|2056585_2058070_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	38.4	4.7e-89
WP_063267792.1|2058070_2058517_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	39.7	5.3e-20
WP_063267793.1|2058516_2058921_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	43.1	1.2e-18
WP_000386822.1|2058965_2059145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063267794.1|2059128_2061300_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_063267795.1|2061296_2062007_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	1.9e-27
WP_001525448.1|2062006_2062309_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_001525442.1|2062305_2063175_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	33.1	4.1e-32
WP_023219640.1|2063155_2063833_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	36.4	4.1e-32
WP_001191865.1|2063845_2064202_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_052909358.1|2064198_2065440_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	9.1e-102
WP_022742713.1|2065441_2066044_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
WP_063267796.1|2066033_2067494_+|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	76.3	2.7e-44
WP_078097279.1|2067994_2068315_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	85.8	9.3e-51
WP_001525039.1|2068304_2068874_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	85.7	1.1e-89
WP_046722438.1|2069024_2069879_+	protein YibB	NA	NA	NA	NA	NA
WP_046722437.1|2069951_2071493_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
2072144:2072157	attL	TTATAAATAAGCTA	NA	NA	NA	NA
WP_020438172.1|2072264_2073344_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|2073340_2074447_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|2074477_2074708_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|2074761_2075295_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|2075551_2075719_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2075783_2075972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063267797.1|2076026_2076518_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	1.6e-41
WP_023244117.1|2077070_2077667_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
WP_001751604.1|2079219_2079420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574229.1|2079987_2080113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848069.1|2081260_2081875_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000480735.1|2081884_2082043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|2082175_2083090_-	DMT family transporter	NA	NA	NA	NA	NA
WP_023244119.1|2084385_2084715_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	43.4	6.5e-15
2087120:2087133	attR	TAGCTTATTTATAA	NA	NA	NA	NA
>prophage 7
NZ_CP014621	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 chromosome, complete genome	4883499	2685207	2765637	4883499	integrase,tRNA,protease,plate,terminase,tail,portal,capsid,head,transposase,holin	Salmonella_phage(56.67%)	104	2705845:2705861	2765156:2765172
WP_023893413.1|2685207_2685726_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_000272239.1|2685722_2685830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460698.1|2686035_2686482_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_000579793.1|2686461_2687256_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000205341.1|2687356_2688541_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_001222527.1|2688659_2689007_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_000487135.1|2688992_2689304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000673492.1|2689372_2689624_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001589065.1|2689819_2689918_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_000512149.1|2690056_2690305_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_001532438.1|2690618_2691260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000513733.1|2691489_2691672_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_001248993.1|2691674_2692037_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457190.1|2692209_2692848_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_000617985.1|2693043_2693589_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000908466.1|2693671_2693827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000208086.1|2693905_2694154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000190263.1|2694408_2695257_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001682351.1|2695325_2695919_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000175797.1|2696063_2696852_-	cryptic aminoglycoside nucleotidyltransferase ANT(3'')/ANT(9)	NA	NA	NA	NA	NA
WP_001537483.1|2696959_2697607_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001183699.1|2697803_2698130_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_001618317.1|2698323_2699457_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000947459.1|2699538_2700129_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000950212.1|2700122_2700920_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	2.8e-11
WP_000966637.1|2700913_2701726_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001748353.1|2701715_2702690_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000946091.1|2702689_2704324_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000182479.1|2705005_2705320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929973.1|2705468_2705999_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
2705845:2705861	attL	CAGATAGCGCCCTAAAA	NA	NA	NA	NA
WP_021000256.1|2706081_2707125_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_001218120.1|2707463_2707931_-	Hsp20 family protein	NA	NA	NA	NA	NA
WP_000927827.1|2708083_2708356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000758947.1|2708555_2708681_-	lipoprotein	NA	NA	NA	NA	NA
WP_000977725.1|2709058_2709403_+	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_079007565.1|2709949_2710918_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	93.8	7.4e-176
WP_000789471.1|2711690_2712248_-	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	1.0e-15
WP_001535993.1|2713059_2713323_+	virulence protein PagD	NA	NA	NA	NA	NA
WP_001537306.1|2713454_2713667_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_001520581.1|2714081_2714603_+	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_000497451.1|2714793_2715033_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001033398.1|2715522_2716311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021000253.1|2717306_2718431_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_012218897.1|2718878_2719091_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
WP_000334550.1|2719344_2720016_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
WP_023171144.1|2720008_2721277_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	96.0	7.3e-240
WP_023171145.1|2721279_2721699_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	3.8e-36
WP_077909836.1|2722035_2722248_-	hypothetical protein	NA	A0A1B0V844	Salmonella_phage	62.9	9.3e-07
WP_023171148.1|2722372_2723506_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.0	1.6e-36
WP_023171149.1|2723543_2723756_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	60.9	1.6e-11
WP_094445164.1|2723745_2724351_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	93.1	1.4e-100
WP_023244258.1|2724320_2725574_-	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	95.6	4.6e-178
WP_023171039.1|2725560_2726148_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	99.0	1.4e-113
WP_023215805.1|2726150_2727230_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	1.2e-203
WP_000605051.1|2727222_2727636_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|2727640_2728174_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066631.1|2728173_2729232_-	hypothetical protein	NA	A0A192Y7L7	Salmonella_phage	99.7	6.6e-202
WP_023171041.1|2729228_2730569_-|tail	tail/DNA circulation protein	tail	A0A192Y5U9	Salmonella_phage	99.3	1.1e-249
WP_023171042.1|2730602_2732531_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	99.1	0.0e+00
WP_000588852.1|2732615_2732942_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2732938_2733295_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007994.1|2733294_2734791_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000497755.1|2734780_2734945_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	96.3	8.4e-24
WP_001241332.1|2734966_2735512_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	84.7	3.6e-87
WP_023171043.1|2735508_2736021_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.1	6.2e-81
WP_023171044.1|2735992_2736406_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.8	6.0e-50
WP_000886224.1|2736417_2736741_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	57.4	2.2e-31
WP_023232348.1|2736740_2736974_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.6e-10
WP_023171046.1|2737017_2738235_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	4.6e-199
WP_023171047.1|2738244_2739093_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.2	7.5e-132
WP_023171048.1|2739106_2740411_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.6	1.9e-219
WP_077909829.1|2740410_2742153_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.5	5.3e-140
WP_023171050.1|2742106_2742571_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.7e-48
WP_024147208.1|2742703_2743048_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	8.8e-47
WP_001070544.1|2743182_2743410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000495545.1|2743506_2743884_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	2.2e-43
WP_023171052.1|2743926_2744466_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	49.3	1.3e-07
WP_023171053.1|2744462_2745077_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	1.4e-108
WP_000250465.1|2745076_2745358_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	8.2e-19
WP_023171055.1|2745344_2745731_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	92.2	8.9e-56
WP_023171056.1|2745881_2746805_+	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	56.4	1.6e-42
WP_023171057.1|2746911_2747742_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	43.3	5.0e-56
WP_024147207.1|2747772_2748762_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.8	1.5e-192
WP_023171059.1|2748769_2749630_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	98.6	2.7e-161
WP_023171060.1|2749646_2750036_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	7.1e-69
WP_023171061.1|2750032_2750926_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.9	8.7e-163
WP_023171062.1|2750925_2751408_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.8	1.6e-86
WP_000104924.1|2751409_2752369_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.6e-117
WP_000620702.1|2752365_2752590_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_023244168.1|2752586_2753729_-	antirepressor	NA	A0A1C9IHV9	Salmonella_phage	87.4	6.3e-182
WP_000509731.1|2753725_2754280_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2754308_2754533_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|2754630_2755326_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000997190.1|2756140_2756512_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_023171064.1|2756569_2757397_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	98.5	4.1e-151
WP_000008351.1|2757533_2758073_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_023171066.1|2758874_2759348_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.8	2.1e-67
WP_000089141.1|2760108_2760345_+	excisionase	NA	NA	NA	NA	NA
WP_000741325.1|2760334_2761477_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000444509.1|2761590_2762841_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
WP_001249412.1|2763012_2763678_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000825957.1|2763674_2764004_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_023227248.1|2764015_2764477_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000004540.1|2764530_2765637_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2765156:2765172	attR	TTTTAGGGCGCTATCTG	NA	NA	NA	NA
>prophage 8
NZ_CP014621	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 chromosome, complete genome	4883499	3037181	3046263	4883499	protease,integrase	Ralstonia_phage(16.67%)	8	3035574:3035586	3054760:3054772
3035574:3035586	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_024155556.1|3037181_3038423_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|3038950_3039328_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|3039489_3039687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|3039899_3042176_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3042206_3042527_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3042850_3043072_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|3043201_3045148_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|3045144_3046263_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
3054760:3054772	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 9
NZ_CP014621	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 chromosome, complete genome	4883499	3404375	3444023	4883499	protease,tail,portal,coat,integrase	Salmonella_phage(47.27%)	60	3402793:3402810	3449425:3449442
3402793:3402810	attL	CCGCATAGCCCCGCCAGT	NA	NA	NA	NA
WP_052909395.1|3404375_3406298_+	acyltransferase	NA	C6ZR20	Salmonella_phage	99.5	0.0e+00
WP_072106194.1|3406643_3408761_-|tail	phage tail protein	tail	C6ZR19	Salmonella_phage	99.3	0.0e+00
WP_052909394.1|3408916_3410887_-	hypothetical protein	NA	C6ZR18	Salmonella_phage	99.1	0.0e+00
WP_052909416.1|3410886_3412209_-	phage DNA ejection protein	NA	C6ZR17	Salmonella_phage	96.8	8.2e-234
WP_052909393.1|3412251_3412941_-	hypothetical protein	NA	B9UDK9	Salmonella_phage	91.7	8.1e-92
WP_052909392.1|3412943_3413399_-	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	98.7	1.1e-86
WP_052909391.1|3413398_3414100_-	hypothetical protein	NA	C6ZR14	Salmonella_phage	94.0	6.1e-71
WP_052909390.1|3414103_3415522_-	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.1	1.1e-271
WP_023223387.1|3415481_3415982_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	99.4	4.2e-90
WP_052909389.1|3415965_3416175_-	hypothetical protein	NA	A0A192Y697	Salmonella_phage	88.4	1.7e-29
WP_052909388.1|3416213_3417509_-|coat	coat protein	coat	A0A0M5M1J5	Salmonella_phage	99.8	2.2e-244
WP_052909387.1|3417508_3418420_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	99.7	6.3e-161
WP_052909386.1|3418433_3420611_-|portal	portal protein	portal	Q5C835	Enterobacteria_phage	99.3	0.0e+00
WP_046722394.1|3420610_3422059_-	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	71.3	2.7e-206
WP_045718261.1|3422027_3422531_-	hypothetical protein	NA	A0A2K8HN72	Pseudomonas_phage	47.8	7.3e-26
WP_046722393.1|3422543_3422948_-	hypothetical protein	NA	C6ZR73	Salmonella_phage	98.5	2.0e-66
WP_046722392.1|3422947_3423337_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	98.4	4.3e-74
WP_052909385.1|3423340_3423583_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	98.8	1.1e-32
WP_046722391.1|3423933_3424422_-	GIY-YIG nuclease family protein	NA	K7P7S3	Enterobacteria_phage	96.9	3.4e-84
WP_000182933.1|3424784_3425072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052909415.1|3425295_3425763_-	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	45.8	1.1e-28
WP_024133454.1|3425737_3425965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235461.1|3426408_3427032_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000994516.1|3427028_3427217_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008200.1|3427213_3427576_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_052909383.1|3427572_3427863_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	99.0	6.5e-51
WP_001549091.1|3427855_3428068_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	98.6	1.1e-34
WP_000950973.1|3428060_3428237_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	5.7e-26
WP_052909382.1|3428229_3428580_-	DUF2591 family protein	NA	A0A2D1GLI3	Escherichia_phage	69.5	4.0e-39
WP_000113767.1|3428582_3428759_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	98.3	7.9e-28
WP_000679699.1|3428725_3428899_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	93.0	7.0e-29
WP_001629218.1|3428895_3429768_-	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	93.1	6.7e-168
WP_052909414.1|3429764_3430205_-	recombination protein NinB	NA	A0A2I6PIF6	Escherichia_phage	95.9	4.0e-76
WP_052909381.1|3430352_3430619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052909380.1|3430605_3430836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052909379.1|3430832_3432206_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	96.3	2.0e-243
WP_052909378.1|3432202_3433036_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	98.6	7.9e-150
WP_001125981.1|3433028_3433175_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000424166.1|3433209_3433488_-	transcriptional regulator	NA	A0A220NRS4	Escherichia_phage	93.5	2.2e-40
WP_000067726.1|3433595_3433811_-	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_023177700.1|3433929_3434592_+	LexA family transcriptional regulator	NA	Q37946	Enterobacteria_phage	100.0	6.3e-126
WP_125866875.1|3434946_3435129_+	hypothetical protein	NA	A0A220NQW5	Salmonella_phage	96.7	6.3e-28
WP_052909377.1|3435149_3435482_+	hypothetical protein	NA	A0A1R3Y5R1	Salmonella_virus	95.5	1.3e-52
WP_052909376.1|3435492_3435807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052909375.1|3435850_3436096_+	hypothetical protein	NA	U5PUY0	Salmonella_phage	62.3	1.9e-19
WP_052909374.1|3436132_3436420_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	96.8	8.6e-48
WP_006831706.1|3436749_3436908_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	98.1	1.2e-22
WP_000156731.1|3436888_3437077_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_046722386.1|3437066_3437210_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	95.7	2.1e-18
WP_046722385.1|3437206_3437914_+	recombinase	NA	I6R0N0	Salmonella_phage	99.1	1.3e-137
WP_046722384.1|3437914_3438421_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	98.8	6.5e-91
WP_001016182.1|3438429_3438978_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	100.0	2.1e-106
WP_015995298.1|3438993_3439287_+	DUF2856 family protein	NA	C6ZR34	Salmonella_phage	100.0	1.9e-50
WP_071892267.1|3439297_3439468_+	DUF2737 family protein	NA	A0A220NQV6	Salmonella_phage	98.2	3.0e-24
WP_116585787.1|3439464_3440055_+	Eae-like protein	NA	Q5G8U6	Enterobacteria_phage	51.0	2.5e-25
WP_071892271.1|3440051_3440861_+	ead/Ea22-like family protein	NA	Q1MVF9	Enterobacteria_phage	97.9	4.1e-103
WP_001229203.1|3440862_3441378_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	100.0	2.4e-101
WP_052909373.1|3441374_3441926_+	DUF551 domain-containing protein	NA	G9L6G3	Escherichia_phage	72.0	1.0e-65
WP_052909372.1|3441994_3442630_+	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	87.7	1.8e-106
WP_052909371.1|3442859_3444023_+|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	96.9	2.2e-222
3449425:3449442	attR	CCGCATAGCCCCGCCAGT	NA	NA	NA	NA
>prophage 10
NZ_CP014621	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 chromosome, complete genome	4883499	3687587	3735050	4883499	integrase,lysis,terminase,tail,head,transposase,holin	Salmonella_phage(57.45%)	57	3689185:3689203	3731158:3731176
WP_095470817.1|3687587_3688749_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.3	3.6e-52
WP_023242996.1|3688746_3689022_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.4e-23
3689185:3689203	attL	ATGGTGCCGATAATAGGAG	NA	NA	NA	NA
WP_020898636.1|3689752_3690490_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000143174.1|3690685_3691261_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	91.0	1.5e-96
WP_000049936.1|3692792_3693473_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	8.1e-129
WP_063267817.1|3693469_3694669_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	97.2	1.1e-213
WP_001270643.1|3694669_3695023_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	97.4	2.1e-59
WP_000301076.1|3695022_3695775_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	71.7	1.2e-93
WP_023135366.1|3695997_3696363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063267818.1|3696382_3696715_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	70.9	2.9e-23
WP_063267819.1|3696711_3697785_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	95.8	1.3e-184
WP_063267820.1|3697787_3698090_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	99.0	1.2e-52
WP_000353826.1|3698089_3698665_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_063267821.1|3698664_3700674_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	99.7	0.0e+00
WP_000389018.1|3700851_3701304_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	100.0	5.1e-79
WP_000501635.1|3701307_3701748_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	100.0	9.4e-78
WP_063267822.1|3701758_3702910_-	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	99.7	9.6e-215
WP_057935452.1|3702912_3703479_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	98.9	8.9e-105
WP_001142474.1|3703453_3703843_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	97.7	6.0e-68
WP_000008736.1|3703829_3704384_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	1.8e-94
WP_001125677.1|3704380_3704788_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	1.0e-70
WP_001040702.1|3704753_3705122_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
WP_063267823.1|3705163_3706105_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	99.7	9.1e-179
WP_000128057.1|3706116_3706614_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000873159.1|3706618_3707851_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.5	1.6e-228
WP_138010671.1|3707865_3708603_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	88.1	7.8e-101
WP_063267824.1|3708487_3709957_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	2.2e-280
WP_063267825.1|3709956_3711579_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	98.7	0.0e+00
WP_063267826.1|3711581_3712154_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	68.5	1.0e-60
WP_063267827.1|3712174_3712663_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	91.9	4.5e-73
WP_063267828.1|3712659_3713274_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	83.8	5.3e-95
WP_020844532.1|3713273_3713555_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	79.3	8.2e-35
WP_001294874.1|3713541_3713931_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000658039.1|3714020_3714209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001244502.1|3714794_3715229_-	antitermination protein Q	NA	B6SD39	Bacteriophage	58.9	4.5e-40
WP_063267829.1|3715517_3717704_-	replication protein	NA	B6SCY1	Bacteriophage	71.5	1.6e-173
WP_000170999.1|3717707_3717920_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	6.0e-06
WP_000049987.1|3718040_3718664_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	45.3	1.1e-36
WP_023135388.1|3719207_3719732_+	hypothetical protein	NA	C9EH97	Sodalis_phage	48.8	8.4e-41
WP_063267830.1|3719990_3720893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063267831.1|3720895_3722197_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.4	1.6e-133
WP_063267832.1|3722211_3722760_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	64.8	3.5e-66
WP_063267833.1|3722809_3723448_+	hypothetical protein	NA	H6WRY3	Salmonella_phage	71.0	2.0e-76
WP_063267834.1|3723522_3725589_+	DNA polymerase	NA	Q775A3	Bordetella_phage	67.8	2.8e-273
WP_000077590.1|3725593_3725806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000873865.1|3725802_3726006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000007248.1|3726016_3726232_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063267835.1|3726232_3726712_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	6.7e-69
WP_063267836.1|3726714_3727023_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	64.7	2.2e-25
WP_109208487.1|3726980_3727736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070075.1|3727772_3729173_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.4	6.0e-211
WP_000189281.1|3729169_3729358_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001046411.1|3729364_3729832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000772661.1|3729832_3731005_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	49.0	5.0e-110
WP_023242995.1|3731349_3732600_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
3731158:3731176	attR	ATGGTGCCGATAATAGGAG	NA	NA	NA	NA
WP_001285275.1|3732611_3733715_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3733997_3735050_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
>prophage 11
NZ_CP014621	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 chromosome, complete genome	4883499	4211546	4220494	4883499	integrase,capsid	Enterobacteria_phage(83.33%)	12	4208770:4208786	4220664:4220680
4208770:4208786	attL	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
WP_000783715.1|4211546_4213880_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	85.3	0.0e+00
WP_000743145.1|4213894_4214215_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216597.1|4214211_4214439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979749.1|4214435_4214987_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.5	1.2e-29
WP_000556587.1|4214983_4215250_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_162491381.1|4215354_4215483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075207146.1|4215724_4216534_+|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_000468231.1|4216537_4216777_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	2.4e-19
WP_000214429.1|4216792_4217359_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	7.9e-61
WP_000775190.1|4217797_4218739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957221.1|4218747_4219203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772664.1|4219225_4220494_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	5.7e-75
4220664:4220680	attR	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
>prophage 12
NZ_CP014621	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 chromosome, complete genome	4883499	4471226	4515283	4883499	tRNA,protease,plate,terminase,tail,portal,capsid,head,integrase,holin	Shigella_phage(46.3%)	60	4473360:4473375	4476766:4476781
WP_000918353.1|4471226_4472642_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_000235555.1|4472706_4473690_+	quinone oxidoreductase	NA	NA	NA	NA	NA
4473360:4473375	attL	GAAAGATACCTGGGAA	NA	NA	NA	NA
WP_000891414.1|4473864_4474107_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_052934728.1|4474274_4475312_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332264.1|4475400_4476498_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_001217553.1|4476559_4476808_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
4476766:4476781	attR	GAAAGATACCTGGGAA	NA	NA	NA	NA
WP_000639149.1|4476951_4477515_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_006678262.1|4477840_4478569_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	100.0	2.8e-143
WP_001747940.1|4478570_4478978_+|tail	tail assembly chaperone	tail	A0A1B0V844	Salmonella_phage	100.0	4.9e-73
WP_006678265.1|4478981_4479599_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	100.0	5.7e-113
WP_023200332.1|4479568_4481101_-	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	97.9	1.6e-241
WP_000383548.1|4481104_4481689_-	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_022630974.1|4481679_4482738_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
WP_000424732.1|4482724_4483150_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_022630975.1|4483149_4483698_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	1.9e-96
WP_000999499.1|4483697_4484777_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.7	5.3e-207
WP_000219913.1|4484773_4486102_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_001439754.1|4486192_4486705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023200330.1|4486786_4488619_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.2	4.7e-304
WP_000661047.1|4488760_4489030_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|4489029_4489386_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_022630977.1|4489385_4490882_-|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
WP_000497751.1|4490865_4491036_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779279.1|4491044_4491605_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_022630978.1|4491601_4492108_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	5.0e-91
WP_000702388.1|4492082_4492493_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000927719.1|4492489_4492813_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_021577001.1|4492787_4493015_-	hypothetical protein	NA	S5FNU1	Shigella_phage	94.9	2.2e-22
WP_021567480.1|4493064_4494270_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	3.5e-223
WP_021578635.1|4494284_4494935_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	3.6e-118
WP_001514795.1|4494912_4496154_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.0e-241
WP_000605606.1|4496153_4496336_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000088161.1|4496347_4498081_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	0.0e+00
WP_000929174.1|4498094_4498580_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	99.4	2.1e-86
WP_023200328.1|4498705_4499056_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.0	2.9e-61
WP_023259402.1|4499509_4499902_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	86.0	1.2e-52
WP_023200327.1|4499885_4500362_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	97.5	1.4e-87
WP_023200326.1|4500365_4500701_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	92.8	2.1e-53
WP_001306866.1|4500838_4501081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023200325.1|4501369_4502122_-	antitermination protein	NA	Q8SBE4	Shigella_phage	99.2	1.1e-137
WP_012513026.1|4502135_4503125_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	8.9e-193
WP_001061375.1|4503132_4503930_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	1.3e-149
WP_000767130.1|4503949_4504339_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_000210148.1|4504335_4504662_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.0e-52
WP_000066917.1|4504658_4505312_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000054957.1|4505406_4506399_-	hypothetical protein	NA	U5P0A0	Shigella_phage	98.2	1.2e-93
WP_001250270.1|4506355_4506568_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_000514174.1|4506743_4507328_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001231956.1|4507355_4507553_-	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000981537.1|4507648_4508302_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_072104153.1|4508573_4509122_+	hypothetical protein	NA	U5P4J6	Shigella_phage	97.3	2.3e-97
WP_000081266.1|4509187_4510012_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	2.3e-149
WP_000008249.1|4510140_4510677_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	4.8e-100
WP_023200800.1|4510667_4511546_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	92.5	1.8e-165
WP_023200799.1|4511542_4512016_+	ead/Ea22-like family protein	NA	K7PJQ4	Enterobacteria_phage	70.1	1.2e-59
WP_000212745.1|4512017_4512305_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	98.9	3.5e-49
WP_024146004.1|4513319_4513892_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	99.5	7.1e-110
WP_001093914.1|4513928_4514201_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	96.6	5.7e-41
WP_000900143.1|4514234_4514696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001535325.1|4514701_4515283_-	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.6	8.8e-07
>prophage 13
NZ_CP014621	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 chromosome, complete genome	4883499	4541113	4559268	4883499	plate,tail	Burkholderia_phage(45.0%)	23	NA	NA
WP_000615248.1|4541113_4541461_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|4542036_4542324_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|4542326_4542932_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|4542944_4543259_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4543418_4543874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|4543870_4544068_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_063177174.1|4544057_4545485_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	3.1e-194
WP_000907495.1|4545484_4546009_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4546060_4546378_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4546337_4546466_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|4546562_4548917_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|4548916_4549870_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4549869_4550079_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|4550066_4551110_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|4551119_4551842_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4552169_4552532_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|4552528_4553458_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|4553457_4555005_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|4555168_4555528_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|4555518_4556634_+	bacteriophage protein	NA	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|4556626_4557259_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|4557261_4558743_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_023244443.1|4558752_4559268_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	1.3e-33
