The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	10250	44489	5688984	tRNA,tail,plate	Salmonella_phage(34.78%)	38	NA	NA
WP_011144421.1|10250_10472_-	Ogr protein	NA	Q53ZE7	Salmonella_virus	69.4	1.1e-18
WP_011144422.1|10548_11634_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	60.2	1.8e-117
WP_011144423.1|11630_12095_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	65.9	2.6e-46
WP_109791220.1|12097_14536_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	32.5	1.6e-86
WP_071824073.1|14516_14639_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	66.7	5.7e-09
WP_011144426.1|14650_14968_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	52.7	2.0e-21
WP_011144427.1|14994_15510_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	64.0	1.3e-57
WP_011144428.1|15520_16693_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	75.3	7.4e-170
WP_011144431.1|17677_18208_+|tail	tail fiber assembly protein	tail	A0A0A7NRZ7	Enterobacteria_phage	44.6	2.6e-34
WP_071824074.1|18287_18380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791221.1|18437_19037_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	45.2	1.1e-41
WP_011144433.1|19033_19522_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	46.1	5.8e-28
WP_011144434.1|19521_20649_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	53.6	3.1e-93
WP_011144435.1|20645_21260_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	64.8	8.8e-74
WP_011144436.1|21252_22251_-|plate	phage baseplate protein	plate	A0A0F7LCJ3	Escherichia_phage	56.4	3.1e-84
WP_011144437.1|22255_22597_-|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	59.1	1.6e-29
WP_011144438.1|22596_23439_-|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	39.5	1.8e-40
WP_011144439.1|23935_24139_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	70.1	2.0e-22
WP_164488458.1|24421_24586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791928.1|24982_25597_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	42.9	1.9e-44
WP_011144442.1|25879_26452_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	67.9	2.0e-67
WP_011144445.1|27551_27893_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	62.1	6.5e-10
WP_049789712.1|28943_29987_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	44.3	9.9e-25
WP_011144448.1|30413_30554_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_011144449.1|30573_30828_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011144450.1|30976_32806_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.6	1.8e-130
WP_109791222.1|32913_34287_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.8	4.8e-35
WP_011144452.1|34415_34838_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_011144453.1|34859_36242_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_011144454.1|36276_37140_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_011144455.1|37198_38740_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_011144456.1|38754_39288_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_011144457.1|39300_39771_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_000429386.1|39829_40069_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_011144458.1|40122_40947_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_011144459.1|40977_41355_-	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_011144460.1|41965_42586_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_109791223.1|42599_44489_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	276873	350542	5688984	tRNA,transposase,integrase	Planktothrix_phage(22.22%)	60	267601:267630	298356:298385
267601:267630	attL	ATATACCCTATGGATTTCAAGATGCATCGC	NA	NA	NA	NA
WP_011144659.1|276873_277440_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.4	2.3e-52
WP_011144660.1|277865_278471_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_109791261.1|278597_279338_+	molecular chaperone	NA	NA	NA	NA	NA
WP_011144662.1|279375_279948_+	fimbrial protein	NA	NA	NA	NA	NA
WP_109791262.1|280015_280738_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_109791263.1|280788_281484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011144665.1|281564_282284_+	molecular chaperone	NA	NA	NA	NA	NA
WP_109791264.1|282320_283115_+	molecular chaperone	NA	NA	NA	NA	NA
WP_109791935.1|283298_285929_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_109791265.1|286046_287423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791266.1|287554_288055_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_109791267.1|288090_288561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011144671.1|288492_290610_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.2	9.7e-11
WP_011144672.1|290627_290903_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011144673.1|290957_291581_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.6e-20
WP_157852133.1|291716_291872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791268.1|292281_293577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791269.1|293813_295037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791270.1|295803_296493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791937.1|297030_297771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791271.1|299122_299797_-	hypothetical protein	NA	NA	NA	NA	NA
298356:298385	attR	GCGATGCATCTTGAAATCCATAGGGTATAT	NA	NA	NA	NA
WP_011144681.1|300774_301053_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	41.4	2.9e-08
WP_011144682.1|301355_301673_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
WP_011144683.1|301669_302125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791273.1|302776_304519_+	NAD-dependent DNA ligase LigB	NA	G3M9X7	Bacillus_virus	22.6	9.7e-25
WP_011144685.1|304512_305130_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_011144686.1|305263_306553_+	DUF3748 domain-containing protein	NA	NA	NA	NA	NA
WP_011144687.1|306615_306936_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_011144689.1|307823_309077_-	valine--pyruvate transaminase	NA	NA	NA	NA	NA
WP_041379871.1|309282_309840_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_011144691.1|310051_310966_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_109791274.1|310975_313045_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_011144693.1|313662_314886_-	cytochrome P450, cyclodipeptide synthase-associated	NA	NA	NA	NA	NA
WP_109791275.1|314971_315676_-|tRNA	tRNA-dependent cyclodipeptide synthase	tRNA	NA	NA	NA	NA
WP_011144696.1|316426_317347_+	EamA family transporter	NA	NA	NA	NA	NA
WP_011144697.1|317949_319557_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011144698.1|319675_320695_+	dipeptide ABC transporter permease DppB	NA	NA	NA	NA	NA
WP_011144699.1|320705_321605_+	dipeptide ABC transporter permease DppC	NA	NA	NA	NA	NA
WP_011144700.1|321617_322598_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	4.3e-14
WP_011144701.1|322594_323614_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	8.5e-21
WP_041379873.1|323976_324684_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_011144703.1|324862_326353_+	insulinase family protein	NA	NA	NA	NA	NA
WP_011144704.1|326396_326603_-	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_011144705.1|326658_327651_-	inner membrane protein YhjD	NA	NA	NA	NA	NA
WP_011144706.1|327801_327993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041379874.1|328178_329210_-|transposase	IS630-like element ISPlu8 family transposase	transposase	NA	NA	NA	NA
WP_011144708.1|329631_331026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011144709.1|331173_331629_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	36.8	6.2e-16
WP_011144710.1|333296_333845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791277.1|334183_338626_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_109791278.1|338691_340359_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_109791279.1|341027_341621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144714.1|341867_343484_-|transposase	IS1634-like element ISPlu4 family transposase	transposase	NA	NA	NA	NA
WP_109791280.1|343905_344634_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011144717.1|345586_345784_+	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	51.9	1.9e-09
WP_041379878.1|347037_347421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144720.1|347482_348508_+|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011144721.1|349026_349419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303148.1|349428_349590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144722.1|349657_350542_-|transposase	IS982-like element ISPlu11 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	354505	416543	5688984	transposase,plate	Burkholderia_phage(37.5%)	44	NA	NA
WP_011144727.1|354505_355888_-|transposase	IS4-like element ISPlu9 family transposase	transposase	Q9JMP3	Wolbachia_phage	28.1	2.9e-40
WP_109791282.1|356887_360433_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011144731.1|361214_362651_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	48.9	7.0e-106
WP_011144732.1|362658_363132_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	42.9	3.4e-33
WP_109791938.1|363341_364649_+	MvaI/BcnI restriction endonuclease family protein	NA	NA	NA	NA	NA
WP_011144734.1|364726_365077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144735.1|365250_365721_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_011144720.1|367329_368355_+|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011144738.1|368553_369261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058588885.1|369567_369969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144740.1|370265_370646_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_011144742.1|370936_371134_+	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	50.0	1.6e-08
WP_011144743.1|371237_371789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144744.1|372356_372677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144746.1|377113_377533_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_011144747.1|377580_379476_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	8.6e-27
WP_011144727.1|380264_381647_+|transposase	IS4-like element ISPlu9 family transposase	transposase	Q9JMP3	Wolbachia_phage	28.1	2.9e-40
WP_109791283.1|382430_385976_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011144749.1|385972_387406_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_011144750.1|387411_388059_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_011144751.1|388055_388856_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_109791284.1|388852_391498_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.6	4.3e-93
WP_011144753.1|391508_392279_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011144754.1|392278_393631_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_109791285.1|393633_394200_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011144756.1|394199_395486_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_041379883.1|395491_396544_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011144758.1|396507_398355_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011144759.1|398356_398797_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011144760.1|398803_400282_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011144761.1|400305_400803_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011144762.1|401703_402222_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_011144763.1|402860_403703_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_109791286.1|403813_405169_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_011144765.1|405434_406523_+	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_011144766.1|406519_408172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011144767.1|408252_408771_-	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_162096545.1|408767_409361_-	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_011144769.1|409575_410568_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_011144770.1|410588_411212_+	thiol:disulfide interchange protein DsbA	NA	NA	NA	NA	NA
WP_041379885.1|411367_412531_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_011144772.1|412509_415137_-	histidinol-phosphatase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	23.3	6.3e-20
WP_011144773.1|415164_415404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144774.1|415529_416543_+|transposase	IS630-like element ISPlu10 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	1054824	1065802	5688984		Sodalis_phage(80.0%)	11	NA	NA
WP_109791354.1|1054824_1056006_+	cysteine desulfurase	NA	H7BUW1	unidentified_phage	39.9	1.3e-36
WP_011145281.1|1056028_1057222_+	MFS transporter	NA	NA	NA	NA	NA
WP_125026268.1|1057784_1057994_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	63.8	8.0e-19
WP_011145283.1|1058314_1059037_-	PAS and helix-turn-helix domain-containing protein	NA	Q2A088	Sodalis_phage	32.6	2.2e-15
WP_011145284.1|1059197_1059920_-	PAS domain-containing protein	NA	Q2A088	Sodalis_phage	35.3	2.0e-16
WP_109791355.1|1060241_1060964_-	PAS and helix-turn-helix domain-containing protein	NA	Q2A088	Sodalis_phage	30.5	4.9e-15
WP_011145286.1|1061264_1061987_-	PAS and helix-turn-helix domain-containing protein	NA	Q2A088	Sodalis_phage	32.6	9.9e-16
WP_109791947.1|1062304_1063027_-	PAS and helix-turn-helix domain-containing protein	NA	Q2A088	Sodalis_phage	30.3	1.1e-17
WP_109791356.1|1063312_1064035_-	PAS and helix-turn-helix domain-containing protein	NA	Q2A088	Sodalis_phage	31.2	2.4e-14
WP_109791948.1|1064196_1064919_-	PAS and helix-turn-helix domain-containing protein	NA	Q2A088	Sodalis_phage	33.3	2.2e-15
WP_109791357.1|1065079_1065802_-	PAS and helix-turn-helix domain-containing protein	NA	Q2A088	Sodalis_phage	28.8	5.8e-16
>prophage 5
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	1203814	1240735	5688984	transposase,integrase	Shigella_phage(33.33%)	37	1202704:1202718	1239097:1239111
1202704:1202718	attL	CGGATGAGCCAGTCA	NA	NA	NA	NA
WP_011145380.1|1203814_1204003_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157866895.1|1204060_1204360_+|transposase	transposase	transposase	Q716C1	Shigella_phage	75.5	7.7e-31
WP_049789744.1|1204374_1205214_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	68.5	3.9e-96
WP_011145383.1|1205149_1206061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041379950.1|1206170_1206359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791377.1|1206368_1207412_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_157866896.1|1207397_1207538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041379951.1|1208135_1209653_+	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011145387.1|1209730_1210732_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011145388.1|1211266_1212151_+	ParA family protein	NA	NA	NA	NA	NA
WP_011145389.1|1212143_1213523_+	replicative DNA helicase	NA	O80281	Escherichia_phage	51.7	7.5e-113
WP_011145390.1|1213519_1215250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011145391.1|1215242_1215494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011145392.1|1215557_1216148_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_041379952.1|1216144_1216408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791378.1|1216391_1217660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011145394.1|1217928_1218627_+	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011145395.1|1218630_1220661_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	27.1	1.3e-36
WP_011145396.1|1221320_1221779_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_011145397.1|1221852_1222317_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	71.7	2.6e-46
WP_109791951.1|1222842_1223049_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011145399.1|1223041_1223710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145400.1|1223696_1224584_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_011145401.1|1224596_1225490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145407.1|1227924_1228974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011145408.1|1228980_1229418_+	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_109791952.1|1229544_1231140_+	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_011145410.1|1231163_1232480_+	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_049789746.1|1232466_1232952_+	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_011145412.1|1232965_1234519_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_011145413.1|1234511_1235597_+	pilus biosynthesis protein PilR	NA	NA	NA	NA	NA
WP_011145414.1|1235665_1236268_+	type IV prepilin	NA	NA	NA	NA	NA
WP_011145415.1|1236268_1236934_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_109791380.1|1236999_1238178_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_049789715.1|1238471_1238837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011144475.1|1238830_1239166_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
1239097:1239111	attR	TGACTGGCTCATCCG	NA	NA	NA	NA
WP_011145417.1|1239229_1240735_+|transposase	IS66-like element ISPlu20 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.5	1.3e-89
>prophage 6
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	1492597	1503443	5688984		Mycobacterium_phage(25.0%)	12	NA	NA
WP_109791395.1|1492597_1493797_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.7	2.0e-29
WP_109791396.1|1494394_1495354_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	70.5	3.3e-128
WP_109791397.1|1495374_1497504_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A0D3MSW9	Lactococcus_phage	51.9	2.5e-208
WP_041380729.1|1497506_1497923_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	40.3	6.3e-15
WP_011145611.1|1497936_1498167_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	48.6	7.7e-15
WP_011145612.1|1498498_1498960_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_041379980.1|1499178_1499388_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	7.7e-22
WP_011145614.1|1499464_1499839_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.5	3.4e-20
WP_011145615.1|1499978_1500944_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_041379981.1|1501054_1501696_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011145617.1|1501827_1502091_-	YbeD family protein	NA	NA	NA	NA	NA
WP_041380730.1|1502231_1503443_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.7	4.5e-106
>prophage 7
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	1893984	2041677	5688984	tail,tRNA,transposase,protease	Sodalis_phage(10.81%)	111	NA	NA
WP_011145885.1|1893984_1894713_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.8	1.7e-31
WP_011145886.1|1895016_1895916_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_011145887.1|1896236_1897349_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	33.6	8.4e-06
WP_011145888.1|1897348_1899292_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.3	1.3e-38
WP_011145889.1|1899372_1899594_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	1.1e-15
WP_011145890.1|1899936_1900257_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.6	1.4e-14
WP_011145891.1|1900289_1902566_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	3.1e-164
WP_002211347.1|1902665_1902884_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_041380764.1|1903040_1903733_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_011145893.1|1903739_1905488_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A1V0SJ29	Klosneuvirus	34.2	5.2e-18
WP_011145894.1|1905490_1907260_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	1.3e-24
WP_011145895.1|1907394_1908354_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.3	6.4e-63
WP_011145896.1|1908852_1909347_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_011145897.1|1909477_1912912_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.5	3.2e-88
WP_011145898.1|1913130_1913742_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011145899.1|1913749_1915093_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.0	2.6e-78
WP_011145900.1|1915324_1916614_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.9	1.2e-96
WP_109791434.1|1916709_1917480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144714.1|1917586_1919203_+|transposase	IS1634-like element ISPlu4 family transposase	transposase	NA	NA	NA	NA
WP_049789764.1|1921115_1921718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145223.1|1922232_1923201_-|transposase	IS30-like element ISPlu1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	5.3e-41
WP_082303118.1|1923684_1923987_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_109791435.1|1924464_1925403_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.8	4.8e-63
WP_011145904.1|1925819_1926560_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	4.7e-21
WP_109791437.1|1926633_1928916_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	3.9e-159
WP_011145906.1|1928971_1929829_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_041380020.1|1930148_1931912_-	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_011145908.1|1932050_1933094_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_011145909.1|1933263_1933539_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_109791438.1|1933535_1934039_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058588493.1|1934210_1935299_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.6	1.8e-85
WP_058588494.1|1935548_1936835_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_011145913.1|1937139_1937823_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_011145914.1|1938004_1939678_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_011145915.1|1939743_1940028_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	41.1	3.7e-11
WP_011145916.1|1940991_1941891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145917.1|1941954_1942113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145918.1|1942623_1943259_-	LysE family translocator	NA	NA	NA	NA	NA
WP_109791440.1|1943263_1944085_-	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_011145920.1|1944984_1947312_+	ComEC family protein	NA	NA	NA	NA	NA
WP_041380022.1|1947347_1949096_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	32.1	1.0e-66
WP_011145922.1|1949092_1950088_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_036781154.1|1950669_1950885_+	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	46.8	1.3e-08
WP_011145924.1|1951263_1951443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791441.1|1951446_1952196_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_109791442.1|1952424_1953264_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_011145927.1|1953542_1954322_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_011145928.1|1954332_1955655_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_041380024.1|1955635_1956358_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_109791444.1|1956354_1960803_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_011145931.1|1961110_1961794_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_011145932.1|1961832_1962453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145933.1|1962696_1962936_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_011145934.1|1963082_1964045_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	62.7	4.8e-82
WP_109791445.1|1964438_1965239_-	photopexin B	NA	NA	NA	NA	NA
WP_011144786.1|1965346_1966231_-|transposase	IS982-like element ISPlu6 family transposase	transposase	NA	NA	NA	NA
WP_011145935.1|1966540_1967338_-|tail	tail fiber protein	tail	F2Y385	Organic_Lake_phycodnavirus	28.5	6.2e-11
WP_011145938.1|1969767_1970754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145939.1|1970858_1971761_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_011145940.1|1971784_1973884_-	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	33.6	1.3e-07
WP_011145941.1|1973893_1975858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145942.1|1975921_1977139_-|tail	tail fiber protein	tail	F2Y385	Organic_Lake_phycodnavirus	25.1	2.0e-05
WP_109791446.1|1977248_1980602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791447.1|1980598_1983307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145945.1|1983349_1983766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145946.1|1983762_1984254_-	GPW/gp25 family protein	NA	M4SKQ1	Cyanophage	28.8	9.7e-07
WP_109791448.1|1984266_1985868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791449.1|1985864_1986548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145949.1|1986534_1986714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145950.1|1986710_1987169_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011145951.1|1987182_1988418_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_109791450.1|1988465_1989899_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011145953.1|1989910_1990993_-|tail	phage tail sheath family protein	tail	D5LGY7	Escherichia_phage	27.0	7.4e-07
WP_011145954.1|1991046_1991496_-|tail	phage tail protein	tail	A0A1J0GW41	Streptomyces_phage	28.2	9.8e-06
WP_011145956.1|1992244_1993171_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	61.4	3.9e-81
WP_082302904.1|1993271_1993568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145957.1|1993598_1994573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145959.1|1996911_1998996_-	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	34.5	9.8e-08
WP_011145960.1|1999005_2000685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145961.1|2000741_2001773_-|tail	tail fiber protein	tail	R4TQ39	Phaeocystis_globosa_virus	35.0	1.8e-07
WP_011145962.1|2001915_2004795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791452.1|2004787_2007490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145964.1|2007566_2007983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145965.1|2007979_2008426_-	GPW/gp25 family protein	NA	A0A0E3ETF4	Synechococcus_phage	30.5	1.6e-08
WP_011145966.1|2008438_2010040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145967.1|2010036_2010720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145968.1|2010706_2010886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145969.1|2010882_2011341_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011145970.1|2011376_2012552_-|tail	phage tail sheath family protein	tail	A0A2I7QP51	Vibrio_phage	31.0	5.7e-05
WP_011145971.1|2012607_2013993_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011145972.1|2014004_2015087_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011145973.1|2015262_2015712_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011145974.1|2016642_2017590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145976.1|2018791_2019694_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_011145977.1|2019718_2021785_-	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	34.5	4.4e-08
WP_011145978.1|2021794_2023357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144720.1|2023535_2024561_-|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011145979.1|2024610_2025561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791453.1|2025762_2028669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145981.1|2028665_2031368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145982.1|2031464_2031881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145983.1|2031877_2032369_-	GPW/gp25 family protein	NA	M4SKQ1	Cyanophage	27.9	2.8e-06
WP_109791454.1|2032381_2033983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145985.1|2033979_2034663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145986.1|2034649_2034829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145987.1|2034825_2035284_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011145988.1|2035297_2036503_-|tail	phage tail sheath family protein	tail	A0A2I7QP51	Vibrio_phage	31.9	5.3e-06
WP_011145989.1|2036551_2038036_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011145990.1|2038047_2039124_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011145991.1|2039177_2039627_-|tail	phage tail protein	tail	A0A1J0GW41	Streptomyces_phage	28.2	1.3e-05
WP_011145993.1|2040654_2041677_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.4	4.2e-60
>prophage 8
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	2049817	2116982	5688984	tRNA,transposase,tail,protease	Enterobacteria_phage(28.57%)	53	NA	NA
WP_011146000.1|2049817_2051122_-|tail	tail fiber protein	tail	I3PUX0	Vibrio_phage	47.9	4.4e-06
WP_011146001.1|2051309_2054216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146002.1|2054208_2056926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146003.1|2056969_2057386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049789826.1|2057382_2057814_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_109791455.1|2058114_2059716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791456.1|2059712_2060396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146007.1|2060382_2060562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146008.1|2060558_2061017_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_041380029.1|2061030_2062209_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_109791457.1|2062263_2063655_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011146011.1|2063666_2064731_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011146012.1|2064745_2065195_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_041380030.1|2065315_2065498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146013.1|2065880_2067668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146014.1|2068345_2068918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791458.1|2069075_2069870_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_109791459.1|2069909_2071085_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_109791460.1|2071201_2071726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146019.1|2071829_2072171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791461.1|2072175_2073780_+	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_109791462.1|2073783_2075076_+	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_041380786.1|2075098_2075605_+	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_011146023.1|2075626_2077189_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_109791463.1|2077195_2078293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146025.1|2078965_2080279_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_109791464.1|2080441_2081116_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011144714.1|2081919_2083536_+|transposase	IS1634-like element ISPlu4 family transposase	transposase	NA	NA	NA	NA
WP_109791465.1|2083576_2084938_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_011146027.1|2085030_2085579_+	YcbK family protein	NA	NA	NA	NA	NA
WP_109791466.1|2085624_2086272_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.1	1.4e-24
WP_109791467.1|2086688_2087879_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_109791966.1|2088100_2089264_-	porin	NA	Q1MVN1	Enterobacteria_phage	57.2	3.1e-112
WP_109791468.1|2089772_2090918_-	porin	NA	Q1MVN1	Enterobacteria_phage	53.2	1.1e-104
WP_011146032.1|2091254_2092655_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	38.5	9.0e-82
WP_011146033.1|2092859_2094074_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_109791469.1|2094419_2097032_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	7.5e-21
WP_011146035.1|2097207_2097375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146037.1|2097718_2098729_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_011146038.1|2099045_2099591_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_011146039.1|2099976_2101272_-	N-glycosyltransferase	NA	NA	NA	NA	NA
WP_011144786.1|2101393_2102278_-|transposase	IS982-like element ISPlu6 family transposase	transposase	NA	NA	NA	NA
WP_011146040.1|2102495_2103794_-	N-glycosyltransferase	NA	NA	NA	NA	NA
WP_109791471.1|2104071_2105187_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011146042.1|2105289_2107407_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_109791472.1|2107412_2109323_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.1	3.1e-48
WP_109791473.1|2109412_2110660_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_011146045.1|2110680_2112330_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_049789829.1|2112329_2112890_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_011146047.1|2113136_2113304_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_011146048.1|2113885_2114224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146050.1|2114649_2115168_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_011146051.1|2115251_2116982_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
>prophage 9
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	2361469	2406628	5688984	tail,integrase	Enterobacteria_phage(44.44%)	43	2355766:2355805	2401674:2401713
2355766:2355805	attL	ATATACCCGTCATCTTTCAAGTTGCCTCTTTGTTGGCTGC	NA	NA	NA	NA
WP_011146249.1|2361469_2362090_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	48.5	3.0e-53
WP_109791500.1|2362664_2363792_+	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_109791501.1|2363864_2365532_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_011146252.1|2365684_2366590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146253.1|2366613_2366970_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_109791502.1|2367086_2368265_+	YhfX family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_082303121.1|2368215_2369199_+	phosphotriesterase-related protein	NA	NA	NA	NA	NA
WP_011146256.1|2369210_2369570_+	DUF2620 domain-containing protein	NA	NA	NA	NA	NA
WP_041380053.1|2369580_2370942_+	membrane protein	NA	NA	NA	NA	NA
WP_011146258.1|2370989_2372126_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011146259.1|2372412_2373108_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011146260.1|2373255_2373927_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011146261.1|2373954_2374635_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146262.1|2374926_2375607_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146263.1|2375636_2376317_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146264.1|2376347_2377028_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146265.1|2377057_2377738_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146266.1|2377768_2378449_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146267.1|2378709_2379393_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146268.1|2379663_2380344_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146269.1|2380504_2381185_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146270.1|2381345_2382026_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146271.1|2382052_2382733_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011146272.1|2382893_2383571_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146273.1|2383626_2384319_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_041380057.1|2385749_2386418_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011146275.1|2387124_2387799_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011146276.1|2388848_2389757_-	lipopolysaccharide core biosynthesis protein RfaZ	NA	NA	NA	NA	NA
WP_041380058.1|2389792_2390368_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_011146278.1|2390995_2391913_+	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	39.6	3.5e-34
WP_041380819.1|2393561_2394188_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	45.9	1.1e-34
WP_011146280.1|2394242_2394992_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	56.7	6.8e-44
WP_011146282.1|2396417_2396966_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_058589743.1|2397023_2398856_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011146284.1|2398839_2399505_-	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_011146285.1|2399939_2400164_+	DUF2594 family protein	NA	NA	NA	NA	NA
WP_011146286.1|2400523_2400952_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	43.0	4.2e-22
WP_109791505.1|2401212_2401551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146288.1|2401729_2402167_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	44.8	1.4e-25
2401674:2401713	attR	GCAGCCAACAAAGAGGCAACTTGAAAGATGACGGGTATAT	NA	NA	NA	NA
WP_011146289.1|2402658_2403354_+	aquaporin Z	NA	NA	NA	NA	NA
WP_109791506.1|2403736_2404456_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	48.3	5.2e-33
WP_011146291.1|2404477_2405104_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	39.6	2.7e-33
WP_109791507.1|2405341_2406628_+|tail	tail fiber protein	tail	A0A1W6JNZ8	Morganella_phage	38.3	3.1e-60
>prophage 10
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	2646924	2700859	5688984	transposase,plate	Escherichia_phage(12.5%)	46	NA	NA
WP_011144722.1|2646924_2647809_-|transposase	IS982-like element ISPlu11 family transposase	transposase	NA	NA	NA	NA
WP_109791971.1|2647753_2648125_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	47.7	4.8e-06
WP_011146505.1|2649007_2649304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146506.1|2649523_2649808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146507.1|2650219_2651413_-	P1 family peptidase	NA	NA	NA	NA	NA
WP_109791551.1|2651778_2654190_+	decarboxylase	NA	NA	NA	NA	NA
WP_109791552.1|2654310_2655642_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_109791553.1|2655898_2657011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791554.1|2657676_2661123_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_109791555.1|2661326_2662238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791556.1|2662393_2662681_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	47.4	1.4e-18
WP_011146514.1|2662677_2662929_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011146515.1|2663258_2664179_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	32.5	9.6e-40
WP_109791557.1|2664515_2665475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146517.1|2666116_2666578_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	48.6	9.1e-31
WP_011146518.1|2666796_2667087_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011146519.1|2667083_2667362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146520.1|2667665_2668544_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_109791558.1|2668730_2670047_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_011146522.1|2670085_2671528_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_109791559.1|2671568_2672753_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011146524.1|2673060_2674380_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011146525.1|2674799_2675372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041380079.1|2675663_2676038_+	glyoxalase	NA	NA	NA	NA	NA
WP_011146527.1|2676125_2676365_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_011146528.1|2676366_2676672_+	CcdB family protein	NA	NA	NA	NA	NA
WP_071824109.1|2676790_2676883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146529.1|2676942_2677197_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_109791560.1|2677252_2677711_-	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_011145223.1|2677692_2678661_-|transposase	IS30-like element ISPlu1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	5.3e-41
WP_011146531.1|2678803_2679004_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_109791561.1|2679148_2682760_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	28.5	6.7e-28
WP_011146533.1|2682763_2683390_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011146534.1|2683420_2684680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791562.1|2684729_2687312_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	31.1	7.5e-90
WP_109791563.1|2687304_2690814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791564.1|2690829_2691453_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011146538.1|2691449_2692847_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011146539.1|2692850_2693528_-	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_109791565.1|2693520_2694645_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_011146541.1|2694637_2694940_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_109791566.1|2694936_2695533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146543.1|2695567_2697574_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.5	6.3e-28
WP_011146544.1|2697598_2698609_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_109791567.1|2698599_2700411_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_109791568.1|2700415_2700859_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 11
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	2800481	2823281	5688984	tail,protease	Streptomyces_phage(20.0%)	17	NA	NA
WP_011146620.1|2800481_2800931_+|tail	phage tail protein	tail	A0A1J0GW41	Streptomyces_phage	29.5	4.4e-06
WP_011146621.1|2801004_2802081_+|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011146622.1|2802138_2803431_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	38.7	6.9e-28
WP_011146623.1|2803485_2804652_+|tail	phage tail sheath family protein	tail	A0A2I7QP51	Vibrio_phage	29.5	5.7e-05
WP_011146624.1|2804670_2805129_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011146625.1|2805125_2805305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146626.1|2805291_2805975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146627.1|2805971_2807576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146628.1|2807588_2808011_+	GPW/gp25 family protein	NA	A0A0E3ETF4	Synechococcus_phage	32.3	1.8e-09
WP_011146629.1|2808007_2808424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146630.1|2808507_2812560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146631.1|2812585_2815621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146632.1|2815663_2817094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146633.1|2817103_2819185_+	ATP-binding protein	NA	A0A2D2W2C3	Stenotrophomonas_phage	34.5	4.4e-08
WP_011146634.1|2819209_2820112_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_109791580.1|2820413_2822033_+	membrane-targeted effector domain-containing toxin	NA	NA	NA	NA	NA
WP_011146636.1|2822309_2823281_+|protease	YopT-type cysteine protease domain-containing protein	protease	NA	NA	NA	NA
>prophage 12
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	2834274	2914539	5688984	transposase,protease	Acinetobacter_phage(30.0%)	54	NA	NA
WP_011144774.1|2834274_2835288_-|transposase	IS630-like element ISPlu10 family transposase	transposase	NA	NA	NA	NA
WP_109791581.1|2835375_2836443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049789776.1|2836325_2836784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071824114.1|2836711_2837089_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_071824115.1|2837019_2837295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011144720.1|2837741_2838767_-|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_109791582.1|2839042_2843953_+	cytotoxic necrotizing factor	NA	NA	NA	NA	NA
WP_109791583.1|2844040_2845390_-	Fic family protein	NA	NA	NA	NA	NA
WP_011146650.1|2845657_2846020_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_011146651.1|2846016_2847297_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_011146652.1|2847396_2847876_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_109791584.1|2847900_2848506_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_109791585.1|2848895_2849222_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_109791586.1|2849211_2849958_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_011146656.1|2850002_2851172_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_011146657.1|2851178_2851490_-	LapA family protein	NA	NA	NA	NA	NA
WP_109791587.1|2851650_2851782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380089.1|2852007_2852604_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.8	8.1e-40
WP_109791588.1|2852753_2855429_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_011146660.1|2855681_2856509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146661.1|2856684_2857659_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_011146662.1|2857963_2860564_-	type I DNA topoisomerase	NA	E3T4K4	Cafeteria_roenbergensis_virus	35.9	8.9e-91
WP_011146664.1|2861325_2862156_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011146665.1|2862214_2862394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146666.1|2862684_2863731_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	27.7	2.1e-22
WP_041380092.1|2865699_2870991_-	hypothetical protein	NA	B6SD27	Bacteriophage	28.0	4.3e-108
WP_109791590.1|2871101_2871629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146671.1|2872006_2872612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145548.1|2874755_2875760_-|transposase	IS110-like element ISPlu13 family transposase	transposase	NA	NA	NA	NA
WP_011146673.1|2876553_2877192_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	47.8	8.1e-62
WP_011146674.1|2877521_2878286_+	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_011146675.1|2878285_2878882_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_011146676.1|2878918_2879851_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_011146678.1|2885419_2885689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791591.1|2886284_2887433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146680.1|2887752_2888373_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_049789779.1|2888400_2889261_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_011146682.1|2889462_2891331_-	glycoside hydrolase family 18 protein	NA	NA	NA	NA	NA
WP_011146683.1|2891458_2895547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791592.1|2895539_2899061_-	toxin	NA	NA	NA	NA	NA
WP_011146685.1|2899157_2900792_-	glycoside hydrolase family 18 protein	NA	W5VKF1	Buzura_suppressaria_nuclear_polyhedrosis_virus	31.4	5.1e-36
WP_011146686.1|2901648_2903223_+	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_011146687.1|2903222_2903801_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	36.5	1.3e-29
WP_011146688.1|2903814_2904813_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.4	5.3e-52
WP_011146689.1|2904815_2906180_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.1	5.4e-39
WP_011146690.1|2906256_2907447_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011146691.1|2907446_2908253_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_157866902.1|2908959_2909100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146692.1|2909090_2910737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011146693.1|2910738_2911503_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	2.8e-16
WP_011146694.1|2911492_2912245_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011146695.1|2912237_2913008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791593.1|2913017_2913494_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011146697.1|2913498_2914539_-|transposase	IS630-like element ISPlu16 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	2948273	2956585	5688984		Escherichia_phage(57.14%)	8	NA	NA
WP_011146727.1|2948273_2949122_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	34.7	2.2e-14
WP_011146729.1|2949552_2949966_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	55.0	4.8e-31
WP_011146730.1|2951052_2951958_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	59.9	1.4e-91
WP_011146731.1|2951957_2953235_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	50.2	8.7e-108
WP_041380095.1|2953227_2953869_+	aldolase	NA	A0A077SK32	Escherichia_phage	54.1	4.9e-59
WP_011146733.1|2953887_2954667_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_011146734.1|2954679_2955447_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	41.9	9.4e-49
WP_011146735.1|2955619_2956585_+	SDR family oxidoreductase	NA	A0A1V0SAI6	Catovirus	24.8	8.0e-05
>prophage 14
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	2965714	2980852	5688984	tail	Cyanophage(100.0%)	13	NA	NA
WP_011146742.1|2965714_2966971_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_011146743.1|2967098_2970002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146744.1|2969994_2972724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146745.1|2972806_2973223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146746.1|2973219_2973636_-	GPW/gp25 family protein	NA	M4SKQ1	Cyanophage	32.3	8.8e-09
WP_011146747.1|2973649_2975251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146748.1|2975247_2975931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146749.1|2975917_2976097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011146750.1|2976093_2976552_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011146751.1|2976565_2977762_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_109791597.1|2977810_2979217_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_109791598.1|2979228_2980350_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_011146754.1|2980402_2980852_-|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 15
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	3110948	3124192	5688984	tRNA	Tupanvirus(44.44%)	12	NA	NA
WP_109791627.1|3110948_3112931_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	26.7	1.9e-21
WP_109791628.1|3112931_3113909_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	Q76H32	Enterobacteria_phage	33.7	9.5e-38
WP_109791629.1|3113909_3115055_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	25.9	1.4e-35
WP_058588430.1|3115215_3115962_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	M1H3A1	Paramecium_bursaria_Chlorella_virus	27.6	4.8e-05
WP_109791630.1|3115995_3117003_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_011146885.1|3117068_3117365_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	7.1e-13
WP_109791631.1|3117369_3119757_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.2	1.0e-08
WP_109791632.1|3119772_3120756_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.1	2.9e-34
WP_058588404.1|3121027_3121384_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_011146889.1|3121425_3121623_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_071824118.1|3121720_3122260_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.5	2.9e-12
WP_011146891.1|3122263_3124192_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	6.3e-126
>prophage 16
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	3409529	3468148	5688984	transposase,plate,lysis,tail,integrase,holin,head,terminase	Haemophilus_phage(16.67%)	88	3409318:3409377	3456148:3456254
3409318:3409377	attL	CGTCATGGGGTGTCGGGGGTCGGAGGTTCAAATCCTCTCATGCCGACCAAATTTCCCTAG	NA	NA	NA	NA
WP_109791654.1|3409529_3410156_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	39.2	4.7e-30
WP_109791655.1|3410155_3411478_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	44.9	5.4e-28
WP_011147095.1|3411464_3412121_-	DUF2612 domain-containing protein	NA	NA	NA	NA	NA
WP_011147096.1|3412113_3413247_-|plate	baseplate J/gp47 family protein	plate	D0UIH5	Aggregatibacter_phage	37.9	3.8e-70
WP_011147097.1|3413230_3413593_-	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	52.3	8.1e-27
WP_011147098.1|3413589_3414261_-	hypothetical protein	NA	Q7Y5S7	Haemophilus_phage	58.8	1.6e-44
WP_011147099.1|3414235_3415081_-	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	53.6	1.3e-83
WP_011147100.1|3415055_3415394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147101.1|3415390_3416110_-	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	39.8	6.1e-34
WP_133248388.1|3416256_3416406_-	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	72.0	7.4e-11
WP_041380929.1|3416643_3417402_-	antirepressor	NA	A0A2L1IV39	Escherichia_phage	58.4	2.9e-82
WP_011147104.1|3417574_3417748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380931.1|3417864_3418134_+	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	42.7	1.0e-10
WP_011147106.1|3418151_3418439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147107.1|3418507_3420496_-	hypothetical protein	NA	D0UII2	Aggregatibacter_phage	31.9	2.7e-15
WP_011147109.1|3420643_3421039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380124.1|3421038_3421473_-	DUF3277 family protein	NA	NA	NA	NA	NA
WP_011147111.1|3421476_3422988_-	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	44.0	7.9e-108
WP_049789837.1|3422990_3423365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380126.1|3423408_3423747_-	hypothetical protein	NA	Q776V7	Haemophilus_phage	31.2	2.6e-11
WP_011147114.1|3423739_3424333_-	hypothetical protein	NA	A0A1L2JY56	Aeribacillus_phage	33.2	7.6e-14
WP_011147115.1|3424329_3424692_-	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	46.2	4.5e-17
WP_011147116.1|3424706_3425666_-	DUF2184 domain-containing protein	NA	NA	NA	NA	NA
WP_011147117.1|3425670_3426156_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_011147118.1|3426158_3427316_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	36.4	9.6e-21
WP_041380933.1|3427319_3428171_-|head	phage head morphogenesis, SPP1 gp7 family domain protein	head	Q7Y5U5	Haemophilus_phage	31.8	2.7e-28
WP_041380127.1|3428091_3429465_-	DUF1073 domain-containing protein	NA	A0A1W6JTH9	Shewanella_phage	24.3	1.6e-19
WP_011147121.1|3429464_3430694_-|terminase	PBSX family phage terminase large subunit	terminase	H6WRS9	Salmonella_phage	78.9	1.4e-195
WP_011147122.1|3430690_3431092_-	hypothetical protein	NA	A0A068CGC1	Acinetobacter_phage	54.0	1.3e-28
WP_011147123.1|3431136_3431805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380128.1|3432169_3432511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041380129.1|3432503_3432731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147125.1|3432927_3433377_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	46.6	2.3e-18
WP_109791657.1|3433373_3433598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147127.1|3433609_3434020_-	structural protein	NA	A0A0A1IX72	Pseudomonas_phage	51.5	6.4e-28
WP_041380130.1|3434016_3434334_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	51.0	3.0e-25
WP_041380131.1|3434491_3434677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041380132.1|3434666_3434876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380133.1|3434900_3435365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147131.1|3435548_3436364_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	48.9	4.5e-65
WP_041380134.1|3436550_3436736_-	hypothetical protein	NA	E5AGG1	Erwinia_phage	32.2	7.3e-08
WP_011147132.1|3436732_3437113_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	40.7	6.3e-14
WP_011147133.1|3437221_3437458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147134.1|3437457_3437901_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	47.1	4.8e-29
WP_036841551.1|3438094_3438301_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_011147136.1|3438313_3439270_-	DNA primase	NA	A0A0P0ZFY3	Escherichia_phage	57.2	3.1e-102
WP_011147137.1|3439232_3440774_-	DEAD/DEAH box helicase	NA	A0A0N7KZV6	Escherichia_phage	70.9	2.4e-213
WP_154097931.1|3440845_3441319_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049789838.1|3441540_3441870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147140.1|3441947_3442265_-	hypothetical protein	NA	I6PCV6	Cronobacter_phage	52.3	4.3e-16
WP_011147141.1|3442387_3442591_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	67.2	1.1e-17
WP_011147142.1|3442700_3443339_+	helix-turn-helix transcriptional regulator	NA	K7PK07	Enterobacteria_phage	56.9	3.7e-59
WP_011147143.1|3443401_3443740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147144.1|3443732_3444143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147146.1|3444470_3444689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147147.1|3444878_3445163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791976.1|3445314_3445461_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_011147149.1|3445567_3446098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147150.1|3446174_3446354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147151.1|3446572_3446830_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	42.4	5.2e-12
WP_011147152.1|3446859_3447282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147153.1|3447351_3448254_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	54.9	2.1e-39
WP_011147154.1|3448644_3448902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147155.1|3448898_3449819_+	recombinase RecT	NA	F1C5B8	Cronobacter_phage	69.6	1.3e-121
WP_041380943.1|3449822_3450503_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	74.8	4.7e-100
WP_082303152.1|3450499_3450901_+	DUF1317 family protein	NA	NA	NA	NA	NA
WP_011147159.1|3451108_3451546_+	hypothetical protein	NA	A9YX19	Burkholderia_phage	49.6	1.4e-36
WP_011147160.1|3451551_3452208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041380137.1|3452204_3452387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041380139.1|3452597_3452852_+	DUF5405 family protein	NA	A0A192YCJ9	Morganella_phage	48.2	1.7e-15
WP_041380141.1|3452886_3453516_+	DNA methyltransferase	NA	A0A248SKY3	Klebsiella_phage	57.6	1.1e-66
WP_011147163.1|3453502_3453742_+	hypothetical protein	NA	S4TWM3	Salmonella_phage	42.4	5.6e-08
WP_040154027.1|3453765_3454068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147165.1|3454313_3454610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147166.1|3454619_3454838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147167.1|3454839_3456018_+|integrase	site-specific integrase	integrase	A0A2D1GN00	Marinobacter_phage	30.9	5.5e-32
WP_082302955.1|3456283_3456400_-	hypothetical protein	NA	NA	NA	NA	NA
3456148:3456254	attR	CGTCATGGGGTGTCGGGGGTCGGAGGTTCAAATCCTCTCATGCCGACCAAATTTCCCTAGAAAAACCAACCTGTTAGGGTTGGTTTTTTTATGGCTGGGATTTGGCT	NA	NA	NA	NA
WP_109791659.1|3456516_3456804_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_011147171.1|3456818_3457115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147172.1|3457229_3458045_-	hypothetical protein	NA	Q7Y5V4	Haemophilus_phage	44.3	8.7e-61
WP_109791660.1|3458358_3458730_-	DUF4431 domain-containing protein	NA	NA	NA	NA	NA
WP_011146066.1|3458759_3459785_-|transposase	IS630-like element ISPlu3 family transposase	transposase	NA	NA	NA	NA
WP_109791661.1|3460367_3460790_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.0	1.5e-27
WP_109791662.1|3462411_3462834_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.6	1.4e-25
WP_011147178.1|3462836_3463424_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	45.5	1.0e-10
WP_011147179.1|3463957_3464722_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	41.0	7.3e-09
WP_109791663.1|3465165_3466581_-|tail	phage tail protein	tail	A5X9J3	Aeromonas_virus	57.6	1.1e-18
WP_109791664.1|3466663_3468148_-|tail	phage tail protein	tail	A5X9J3	Aeromonas_virus	38.0	1.5e-18
>prophage 17
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	3509122	3537384	5688984	transposase,tail,plate	Salmonella_phage(18.18%)	27	NA	NA
WP_011147226.1|3509122_3509635_+|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	37.3	1.3e-22
WP_011147227.1|3509676_3510774_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_109791674.1|3512832_3513459_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	43.6	3.8e-40
WP_011147230.1|3513458_3514160_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	43.5	1.8e-30
WP_011147232.1|3515846_3516824_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	42.9	2.9e-10
WP_011147233.1|3517193_3518162_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.8e-41
WP_011147235.1|3519439_3520396_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_109791675.1|3520607_3521363_+	glycosyltransferase family 25 protein	NA	A0A1V0SJT4	Klosneuvirus	31.4	1.1e-09
WP_071824123.1|3521519_3522293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791676.1|3522743_3523172_-	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	31.9	1.0e-15
WP_158536418.1|3523995_3524142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147240.1|3524144_3524567_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	44.2	9.8e-24
WP_011147241.1|3524611_3525238_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	41.0	3.8e-32
WP_011147242.1|3525237_3526674_-	hypothetical protein	NA	A0A219YBC2	Aeromonas_phage	49.2	2.4e-37
WP_109791677.1|3526676_3527249_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	44.3	1.7e-34
WP_109791678.1|3527245_3528439_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	50.9	3.6e-103
WP_109791679.1|3528431_3528779_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	56.0	2.7e-27
WP_011147246.1|3528775_3529531_-|plate	phage baseplate assembly protein V	plate	A0A0M5M1K7	Salmonella_phage	62.7	4.4e-75
WP_109791680.1|3529527_3530484_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	39.2	1.2e-64
WP_011147248.1|3530574_3530880_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	41.1	1.1e-13
WP_109791681.1|3530864_3531470_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	51.2	1.1e-47
WP_011147250.1|3531472_3533242_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	34.8	2.1e-14
WP_011147251.1|3533434_3533845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147252.1|3533958_3534399_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	67.8	2.7e-48
WP_165828669.1|3534408_3535881_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	47.3	2.3e-120
WP_109791683.1|3535881_3536445_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	53.6	4.0e-49
WP_011147255.1|3536964_3537384_-	antitermination protein Q	NA	B6SCZ7	Bacteriophage	45.5	2.6e-29
>prophage 18
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	3617377	3722170	5688984	transposase	Tupanvirus(18.18%)	57	NA	NA
WP_011144854.1|3617377_3618391_-|transposase	IS630-like element ISPlu10 family transposase	transposase	NA	NA	NA	NA
WP_058589831.1|3618509_3619154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147317.1|3619960_3620590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147318.1|3621253_3622078_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_041380178.1|3622089_3623244_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_011147320.1|3623255_3624140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147321.1|3625036_3626491_-	amino acid permease	NA	NA	NA	NA	NA
WP_109791699.1|3626595_3627573_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_011147323.1|3627585_3628929_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_058589828.1|3628979_3630455_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_058589827.1|3630457_3631489_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_109791700.1|3631510_3632719_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	1.3e-33
WP_011147327.1|3634811_3635060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049789715.1|3635422_3635788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011144475.1|3635781_3636117_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011145417.1|3636180_3637686_+|transposase	IS66-like element ISPlu20 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.5	1.3e-89
WP_011147329.1|3637871_3638252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147332.1|3639117_3639465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147333.1|3639469_3643966_-	hypothetical protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.8	4.4e-21
WP_011147334.1|3643981_3644149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791701.1|3646117_3662491_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.3	4.5e-140
WP_157852163.1|3663953_3664091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147338.1|3664483_3666604_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.9	1.4e-41
WP_011147339.1|3666603_3667992_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011147340.1|3667991_3670151_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	30.6	1.0e-47
WP_109791702.1|3670246_3677425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058589562.1|3677814_3678090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791703.1|3678525_3688461_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.2	7.4e-146
WP_011147344.1|3690386_3691361_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.4	2.3e-60
WP_125026243.1|3691946_3692189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147346.1|3692921_3694244_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_011147347.1|3694553_3696164_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.7	1.6e-29
WP_011147348.1|3696156_3697323_-	MFS transporter	NA	NA	NA	NA	NA
WP_011147349.1|3697347_3698712_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011147350.1|3698708_3699920_-	citrate/2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_041380187.1|3700081_3701095_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011144720.1|3701217_3702243_-|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011147352.1|3703026_3704619_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_011147353.1|3704834_3705842_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_011147354.1|3706067_3707603_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	32.6	6.5e-25
WP_011147355.1|3707596_3708598_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_162096546.1|3708594_3709599_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_011147357.1|3709661_3710681_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_011147358.1|3710749_3711625_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_011147359.1|3711636_3711936_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_011145659.1|3712011_3712440_-|transposase	IS200/IS605-like element ISPlu2 family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	37.9	2.8e-18
WP_011147360.1|3712841_3713246_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_011147361.1|3713248_3713428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147362.1|3713418_3713733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147363.1|3714419_3714899_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_125043777.1|3715008_3715371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380192.1|3715363_3715717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147365.1|3715709_3716480_-	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_011147366.1|3717066_3717351_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011147367.1|3717520_3718087_-	NUDIX hydrolase YfcD	NA	NA	NA	NA	NA
WP_011147368.1|3718568_3720446_-	lipase family protein	NA	NA	NA	NA	NA
WP_011146697.1|3721129_3722170_+|transposase	IS630-like element ISPlu16 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	3777824	3956322	5688984	tail,tRNA,transposase,plate	uncultured_Caudovirales_phage(15.0%)	108	NA	NA
WP_011144786.1|3777824_3778709_-|transposase	IS982-like element ISPlu6 family transposase	transposase	NA	NA	NA	NA
WP_082303130.1|3778696_3785881_-	MARTX multifunctional-autoprocessing repeats-in-toxin holotoxin RtxA	NA	NA	NA	NA	NA
WP_011147415.1|3787104_3787359_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_011147416.1|3787538_3788477_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	50.8	6.3e-63
WP_011147417.1|3788967_3789984_-	formamidase	NA	NA	NA	NA	NA
WP_011147418.1|3790469_3792023_+	Fic family protein	NA	NA	NA	NA	NA
WP_011147419.1|3792541_3792943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147420.1|3792942_3793503_-	SocA family protein	NA	NA	NA	NA	NA
WP_041380207.1|3793996_3804577_-	MARTX multifunctional-autoprocessing repeats-in-toxin holotoxin RtxA	NA	NA	NA	NA	NA
WP_011147422.1|3805727_3806369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147423.1|3807328_3808018_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011147424.1|3808057_3808744_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011147425.1|3809056_3809725_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011147426.1|3810049_3810478_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011147427.1|3810482_3811022_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_011147428.1|3810999_3812088_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011147429.1|3812051_3813812_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011147430.1|3814338_3815322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147431.1|3815365_3817843_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011147432.1|3817830_3818343_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011147433.1|3818394_3818907_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_157866904.1|3819481_3819622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147435.1|3819694_3823066_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_041380211.1|3823062_3824181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049789784.1|3824734_3825784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380217.1|3825837_3827451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147441.1|3827454_3829980_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	1.6e-04
WP_165828660.1|3830818_3834205_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_011147443.1|3834185_3835337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147444.1|3835333_3835591_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011147445.1|3835587_3838077_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011147446.1|3838064_3838577_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011147447.1|3838628_3839141_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011147448.1|3839192_3839708_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011147449.1|3839717_3840500_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011147450.1|3840503_3842903_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	35.0	3.2e-18
WP_157866905.1|3843425_3843566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147451.1|3843638_3847010_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_011147452.1|3847006_3848125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147454.1|3848666_3849716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147455.1|3849894_3850986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147456.1|3850978_3852589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147457.1|3852591_3855120_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.7	5.5e-05
WP_011147458.1|3855296_3855788_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_011147459.1|3855806_3857534_-	OmpA family protein	NA	NA	NA	NA	NA
WP_071824125.1|3857530_3857800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049789715.1|3857846_3858212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011144475.1|3858205_3858541_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011145417.1|3858604_3860110_+|transposase	IS66-like element ISPlu20 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.5	1.3e-89
WP_041380999.1|3860159_3860552_-	type VI secretion protein ImpK	NA	NA	NA	NA	NA
WP_011147460.1|3860548_3861898_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_011147461.1|3861913_3863440_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_011147462.1|3863471_3863969_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011147463.1|3865124_3880775_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.8	1.1e-175
WP_011147464.1|3880894_3881041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144720.1|3882980_3884006_+|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011144714.1|3884606_3886223_-|transposase	IS1634-like element ISPlu4 family transposase	transposase	NA	NA	NA	NA
WP_011144854.1|3886590_3887604_-|transposase	IS630-like element ISPlu10 family transposase	transposase	NA	NA	NA	NA
WP_011147465.1|3888385_3888595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147468.1|3889622_3889874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147469.1|3889860_3891657_+	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_011147470.1|3891748_3892171_-	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_011147471.1|3892206_3893502_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	42.3	1.5e-38
WP_011147472.1|3893810_3894011_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_011147473.1|3894029_3894365_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_011147474.1|3894367_3896218_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.1	3.9e-109
WP_011147475.1|3896229_3896751_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_011147476.1|3896788_3897112_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	49.5	5.4e-22
WP_011147477.1|3897221_3897608_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	3.5e-52
WP_011147478.1|3897632_3898847_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	2.7e-34
WP_011147479.1|3898896_3899391_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_011147480.1|3899477_3900203_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_011147481.1|3900336_3901140_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_011147482.1|3901242_3902904_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_011147483.1|3903003_3904425_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_011147484.1|3904573_3905521_-	trehalose operon repressor	NA	NA	NA	NA	NA
WP_011147485.1|3905593_3906739_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_011147486.1|3907058_3908312_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	51.3	1.9e-99
WP_011147487.1|3908683_3909874_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_011147489.1|3910529_3910952_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_011147490.1|3910948_3912343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147491.1|3912402_3912984_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	36.6	2.0e-22
WP_011147492.1|3913331_3913652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071824126.1|3914150_3914354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082302899.1|3914350_3914482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147494.1|3914457_3915483_-|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_041380234.1|3915774_3916425_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_041380236.1|3916421_3917510_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011147497.1|3918069_3918657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146748378.1|3918580_3918922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791981.1|3919141_3920245_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_109791982.1|3920686_3921889_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_109791723.1|3922077_3923139_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_011144786.1|3923572_3924457_-|transposase	IS982-like element ISPlu6 family transposase	transposase	NA	NA	NA	NA
WP_011147501.1|3924817_3925156_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_011147502.1|3925171_3926794_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.8	1.1e-94
WP_011147503.1|3926860_3928198_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	38.2	1.8e-10
WP_041380238.1|3928194_3929040_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_041381009.1|3929043_3930483_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.3	2.0e-15
WP_011147507.1|3931258_3931531_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011147508.1|3931517_3931865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791724.1|3931981_3935869_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.0	2.1e-128
WP_109791725.1|3936135_3937551_+	membrane-bound lytic murein transglycosylase MltF	NA	A0A1V0E6L2	Klebsiella_phage	36.6	1.1e-07
WP_109791726.1|3937681_3939988_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_109791984.1|3939976_3940495_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_109791727.1|3942667_3953263_-	MARTX multifunctional-autoprocessing repeats-in-toxin holotoxin RtxA	NA	NA	NA	NA	NA
WP_011147515.1|3955225_3955726_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	44.5	1.2e-31
WP_011147516.1|3955722_3956322_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	45.2	1.7e-45
>prophage 20
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	3959754	4077256	5688984	transposase,capsid,plate,head,tail,protease,lysis,integrase,tRNA,terminase	Burkholderia_virus(15.85%)	132	4006391:4006425	4085181:4085215
WP_011147519.1|3959754_3960582_+|tail	tail fiber protein	tail	F1BUP1	Erwinia_phage	39.2	2.7e-17
WP_109791728.1|3960621_3960741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147520.1|3961154_3961982_+|tail	tail fiber protein	tail	Q858V4	Yersinia_virus	42.7	2.7e-09
WP_109791729.1|3961983_3962418_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	47.6	7.5e-27
WP_109791730.1|3962806_3963526_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	41.7	8.9e-17
WP_109791731.1|3964213_3964474_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	3.8e-18
WP_011147524.1|3964476_3964857_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_011147525.1|3964856_3965588_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_011147526.1|3965782_3966508_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011147527.1|3966519_3967428_-	GTPase Era	NA	NA	NA	NA	NA
WP_011147528.1|3967424_3968105_-	ribonuclease III	NA	M1HK80	Acanthocystis_turfacea_Chlorella_virus	32.0	2.1e-20
WP_011147529.1|3968279_3969260_-	signal peptidase I	NA	NA	NA	NA	NA
WP_058589201.1|3969280_3971077_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.8	3.2e-23
WP_011147531.1|3971270_3971735_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_058589192.1|3971734_3972691_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_058589193.1|3972696_3973347_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_011147534.1|3973386_3973956_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_058589194.1|3974159_3975764_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_058589195.1|3975831_3976566_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011147537.1|3976848_3978186_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.8	4.2e-44
WP_011147538.1|3978356_3978875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147539.1|3979432_3980647_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011144720.1|3981233_3982259_-|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011147540.1|3983531_3984278_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011144854.1|3984960_3985974_+|transposase	IS630-like element ISPlu10 family transposase	transposase	NA	NA	NA	NA
WP_011147543.1|3986349_3987240_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011147544.1|3987277_3987982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147545.1|3987988_3989203_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011147546.1|3989471_3990086_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011147547.1|3990107_3991217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147548.1|3991705_3993124_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011147549.1|3993320_3993851_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_011147550.1|3993866_3994610_-	geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_011147551.1|3994856_3995996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147552.1|3995997_3996846_-	radical SAM protein	NA	A0A1B1ITW6	uncultured_Mediterranean_phage	24.8	5.4e-13
WP_011147553.1|3997545_3998133_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_011147554.1|3998148_3999165_-	phospholipase	NA	NA	NA	NA	NA
WP_011147555.1|3999923_4000604_+	uracil-DNA glycosylase	NA	A0A1R3T3N6	Sphenicid_alphaherpesvirus	46.7	4.3e-53
WP_011147556.1|4000672_4001254_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_011147557.1|4001378_4002257_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_011147558.1|4002345_4004007_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_011147559.1|4004245_4004593_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_011147560.1|4004648_4004942_-	RnfH family protein	NA	NA	NA	NA	NA
WP_011147561.1|4004934_4005369_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_011147562.1|4005525_4006008_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	49.4	7.3e-31
4006391:4006425	attL	GGACGCGGGTTCAACTCCCGCCAGCTCCACCAAAT	NA	NA	NA	NA
WP_071824172.1|4006924_4007074_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011147564.1|4007216_4007501_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_011147565.1|4007648_4008095_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	60.7	1.1e-09
WP_082302866.1|4008095_4009208_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	35.9	6.6e-11
WP_011147567.1|4009425_4010031_-	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	37.7	2.0e-30
WP_041380244.1|4010031_4011273_-	bacteriophage protein	NA	A0A077KGW9	Edwardsiella_phage	50.2	7.4e-104
WP_011147569.1|4011272_4011629_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	50.9	1.9e-20
WP_011147570.1|4011727_4011901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147571.1|4012057_4012591_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	54.1	2.0e-53
WP_109791732.1|4013054_4013654_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	45.9	3.0e-42
WP_011147574.1|4014506_4014812_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	52.1	3.9e-22
WP_011147575.1|4014808_4015630_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	7.8e-25
WP_041380246.1|4015629_4017747_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	57.1	5.4e-46
WP_011147577.1|4017955_4018363_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	45.7	1.6e-18
WP_011147578.1|4018362_4018800_-	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	36.7	2.3e-20
WP_011147579.1|4018799_4020287_-	DUF3383 domain-containing protein	NA	E2GLU1	Acinetobacter_phage	31.7	3.0e-59
WP_049789841.1|4020267_4020753_-	hypothetical protein	NA	Q6UJ27	Burkholderia_virus	33.8	2.4e-10
WP_011147581.1|4020809_4021181_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	46.7	3.2e-26
WP_011147582.1|4021177_4021636_-	hypothetical protein	NA	A0A068C8K8	Acinetobacter_phage	40.8	5.7e-17
WP_011147583.1|4021635_4022085_-	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	45.9	1.0e-18
WP_011147584.1|4022089_4022416_-	hypothetical protein	NA	A0A1X9SFA9	Acinetobacter_phage	38.6	3.5e-13
WP_011147585.1|4022416_4023451_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	47.0	1.3e-82
WP_011147586.1|4023450_4023927_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	44.2	5.3e-26
WP_011147587.1|4023929_4025255_-	DUF2213 domain-containing protein	NA	A0A219YBB9	Aeromonas_phage	42.7	1.8e-71
WP_040149365.1|4025272_4025965_-|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	45.1	2.0e-50
WP_109791985.1|4026050_4027475_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	45.5	4.2e-103
WP_071824128.1|4027533_4028739_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4JCM3	uncultured_Caudovirales_phage	64.0	1.4e-144
WP_011147591.1|4028798_4029518_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	37.3	6.4e-07
WP_011147592.1|4029596_4029914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147593.1|4031307_4032207_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_011147594.1|4032226_4032745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147595.1|4032875_4033325_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	46.6	1.3e-18
WP_011147596.1|4033417_4033954_-	lysozyme	NA	K7PM52	Enterobacteria_phage	67.8	3.7e-68
WP_011147597.1|4033937_4034120_-	hypothetical protein	NA	B6SD15	Bacteriophage	58.6	4.2e-16
WP_011147598.1|4034280_4034682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147600.1|4036098_4036347_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041380249.1|4036435_4036690_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011147602.1|4036794_4037052_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	1.9e-17
WP_011147603.1|4037152_4037605_-|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	43.8	1.2e-11
WP_109791986.1|4038584_4039163_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	62.2	9.5e-62
WP_011147606.1|4039152_4040256_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	50.7	1.1e-98
WP_041380251.1|4040246_4040600_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.2	2.5e-33
WP_011147608.1|4040646_4041252_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.1	7.0e-15
WP_011147609.1|4041248_4042427_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	50.1	3.5e-87
WP_036777198.1|4042414_4042627_-	membrane protein	NA	NA	NA	NA	NA
WP_011147610.1|4042629_4043514_-|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	47.1	2.4e-56
WP_011147611.1|4043513_4046066_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.0	4.8e-166
WP_088776128.1|4046069_4046189_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_011147612.1|4046148_4046475_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_011147613.1|4046732_4047257_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	70.1	6.0e-71
WP_011147614.1|4047256_4048684_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	73.2	2.3e-205
WP_011147615.1|4048673_4048886_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	41.9	5.4e-07
WP_011147616.1|4048882_4049350_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	53.4	1.4e-39
WP_041380252.1|4049349_4049787_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	47.7	3.6e-29
WP_011147618.1|4049788_4050139_-	DUF2190 family protein	NA	Q6QIB4	Burkholderia_phage	46.9	7.4e-17
WP_011147619.1|4050152_4051088_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.9	1.9e-67
WP_011147620.1|4051119_4052214_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	1.3e-99
WP_011147621.1|4052418_4052868_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	40.6	4.0e-23
WP_041380253.1|4052860_4053691_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	62.9	9.7e-100
WP_011147623.1|4053671_4055165_-	DUF935 domain-containing protein	NA	Q6QIC0	Burkholderia_phage	59.3	5.5e-170
WP_011147624.1|4055164_4056688_-	hypothetical protein	NA	Q6QIC1	Burkholderia_phage	61.8	5.4e-181
WP_011147625.1|4056684_4057230_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	65.4	4.3e-56
WP_011147626.1|4057229_4057541_-	hypothetical protein	NA	A0A2H4JGU5	uncultured_Caudovirales_phage	61.0	2.3e-30
WP_011147627.1|4057533_4057866_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	6.8e-20
WP_011147628.1|4057862_4058486_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	33.3	2.0e-09
WP_011147629.1|4058475_4059093_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J7R8	uncultured_Caudovirales_phage	51.7	4.6e-54
WP_011147630.1|4059095_4059446_-	membrane protein	NA	A4JWP3	Burkholderia_virus	52.3	7.1e-20
WP_011147631.1|4059696_4060467_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.9	1.3e-98
WP_011147632.1|4060514_4060952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125043781.1|4060969_4061335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380254.1|4061435_4061780_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_041380255.1|4062299_4062485_+	DNA-binding protein	NA	A0A0S4L0D0	Pseudomonas_phage	71.4	1.9e-16
WP_011147637.1|4062540_4062849_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	49.0	2.0e-18
WP_041380256.1|4062868_4063825_+	hypothetical protein	NA	A4JWN3	Burkholderia_virus	44.1	1.1e-62
WP_011147639.1|4063878_4065663_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	54.3	1.3e-181
WP_011147640.1|4065901_4067074_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	58.8	8.0e-116
WP_011147641.1|4067532_4067724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147643.1|4068245_4068614_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.4	4.4e-28
WP_011147645.1|4069363_4069564_-	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	53.1	1.4e-09
WP_011147649.1|4070559_4071153_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	54.1	9.2e-60
WP_011147650.1|4071253_4072453_-	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	31.0	6.6e-49
WP_011147652.1|4073565_4074933_-	DNA helicase	NA	K7P852	Enterobacteria_phage	44.1	1.1e-92
WP_011147653.1|4074934_4075519_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	48.1	6.7e-47
WP_011147654.1|4075527_4076280_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	48.1	1.6e-29
WP_011147655.1|4076282_4076507_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	47.9	6.6e-11
WP_011147656.1|4076521_4076971_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	53.7	5.7e-30
WP_041380257.1|4077028_4077256_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD1	Pseudomonas_phage	42.0	1.4e-05
4085181:4085215	attR	GGACGCGGGTTCAACTCCCGCCAGCTCCACCAAAT	NA	NA	NA	NA
>prophage 21
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	4080517	4089617	5688984		Pectobacterium_phage(37.5%)	11	NA	NA
WP_011147662.1|4080517_4082278_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	38.3	3.1e-119
WP_011147663.1|4082274_4082772_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	63.2	1.4e-50
WP_011147664.1|4082823_4083012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147665.1|4083581_4083752_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	53.6	3.0e-08
WP_011147666.1|4083756_4083972_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	71.7	3.0e-21
WP_049789790.1|4085552_4085768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147669.1|4085831_4086062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147670.1|4086058_4086328_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	61.5	2.1e-16
WP_109791736.1|4086675_4087086_-	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	57.9	1.9e-35
WP_011147672.1|4087139_4087313_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	66.7	3.7e-14
WP_041380260.1|4089080_4089617_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	54.9	2.0e-42
>prophage 22
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	4179205	4187671	5688984	transposase,tRNA	Sodalis_phage(16.67%)	7	NA	NA
WP_109791748.1|4179205_4180213_-|transposase	ISNCY-like element ISPlu15 family transposase	transposase	Q2A0A7	Sodalis_phage	64.6	9.7e-78
WP_011147727.1|4180416_4181040_-	CatB-related O-acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	38.7	1.5e-20
WP_109791749.1|4181515_4183030_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	1.8e-83
WP_109791750.1|4183039_4184138_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
WP_011147730.1|4184295_4186029_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.6	9.8e-62
WP_011147731.1|4186028_4186736_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_011147732.1|4186759_4187671_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.4	2.2e-28
>prophage 23
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	4357606	4421731	5688984	holin,transposase,lysis	Wolbachia_phage(18.18%)	49	NA	NA
WP_011144727.1|4357606_4358989_+|transposase	IS4-like element ISPlu9 family transposase	transposase	Q9JMP3	Wolbachia_phage	28.1	2.9e-40
WP_125026219.1|4359033_4359294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147852.1|4359523_4360654_-	site-specific tyrosine recombinase XerC	NA	S5W9T9	Leptospira_phage	31.4	3.8e-14
WP_011147856.1|4360640_4363955_-	toprim domain-containing protein	NA	C7F4F5	Cyanophage	23.9	1.9e-13
WP_011147857.1|4364087_4364450_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011147858.1|4364522_4364750_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_109791993.1|4364802_4365129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041381087.1|4365164_4365500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144727.1|4366496_4367879_+|transposase	IS4-like element ISPlu9 family transposase	transposase	Q9JMP3	Wolbachia_phage	28.1	2.9e-40
WP_157866891.1|4367923_4368181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791782.1|4368410_4369541_-	site-specific tyrosine recombinase XerC	NA	A0A1B1P7C7	Bacillus_phage	23.6	1.6e-07
WP_109791783.1|4369527_4372845_-	toprim domain-containing protein	NA	C7F4F5	Cyanophage	24.1	3.9e-14
WP_011147857.1|4372977_4373340_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011147858.1|4373412_4373640_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_109791993.1|4373692_4374019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791784.1|4374054_4383138_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	36.6	2.8e-46
WP_109791785.1|4383186_4384851_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_011147864.1|4385659_4386340_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_109791787.1|4386393_4387086_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011144720.1|4387627_4388653_-|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_109791788.1|4388685_4389120_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011147866.1|4389397_4390924_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_011147867.1|4391033_4392482_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011147868.1|4392474_4393797_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_011147869.1|4394071_4394971_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011144720.1|4395508_4396534_-|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011147870.1|4396576_4397143_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_041381091.1|4397835_4398045_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	67.2	2.7e-19
WP_011147872.1|4398178_4399357_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_109791789.1|4399343_4400798_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_011147874.1|4400955_4401957_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011147875.1|4402187_4402862_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_058588601.1|4403541_4403748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011147876.1|4403985_4404651_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_011147877.1|4405164_4406235_-	magnesium transporter	NA	NA	NA	NA	NA
WP_011147878.1|4406657_4406990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380310.1|4407259_4407517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011147879.1|4407506_4408643_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011147880.1|4409208_4410693_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011147881.1|4410738_4412106_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_041381095.1|4412848_4414438_+	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_011147883.1|4414482_4415340_-	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
WP_011147884.1|4415587_4417735_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_011147885.1|4417796_4418225_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_011147886.1|4418224_4419370_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_011147887.1|4420050_4420446_+	VOC family protein	NA	NA	NA	NA	NA
WP_011147888.1|4420534_4420984_-|lysis	lysis protein	lysis	G0ZNC9	Cronobacter_phage	41.9	7.2e-17
WP_011147889.1|4420993_4421395_-	hypothetical protein	NA	A0A0A0RQM4	Escherichia_phage	55.4	2.7e-39
WP_011147890.1|4421404_4421731_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	61.4	5.2e-25
>prophage 24
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	4799566	4859954	5688984	transposase	Hyperthermophilic_Archaeal_Virus_2(20.0%)	43	NA	NA
WP_011144722.1|4799566_4800451_+|transposase	IS982-like element ISPlu11 family transposase	transposase	NA	NA	NA	NA
WP_011148233.1|4802077_4803178_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_011148234.1|4803368_4803950_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_109791998.1|4803946_4804834_-	hypothetical protein	NA	A0A2H4JEI4	uncultured_Caudovirales_phage	38.4	1.5e-21
WP_011148236.1|4805530_4805962_-	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	47.6	3.9e-28
WP_011148237.1|4806465_4807818_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_011148238.1|4807997_4809074_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	48.4	6.0e-09
WP_011148239.1|4809123_4810101_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	24.8	1.1e-22
WP_011148240.1|4810632_4811046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144720.1|4811363_4812389_-|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011148241.1|4813327_4815124_+	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.8	2.0e-17
WP_011148242.1|4815116_4815851_+	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011148243.1|4815867_4816260_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_011148244.1|4816276_4816630_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_011144786.1|4816832_4817717_+|transposase	IS982-like element ISPlu6 family transposase	transposase	NA	NA	NA	NA
WP_011148245.1|4817906_4818221_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_011148246.1|4818446_4819013_-	elongation factor P	NA	NA	NA	NA	NA
WP_011148247.1|4819050_4820079_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_011148248.1|4820138_4820483_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_011148249.1|4821266_4822175_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011148250.1|4822821_4824468_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	66.7	1.8e-185
WP_011148251.1|4824517_4824811_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	35.8	1.4e-08
WP_011148252.1|4825008_4825497_-	FxsA family protein	NA	NA	NA	NA	NA
WP_011148253.1|4825874_4827299_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_011148254.1|4827439_4828741_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_011148255.1|4828925_4830653_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_041380362.1|4830670_4831243_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_011148258.1|4832187_4841181_-	cytotoxin	NA	NA	NA	NA	NA
WP_109791840.1|4842059_4843319_-	agmatinase	NA	NA	NA	NA	NA
WP_041380364.1|4843315_4844041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148261.1|4844033_4845887_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.4	4.3e-23
WP_011148262.1|4845895_4846333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157866909.1|4846483_4846789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148264.1|4846855_4850539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144720.1|4851036_4852062_+|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_041380367.1|4852622_4854290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380369.1|4854807_4855098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148265.1|4855313_4855778_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011148266.1|4856039_4856654_+	LysE family translocator	NA	NA	NA	NA	NA
WP_125026256.1|4856995_4857307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145659.1|4857555_4857984_-|transposase	IS200/IS605-like element ISPlu2 family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	37.9	2.8e-18
WP_041381140.1|4858052_4859135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011145659.1|4859525_4859954_+|transposase	IS200/IS605-like element ISPlu2 family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	37.9	2.8e-18
>prophage 25
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	4863570	4947644	5688984	transposase,plate	Stx2-converting_phage(14.29%)	60	NA	NA
WP_011145417.1|4863570_4865076_-|transposase	IS66-like element ISPlu20 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.5	1.3e-89
WP_011144475.1|4865139_4865475_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_049789715.1|4865468_4865834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157866910.1|4865840_4866014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148271.1|4866094_4869226_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_011148272.1|4869359_4874054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791841.1|4874148_4877049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148274.1|4877476_4877944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148275.1|4878052_4878520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148276.1|4878611_4879079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148277.1|4879188_4879650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148278.1|4879757_4880225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148279.1|4880333_4880801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148280.1|4880909_4881368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148281.1|4881364_4883026_-	hypothetical protein	NA	A4PE23	Ralstonia_virus	48.1	3.6e-05
WP_011148282.1|4883426_4884350_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011148283.1|4884346_4885618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148284.1|4885647_4888053_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_011148285.1|4888054_4889185_-	acyl-protein synthase	NA	NA	NA	NA	NA
WP_011148286.1|4890897_4893795_+	toxin	NA	NA	NA	NA	NA
WP_011148287.1|4894111_4895215_-	cytochrome P450	NA	NA	NA	NA	NA
WP_011148288.1|4896243_4896588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148289.1|4897231_4897933_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_011148290.1|4898885_4900040_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011148291.1|4900059_4901502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148292.1|4901501_4903049_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.4	4.4e-13
WP_011148293.1|4903072_4903321_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_011148294.1|4903355_4904471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148295.1|4904463_4905750_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_011148296.1|4906401_4907217_-	cyclase family protein	NA	NA	NA	NA	NA
WP_011148297.1|4907209_4907923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148298.1|4907925_4908702_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_158537556.1|4909676_4909982_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_011148300.1|4910084_4910498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148301.1|4911017_4911512_-	hypothetical protein	NA	A0A2L1IV91	Escherichia_phage	75.3	5.3e-29
WP_011148302.1|4911697_4913077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148303.1|4913128_4913563_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_011148304.1|4913566_4914103_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_041380379.1|4914083_4915160_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_011148306.1|4915123_4916890_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011148307.1|4916968_4918567_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_041380381.1|4918732_4919494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148310.1|4919686_4920688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125043791.1|4920764_4921052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144727.1|4921257_4922640_+|transposase	IS4-like element ISPlu9 family transposase	transposase	Q9JMP3	Wolbachia_phage	28.1	2.9e-40
WP_011148311.1|4923245_4925852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148312.1|4925952_4926444_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_011148315.1|4927188_4930548_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_011148316.1|4930540_4931716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041380383.1|4931718_4931991_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_011148318.1|4932021_4932690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148319.1|4932875_4933865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148320.1|4933942_4934953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791842.1|4934949_4937550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791843.1|4937549_4938590_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_109791844.1|4938600_4940979_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	26.7	2.0e-04
WP_058589813.1|4940975_4943657_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.4	9.2e-91
WP_058589812.1|4943905_4945582_-	OmpA family protein	NA	NA	NA	NA	NA
WP_011148326.1|4945598_4946243_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_058589811.1|4946285_4947644_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 26
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	5040234	5102150	5688984	tail,transposase,tRNA	Lactobacillus_prophage(11.76%)	52	NA	NA
WP_011144786.1|5040234_5041119_+|transposase	IS982-like element ISPlu6 family transposase	transposase	NA	NA	NA	NA
WP_011148410.1|5041959_5042172_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_011148411.1|5042171_5043047_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	35.5	3.8e-30
WP_109791866.1|5043962_5045519_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.1	1.5e-101
WP_109791867.1|5045515_5046613_+	restriction endonuclease subunit S	NA	A0A2H4UVW8	Bodo_saltans_virus	22.9	3.4e-07
WP_011148414.1|5046614_5047769_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_109791868.1|5047794_5050911_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_011148417.1|5051682_5053308_-	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	48.9	6.1e-90
WP_109791870.1|5054137_5055010_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_011148419.1|5055207_5057193_-	DUF3732 domain-containing protein	NA	NA	NA	NA	NA
WP_011148420.1|5057195_5057678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148421.1|5057680_5058889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148423.1|5059680_5059986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157866911.1|5060021_5060165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148425.1|5060493_5061603_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.6	1.6e-33
WP_011148426.1|5061725_5062574_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011148427.1|5063485_5063815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148429.1|5064174_5065647_+	carotenoid oxygenase family protein	NA	NA	NA	NA	NA
WP_011148430.1|5065881_5066784_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.9	1.0e-09
WP_049789804.1|5066806_5067229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011144786.1|5067241_5068126_-|transposase	IS982-like element ISPlu6 family transposase	transposase	NA	NA	NA	NA
WP_082303141.1|5068243_5068834_+	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_011148431.1|5068947_5070123_+	lycopene beta-cyclase CrtY	NA	NA	NA	NA	NA
WP_011148432.1|5070115_5071597_+	phytoene desaturase	NA	NA	NA	NA	NA
WP_011148433.1|5071593_5072520_+	phytoene/squalene synthase family protein	NA	NA	NA	NA	NA
WP_011148434.1|5073283_5076442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148435.1|5076442_5077003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148436.1|5076992_5078318_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_011148437.1|5078307_5079390_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_011148439.1|5080303_5080840_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	8.9e-54
WP_011148440.1|5081198_5084033_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.3	5.2e-312
WP_011148441.1|5084093_5085032_-	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_011148442.1|5085034_5086120_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041381194.1|5086808_5086985_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	50.0	1.3e-09
WP_109791871.1|5087036_5087444_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	77.6	1.0e-49
WP_011148445.1|5087515_5087770_-	cloacin	NA	NA	NA	NA	NA
WP_011148446.1|5087818_5088832_-|transposase	IS630-like element ISPlu10 family transposase	transposase	NA	NA	NA	NA
WP_011148447.1|5089224_5090424_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011148448.1|5090473_5091553_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.5	1.3e-27
WP_011148449.1|5091592_5093002_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	76.8	2.7e-195
WP_011148450.1|5093172_5094156_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_011148451.1|5094366_5094744_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	54.4	1.6e-30
WP_049789805.1|5094721_5095318_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	44.3	1.2e-38
WP_011148452.1|5095360_5096386_-|transposase	IS630-like element ISPlu3 family transposase	transposase	NA	NA	NA	NA
WP_011148453.1|5096435_5096882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148454.1|5097462_5098500_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_011148455.1|5098916_5099201_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	57.6	3.9e-24
WP_082303155.1|5099197_5099353_-	hypothetical protein	NA	A0A2I6TCA4	Escherichia_phage	71.7	2.9e-10
WP_011148457.1|5099641_5099938_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_041380399.1|5100140_5100719_-	glyoxalase/Bleomycin resistance protein/dioxygenase superfamily	NA	NA	NA	NA	NA
WP_041380400.1|5100885_5101311_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	48.6	6.2e-26
WP_011148460.1|5101313_5102150_-|tail	tail fiber protein	tail	NA	NA	NA	NA
>prophage 27
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	5185073	5228812	5688984	holin,transposase,integrase	uncultured_Caudovirales_phage(27.27%)	35	5216906:5216920	5229037:5229051
WP_011146066.1|5185073_5186099_-|transposase	IS630-like element ISPlu3 family transposase	transposase	NA	NA	NA	NA
WP_011148524.1|5186644_5186971_-|holin	holin	holin	O80283	Phage_PS3	42.4	9.0e-17
WP_011148525.1|5187745_5188093_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011148526.1|5188295_5188667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011144854.1|5188972_5189986_-|transposase	IS630-like element ISPlu10 family transposase	transposase	NA	NA	NA	NA
WP_011148527.1|5193034_5193556_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011148528.1|5193557_5194523_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_109791880.1|5194607_5196968_+	TonB-dependent receptor family protein	NA	NA	NA	NA	NA
WP_011148530.1|5197027_5197936_+	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_011148531.1|5197932_5198931_+	iron-dicitrate ABC transporter permease FecC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.2	1.3e-10
WP_011148532.1|5198927_5199884_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_109791881.1|5199884_5200652_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	W5SAS9	Pithovirus	28.1	3.0e-18
WP_109791882.1|5201180_5204492_+	helicase	NA	NA	NA	NA	NA
WP_109791883.1|5204659_5206762_+	RecQ family ATP-dependent DNA helicase	NA	Q9DSV4	Diadromus_pulchellus_ascovirus	31.5	1.2e-40
WP_011148536.1|5206758_5208180_+	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_049789806.1|5208776_5209058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041380411.1|5210408_5210831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109791884.1|5211175_5212297_+	ATP-binding protein	NA	R4TQL5	Phaeocystis_globosa_virus	28.8	1.8e-16
WP_011148539.1|5212319_5214545_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_011148540.1|5214638_5215070_-	antitermination protein Q	NA	B6SCZ7	Bacteriophage	43.4	1.2e-24
WP_011148541.1|5215483_5216749_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1V0E8G8	Vibrio_phage	33.3	3.8e-63
5216906:5216920	attL	CGAAGGCCGGACTCG	NA	NA	NA	NA
WP_011148542.1|5217245_5218238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148547.1|5220894_5221218_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011148548.1|5221201_5221561_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_125026260.1|5221663_5221891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125026261.1|5222068_5222248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148551.1|5222563_5223430_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_041380412.1|5223432_5223654_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	47.1	2.0e-07
WP_041380413.1|5223646_5224726_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.0	2.2e-120
WP_011148553.1|5225260_5225521_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011148554.1|5225549_5225816_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_011148555.1|5225787_5226075_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	66.7	2.1e-17
WP_011148556.1|5226191_5226455_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_125026262.1|5226557_5227379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148558.1|5227555_5228812_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	41.2	2.6e-80
5229037:5229051	attR	CGAAGGCCGGACTCG	NA	NA	NA	NA
>prophage 28
NZ_CP015281	Photorhabdus laumondii subsp. laumondii strain DSPV002N chromosome, complete genome	5688984	5323656	5381219	5688984	tRNA,transposase,protease,plate	Lactococcus_phage(18.18%)	52	NA	NA
WP_011144720.1|5323656_5324682_+|transposase	IS630-like element ISPlu19 family transposase	transposase	NA	NA	NA	NA
WP_011148636.1|5325124_5325745_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011148637.1|5326015_5326732_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011148638.1|5326768_5328079_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_049789808.1|5328089_5329277_-	MFS transporter	NA	NA	NA	NA	NA
WP_011148640.1|5329528_5331226_-	hypothetical protein	NA	E3SL39	Synechococcus_phage	29.2	1.6e-64
WP_011148641.1|5331249_5332053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011148642.1|5332049_5333240_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011148643.1|5333229_5334258_-	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	39.0	1.5e-57
WP_011144786.1|5335044_5335929_-|transposase	IS982-like element ISPlu6 family transposase	transposase	NA	NA	NA	NA
WP_011148644.1|5336220_5336673_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|5336711_5336939_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_011148645.1|5336943_5337261_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_011148646.1|5337266_5337662_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_011148647.1|5337965_5338700_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_011148648.1|5338827_5341269_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.0	2.8e-62
WP_011148649.1|5341313_5341739_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_011148650.1|5341929_5343228_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.1	9.9e-67
WP_011148651.1|5343375_5344386_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011148652.1|5344391_5345612_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011148653.1|5345717_5346998_-	GTPase HflX	NA	NA	NA	NA	NA
WP_011148654.1|5347094_5347403_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_011148655.1|5347513_5348455_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_058588966.1|5348447_5350343_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.6	5.3e-61
WP_058588967.1|5350352_5351636_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	30.7	4.9e-18
WP_109792004.1|5352287_5353445_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011148661.1|5354313_5354745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791894.1|5354874_5355792_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011148663.1|5355940_5357131_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_109791895.1|5357149_5358145_+	DMT family transporter	NA	NA	NA	NA	NA
WP_109791896.1|5358408_5358720_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011148666.1|5359022_5359298_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_109791897.1|5359294_5359630_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011148668.1|5360188_5360734_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	2.6e-29
WP_011148669.1|5360827_5361883_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_049789850.1|5361960_5362851_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_011148671.1|5362877_5366213_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_109791898.1|5366821_5368555_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011148674.1|5368569_5370546_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011148675.1|5370542_5371034_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	36.0	4.4e-15
WP_011148676.1|5371036_5371381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148677.1|5371382_5371991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109791899.1|5372014_5372737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148679.1|5372739_5373003_+	PAAR domain-containing protein	NA	Q8W6S2	Burkholderia_virus	43.8	5.0e-10
WP_011148680.1|5373166_5373799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148681.1|5373847_5374582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148682.1|5374584_5374848_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	41.2	2.5e-09
WP_011148683.1|5375011_5375638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148684.1|5375664_5376399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011148685.1|5378105_5378555_+	Ati1 family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_011148686.1|5378597_5380091_+	VPA0450 family T3SS effector inositol phosphatase	NA	NA	NA	NA	NA
WP_011148688.1|5380763_5381219_-|transposase	IS200/IS605-like element ISPlu5 family transposase	transposase	I4AZI8	Saccharomonospora_phage	36.4	2.3e-18
