The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014965	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 chromosome, complete genome	4799398	1171306	1229686	4799398	transposase,integrase	Stx2-converting_phage(25.0%)	53	1201775:1201789	1237231:1237245
WP_085983317.1|1171306_1172469_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
WP_000073810.1|1172747_1174730_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000061088.1|1174726_1175365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682341.1|1177078_1177675_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
WP_010989066.1|1178252_1179536_+	membrane protein	NA	NA	NA	NA	NA
WP_001521074.1|1179795_1181670_-	membrane protein	NA	NA	NA	NA	NA
WP_000088556.1|1181835_1182711_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000021514.1|1183827_1185507_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000819716.1|1185729_1187271_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000811366.1|1187400_1188243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603456.1|1188242_1188806_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000776032.1|1188829_1189465_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_000889012.1|1189538_1190741_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001033832.1|1191035_1192049_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_020837104.1|1192059_1193040_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000973738.1|1193036_1193411_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000480483.1|1193407_1193929_-	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_063320250.1|1194041_1194287_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	62.9	4.8e-15
WP_010989065.1|1194421_1194778_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989064.1|1194931_1195750_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_001520831.1|1195794_1197078_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001682408.1|1197305_1197983_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1197982_1198330_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1198349_1199921_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001520307.1|1200205_1202275_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
1201775:1201789	attL	GGTGATGGCGGTGAC	NA	NA	NA	NA
WP_000701821.1|1202310_1202526_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001161781.1|1202976_1203804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|1204138_1205332_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_010989063.1|1205721_1206315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020837107.1|1208091_1208940_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_020837108.1|1209015_1209210_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_020837109.1|1209235_1209727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020837110.1|1209723_1210101_-	toxin of the YeeV-YeeU toxin-antitoxin system	NA	NA	NA	NA	NA
WP_020837111.1|1210160_1210808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165845994.1|1210804_1211146_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_020837113.1|1211202_1211424_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000437750.1|1211444_1211924_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_020837114.1|1211935_1212406_-	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	35.1	8.1e-11
WP_001614356.1|1212673_1213492_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.2	9.7e-44
WP_001614358.1|1213611_1213845_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_020837115.1|1213921_1214374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104018.1|1214433_1214976_-	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_000734138.1|1215038_1215491_-	hypothetical protein	NA	J7KKK1	Erwinia_phage	50.8	1.0e-34
WP_020837116.1|1215487_1215943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020837117.1|1215981_1216617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020837118.1|1216613_1217327_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_020837119.1|1217587_1218463_-	GTPase family protein	NA	NA	NA	NA	NA
WP_020837120.1|1218775_1220905_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	28.0	1.2e-32
WP_020837121.1|1220901_1223475_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_024159583.1|1223565_1224192_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_071931434.1|1226064_1226277_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016246229.1|1227620_1228382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016246228.1|1228444_1229686_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	2.4e-102
1237231:1237245	attR	GGTGATGGCGGTGAC	NA	NA	NA	NA
>prophage 2
NZ_CP014965	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 chromosome, complete genome	4799398	1664424	1694010	4799398	protease,holin,tail	Salmonella_phage(33.33%)	31	NA	NA
WP_000781589.1|1664424_1664919_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1665332_1665824_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1665813_1666077_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1666073_1668560_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1668566_1669262_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1669248_1670118_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1670233_1670683_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1670692_1671295_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1671315_1671933_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1671929_1672589_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1672640_1673378_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1673374_1673587_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1673583_1674063_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1674059_1675991_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1675987_1676545_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_020899389.1|1676541_1677585_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1677628_1678276_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1679005_1679569_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1679760_1679964_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1680266_1681058_+|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1681354_1681558_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1681726_1684093_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1684421_1685411_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1685425_1685794_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1685822_1687154_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1687450_1687780_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1688372_1689614_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1689616_1690144_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1690521_1690965_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000884778.1|1693188_1693479_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1693506_1694010_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 3
NZ_CP014965	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 chromosome, complete genome	4799398	1766773	1775944	4799398	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1766773_1767721_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824855.1|1767704_1768436_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1768416_1768524_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1768583_1769315_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1769537_1771223_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1771219_1771939_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1771985_1772453_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1772509_1773040_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1773211_1773670_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1773910_1775944_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP014965	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 chromosome, complete genome	4799398	1844252	1854758	4799398		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1844252_1845656_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1845833_1846727_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1847103_1848189_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1848188_1849088_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1849135_1850014_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1850014_1850566_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1850571_1851564_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1851560_1852334_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1852338_1853418_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1853444_1854758_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP014965	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 chromosome, complete genome	4799398	1944101	1951355	4799398		Morganella_phage(33.33%)	8	NA	NA
WP_000394196.1|1944101_1944521_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|1944523_1945792_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1946246_1946459_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1946469_1946658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|1946918_1948115_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|1948764_1949064_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|1949155_1949851_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|1949924_1951355_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP014965	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 chromosome, complete genome	4799398	2055399	2062208	4799398	integrase,tail	Salmonella_phage(33.33%)	11	2057609:2057631	2067324:2067346
WP_000856224.1|2055399_2055630_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2055767_2056142_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2056142_2057018_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2057034_2057388_+	YebY family protein	NA	NA	NA	NA	NA
2057609:2057631	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2057761_2058616_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2058675_2059170_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2059359_2059590_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2059643_2060177_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2060433_2060601_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2060665_2060854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2061326_2062208_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2067324:2067346	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP014965	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 chromosome, complete genome	4799398	2852696	2943613	4799398	protease,holin,lysis,terminase,tRNA,tail	Salmonella_phage(58.7%)	91	NA	NA
WP_000938191.1|2852696_2853377_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2853997_2854657_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2854743_2855073_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2855069_2855351_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2855399_2856179_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000859419.1|2856204_2856753_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2856967_2858179_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2858236_2858554_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2858598_2859012_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2859185_2859848_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2859942_2860401_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2860436_2862491_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2862614_2863061_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2863079_2865233_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2865219_2865825_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2866041_2866551_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2866907_2867960_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2868031_2868484_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2868669_2870430_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2870498_2871017_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2871116_2871284_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2871539_2872103_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2872099_2873740_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2873744_2874998_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2875012_2876920_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2876932_2879041_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2879139_2880249_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001220671.1|2880245_2880788_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2880953_2881964_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2882171_2884784_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2885210_2885402_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2885672_2886359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603423.1|2886343_2886643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2886711_2887338_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2887985_2888954_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000143167.1|2889429_2890011_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_031247858.1|2890010_2892449_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000178849.1|2892502_2892745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541993.1|2892783_2893659_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_001576012.1|2896205_2896910_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|2896807_2897545_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2897554_2898250_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2898339_2898873_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2898989_2899487_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_020899435.1|2899586_2899919_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000867564.1|2901039_2901585_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_024143045.1|2902053_2902500_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000984584.1|2902517_2902970_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_077248428.1|2902953_2903283_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_001141973.1|2903558_2904245_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2904605_2905055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2905190_2905316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020899439.1|2905510_2906200_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.2	2.4e-59
WP_000801757.1|2906196_2906337_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096542.1|2906333_2906945_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000929788.1|2907153_2907756_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_000763780.1|2907840_2908062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|2908171_2908405_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_022630855.1|2908996_2909593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|2909604_2910582_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001536080.1|2910636_2910894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208142.1|2910893_2911538_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_000850457.1|2911541_2911850_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000065109.1|2911853_2912312_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_020899441.1|2912308_2912656_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000800012.1|2912666_2913416_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000062943.1|2913418_2914402_-	replication protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000426364.1|2914486_2914807_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_001555460.1|2914841_2915069_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|2915174_2915609_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_000917559.1|2915905_2916037_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_023139985.1|2916085_2916436_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_020899444.1|2916562_2919763_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	78.8	0.0e+00
WP_014344386.1|2919725_2920883_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|2920925_2921165_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2921205_2921454_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_020899445.1|2921498_2922791_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000191399.1|2922985_2924188_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2924265_2925702_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2925946_2927161_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2927477_2927939_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2928139_2929540_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|2930146_2931238_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|2931422_2932613_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|2932674_2933322_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|2933349_2933898_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|2934157_2935999_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572724.1|2936343_2940810_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000060025.1|2940809_2941514_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|2941494_2942817_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|2942809_2943613_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP014965	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 chromosome, complete genome	4799398	2993676	3002408	4799398	transposase,protease	Enterobacteria_phage(16.67%)	6	NA	NA
WP_085983316.1|2993676_2994931_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|2995394_2995853_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|2996044_2998321_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2998351_2998672_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2998995_2999217_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_001201751.1|3001289_3002408_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 9
NZ_CP014965	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 chromosome, complete genome	4799398	3615032	3660685	4799398	transposase,portal,protease,holin,lysis,terminase,coat,integrase	Salmonella_phage(44.78%)	68	3601716:3601732	3669900:3669916
3601716:3601732	attL	ACGCGAATTTCAATATC	NA	NA	NA	NA
WP_096812970.1|3615032_3615323_-	phage antirepressor protein	NA	H6WRU9	Salmonella_phage	43.8	4.7e-09
WP_000749288.1|3615395_3615881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001029838.1|3615971_3617969_-	hypothetical protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
WP_020899470.1|3617968_3619273_-	DNA transfer protein	NA	E7C9U5	Salmonella_phage	95.4	1.6e-210
WP_000964898.1|3619283_3619973_-	hypothetical protein	NA	E7C9U4	Salmonella_phage	99.6	1.2e-108
WP_000627695.1|3619975_3620431_-	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
WP_020899471.1|3620430_3621132_-	hypothetical protein	NA	A0A0M4QWW6	Salmonella_phage	97.4	4.8e-76
WP_020899472.1|3621135_3622554_-	packaged DNA stabilization protein gp10	NA	E7C9U1	Salmonella_phage	99.4	2.1e-275
WP_001166103.1|3622513_3623014_-	packaged DNA stabilization gp4 family protein	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538670.1|3622997_3623558_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_020899473.1|3623598_3624891_-|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.3	3.2e-243
WP_020899474.1|3624890_3625802_-	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	99.7	2.4e-160
WP_000774652.1|3625815_3627993_-|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000417860.1|3627992_3629492_-|terminase	terminase large subunit	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000729923.1|3629469_3629958_-	DNA-packaging protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3629961_3630366_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3630365_3630755_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3630758_3631001_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_015995148.1|3631223_3631754_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	100.0	1.3e-94
WP_001687043.1|3631966_3632434_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3632430_3632928_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3632905_3633109_-|holin	phage holin family protein	holin	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047566.1|3633539_3634313_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|3634309_3634489_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|3634469_3634673_-	phage NinH family protein	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|3634669_3634894_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001107939.1|3634890_3635496_-	recombination protein NinG	NA	E7C9S3	Salmonella_phage	100.0	7.1e-100
WP_020899477.1|3635488_3635665_-	protein ninF	NA	I6S668	Salmonella_phage	98.3	4.3e-26
WP_001531428.1|3635657_3635990_-	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000113772.1|3635992_3636169_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_000679702.1|3636135_3636309_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_020899478.1|3636305_3636743_-	recombination protein NinB	NA	A8CGE3	Salmonella_phage	99.3	1.4e-78
WP_001248406.1|3636816_3638193_-	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000067075.1|3638189_3639005_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001125981.1|3638997_3639144_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_020833632.1|3639227_3640841_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.6	5.0e-177
WP_001405209.1|3640871_3641222_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	4.7e-40
WP_004018134.1|3641218_3641638_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	95.9	2.2e-47
WP_063320258.1|3641688_3641991_-	lambda phage CII family protein	NA	Q5G8T2	Enterobacteria_phage	100.0	2.6e-42
WP_001180316.1|3642126_3642354_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	89.3	2.1e-33
WP_000250476.1|3642431_3643142_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	87.7	4.0e-118
WP_020899481.1|3643227_3644151_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	99.7	4.3e-181
WP_020899482.1|3644186_3644390_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	98.5	7.7e-27
WP_024143050.1|3644757_3645120_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	88.3	1.1e-52
WP_000843522.1|3645136_3645580_+	hypothetical protein	NA	E5AGE5	Erwinia_phage	62.6	3.0e-47
WP_020899485.1|3646202_3646481_+	hypothetical protein	NA	C6ZR42	Salmonella_phage	98.9	2.3e-45
WP_000776963.1|3646756_3647071_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3647155_3647314_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000156731.1|3647294_3647483_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902092.1|3647472_3647616_+	hypothetical protein	NA	A0A2H5BFM6	Salmonella_phage	100.0	6.4e-20
WP_001046968.1|3647612_3648320_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|3648319_3648604_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_020899486.1|3648650_3648944_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	93.8	4.8e-46
WP_001214777.1|3648954_3649125_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_020899487.1|3649121_3649712_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	73.9	1.7e-74
WP_020899488.1|3649878_3650529_+	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	68.4	4.5e-52
WP_000161224.1|3650530_3650749_+	DUF4014 family protein	NA	C6ZR28	Salmonella_phage	97.2	7.0e-34
WP_000208144.1|3650752_3651145_+	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	59.5	1.0e-38
WP_001682408.1|3651231_3651909_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3651908_3652256_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3652275_3653847_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_046072967.1|3653884_3654409_+	DUF551 domain-containing protein	NA	A0A220NQT9	Salmonella_phage	97.0	8.6e-94
WP_020899490.1|3654401_3654686_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	97.9	1.7e-48
WP_024143053.1|3654756_3655386_+	hypothetical protein	NA	A0A220NQT7	Salmonella_phage	94.3	4.0e-114
WP_000051898.1|3655615_3656779_+|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	100.0	6.3e-230
WP_000893231.1|3656984_3658235_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|3658246_3659350_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3659632_3660685_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
3669900:3669916	attR	ACGCGAATTTCAATATC	NA	NA	NA	NA
>prophage 10
NZ_CP014965	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 chromosome, complete genome	4799398	3704550	3765373	4799398	transposase,protease,tRNA,plate	Saccharomonospora_phage(22.22%)	53	NA	NA
WP_000118732.1|3704550_3705894_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001007106.1|3705897_3706434_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119443.1|3706500_3706986_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000379146.1|3707128_3707512_-	type VI secretion system amidase immunity protein Tai4	NA	NA	NA	NA	NA
WP_001081550.1|3707496_3707982_-	type VI secretion system amidase effector protein Tae4	NA	NA	NA	NA	NA
WP_000312802.1|3708286_3708772_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_014344502.1|3709025_3709358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013881.1|3709657_3711166_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000996817.1|3711189_3711732_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000449778.1|3711831_3714471_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.5	1.1e-77
WP_000806681.1|3714838_3715741_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000750535.1|3715727_3716552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108007.1|3716548_3717043_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371508.1|3717058_3718942_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145244.1|3718938_3719934_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000367626.1|3719944_3721000_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001670675.1|3721531_3722263_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000917872.1|3722326_3722794_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_000801238.1|3722790_3723513_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052775.1|3723547_3724303_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644706.1|3724374_3725742_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_000207224.1|3725797_3726568_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230968.1|3726645_3727446_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001127538.1|3727577_3728753_-	MFS transporter	NA	NA	NA	NA	NA
WP_000648534.1|3728857_3729772_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000154871.1|3729792_3730596_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	2.1e-38
WP_001051726.1|3736851_3737418_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594021.1|3737607_3738639_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
WP_001287486.1|3738631_3739285_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874215.1|3739323_3740139_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202315.1|3740257_3740662_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000093986.1|3740658_3741366_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260683.1|3741476_3743195_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000252573.1|3743268_3743970_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000560527.1|3744001_3744424_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185319.1|3744420_3744966_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_001518678.1|3745163_3745364_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062330.1|3745350_3745611_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000210056.1|3745694_3746987_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901088.1|3747049_3747439_-	VOC family protein	NA	NA	NA	NA	NA
WP_001021054.1|3747494_3749636_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_020899493.1|3749711_3751475_-	chitinase	NA	NA	NA	NA	NA
WP_000502119.1|3751713_3752172_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000055753.1|3752365_3753325_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294826.1|3753337_3756820_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569412.1|3756843_3757440_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	1.5e-25
WP_000741212.1|3757436_3758585_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565950.1|3758584_3759373_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210741.1|3759376_3759832_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139265.1|3759937_3760963_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758966.1|3760966_3761452_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240935.1|3761574_3763989_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000949017.1|3764020_3765373_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 11
NZ_CP014965	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 chromosome, complete genome	4799398	4418831	4465875	4799398	holin,tRNA,plate,tail	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4418831_4419830_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4419917_4421228_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4421474_4421990_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4422088_4422298_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4422319_4422433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4422429_4423755_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4423933_4424542_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4424650_4425019_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4425189_4427610_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4427708_4428581_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4428594_4429092_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4429272_4430190_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4430353_4431712_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4431800_4432910_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4433271_4434462_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4434593_4436138_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4436152_4437043_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4437208_4437619_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4437761_4439858_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4439857_4440595_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_125572646.1|4440591_4441260_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4441293_4441536_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4441979_4443629_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4443973_4445323_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4445455_4445803_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4446378_4446666_+|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4446668_4447274_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4447286_4447601_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4447760_4448216_+	Gp37 family protein	NA	NA	NA	NA	NA
WP_000875314.1|4448212_4448410_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_020899514.1|4448399_4449827_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	3.1e-194
WP_000907494.1|4449826_4450351_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4450402_4450720_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4450679_4450808_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4450904_4453259_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4453258_4454212_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4454211_4454421_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4454408_4455452_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4455461_4456184_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4456511_4456874_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4456870_4457800_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4457799_4459347_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4459510_4459870_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4459860_4460976_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4460968_4461601_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4461603_4463349_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4463353_4463959_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4463955_4464411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4464659_4464950_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4465146_4465875_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP016864	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 plasmid pSTY1-2010K-1587, complete sequence	104649	94062	103335	104649	transposase	Stx2-converting_phage(25.0%)	10	NA	NA
WP_000085162.1|94062_95031_+	CbbQ/NirQ/NorQ C-terminal domain-containing protein	NA	L7TKP0	Rhizobium_phage	32.6	2.8e-29
WP_000987165.1|96009_96540_+	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	71.8	2.6e-42
WP_001282585.1|96634_97624_+	phage recombination protein Bet	NA	B5AX97	Iodobacteriophage	39.6	1.1e-52
WP_000706865.1|97685_98696_+	YqaJ viral recombinase family protein	NA	E0YQ48	Mycobacterium_phage	28.7	5.6e-09
WP_020833632.1|98835_100449_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.6	5.0e-177
WP_001405209.1|100479_100830_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	4.7e-40
WP_004018134.1|100826_101246_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	95.9	2.2e-47
WP_000651490.1|101620_102040_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000919078.1|102041_102335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052713385.1|102351_103335_-	ParM/StbA family protein	NA	A7KUY1	Bacillus_phage	24.4	2.1e-08
>prophage 1
NZ_CP016865	Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 plasmid pSTY2-2010K-1587, complete sequence	104250	7281	43431	104250	transposase,integrase	Stx2-converting_phage(20.0%)	45	NA	NA
WP_000608644.1|7281_8544_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000976514.1|8867_10013_+	class C beta-lactamase CMY-2	NA	NA	NA	NA	NA
WP_001221666.1|10106_10640_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	6.1e-47
WP_000118520.1|10636_10954_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_001283341.1|11754_13635_+	colicin 1B	NA	NA	NA	NA	NA
WP_000762570.1|13652_14000_-	colicin 1B immunity protein	NA	NA	NA	NA	NA
WP_000142436.1|14118_14466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194550.1|14483_15074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343103.1|15073_15328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774875.1|15679_16681_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_000793307.1|16856_17201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678527.1|17699_17954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290416.1|17998_18925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813630.1|19482_19701_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|19702_20008_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016969.1|20008_20815_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	94.7	5.4e-55
WP_001144036.1|20994_21639_+	ParA family protein	NA	NA	NA	NA	NA
WP_000030199.1|21725_22034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688514.1|22447_23428_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
WP_001278818.1|23420_23837_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000457493.1|23838_25113_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.4	4.4e-144
WP_000109071.1|25112_25550_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|25546_25795_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000273918.1|26212_27115_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891263.1|27111_27423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086178.1|27499_28183_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.0e-30
WP_001104887.1|28183_28405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274403.1|28416_28851_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_024269763.1|29544_30117_+	YubH family protein	NA	NA	NA	NA	NA
WP_001198928.1|30089_30515_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271725.1|30561_30984_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027500.1|30980_31172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303314.1|31242_31590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276116.1|31941_32469_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	9.3e-48
WP_000006012.1|32526_32760_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001145458.1|32818_34777_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	28.9	4.7e-20
WP_000845897.1|34831_35266_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276260.1|35262_35982_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000942657.1|36111_37287_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	81.6	7.1e-173
WP_000381395.1|37939_39511_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|39530_39878_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001682408.1|39877_40555_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000218863.1|41669_42104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247862.1|42197_42464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038404.1|42528_43431_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	5.8e-66
