The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014981	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1880 isolate ST13123 chromosome, complete genome	4815208	1173291	1269599	4815208	portal,terminase,lysis,tRNA,integrase,tail,capsid,head,plate,transposase	Salmonella_phage(84.0%)	89	1207131:1207177	1240548:1240594
WP_085983317.1|1173291_1174454_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
WP_000073810.1|1174732_1176715_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000061088.1|1176711_1177350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682341.1|1179063_1179660_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
WP_010989066.1|1180237_1181521_+	membrane protein	NA	NA	NA	NA	NA
WP_001521074.1|1181780_1183655_-	membrane protein	NA	NA	NA	NA	NA
WP_000088556.1|1183820_1184696_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000021514.1|1185812_1187492_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000819716.1|1187714_1189256_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000811366.1|1189385_1190228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682344.1|1190227_1190791_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000776032.1|1190814_1191450_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_000889012.1|1191523_1192726_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001033832.1|1193020_1194034_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098984.1|1194044_1195025_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000973738.1|1195021_1195396_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000480483.1|1195392_1195914_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000749979.1|1196026_1196311_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_010989065.1|1196405_1196762_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989064.1|1196915_1197734_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_001520831.1|1197778_1199062_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001520307.1|1199564_1201634_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_000701821.1|1201669_1201885_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001161781.1|1202335_1203163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|1203497_1204691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989063.1|1205080_1205674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542209.1|1205720_1205888_-	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_001542208.1|1205901_1206966_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
1207131:1207177	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001536726.1|1207294_1208320_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_000616878.1|1208323_1208956_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	100.0	1.1e-116
WP_000102102.1|1209075_1209318_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	100.0	1.1e-38
WP_000460861.1|1209350_1209860_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	99.4	3.6e-89
WP_000956166.1|1209867_1210068_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	98.5	1.2e-32
WP_000963480.1|1210031_1210373_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	100.0	2.1e-56
WP_001244238.1|1210440_1210674_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	98.7	2.9e-33
WP_000785513.1|1210673_1210901_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	3.0e-35
WP_001090715.1|1210897_1211482_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.7	9.0e-76
WP_000104131.1|1211478_1212339_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	4.5e-132
WP_000301197.1|1212329_1214759_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.1	0.0e+00
WP_001154433.1|1214911_1215100_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_001217575.1|1215110_1215344_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001673609.1|1215457_1216135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284992.1|1216448_1218113_+	AIPR family protein	NA	E5G6M2	Salmonella_phage	99.8	0.0e+00
WP_001542203.1|1218216_1219257_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001098395.1|1219256_1221023_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_000216276.1|1221165_1221999_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_000730759.1|1222015_1223077_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000059173.1|1223080_1223731_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000673536.1|1223824_1224289_+|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	99.4	3.8e-85
WP_000868184.1|1224288_1224492_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1224495_1224711_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069921.1|1224691_1225207_+	lysozyme	NA	E5G6N1	Salmonella_phage	99.4	1.2e-95
WP_000196199.1|1225203_1225632_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001039958.1|1225727_1226159_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000343949.1|1226151_1226598_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_000958562.1|1226599_1227451_-	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_001672413.1|1227528_1228107_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000189373.1|1228103_1228463_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_000268332.1|1228449_1229358_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_001086801.1|1229350_1229956_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	99.5	1.1e-116
WP_001274645.1|1229952_1231806_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	99.8	0.0e+00
WP_000143187.1|1231805_1232381_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_000974843.1|1233250_1233475_+	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000046108.1|1233577_1234750_+|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_001207651.1|1234759_1235275_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_001280964.1|1235329_1235632_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	99.0	1.6e-44
WP_000763316.1|1235646_1235766_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001282770.1|1235758_1238566_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.8	0.0e+00
WP_000980411.1|1238562_1239048_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
WP_001102269.1|1239044_1240145_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980500.1|1240213_1240432_+	hypothetical protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_010989057.1|1240983_1242147_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1240548:1240594	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000196159.1|1242154_1244335_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533858.1|1244331_1245741_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237667.1|1245805_1257280_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1257893_1258376_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1258525_1259002_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1258991_1259282_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1259447_1259786_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1259934_1261596_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1261681_1262560_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1262682_1263273_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287923.1|1263307_1263913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1264033_1265320_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1265339_1266131_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1266296_1267658_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1267971_1268220_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1268238_1268787_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1268831_1269599_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP014981	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1880 isolate ST13123 chromosome, complete genome	4815208	1308043	1353050	4815208	holin,integrase,tail,lysis	Salmonella_phage(46.15%)	56	1299910:1299925	1331486:1331501
1299910:1299925	attL	CATGAACTGACGCGTG	NA	NA	NA	NA
WP_001007940.1|1308043_1309273_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	93.6	5.4e-232
WP_016716136.1|1309250_1309535_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	88.3	1.7e-43
WP_001237033.1|1309575_1309815_-	DUF4060 family protein	NA	H6WRW9	Salmonella_phage	96.2	1.8e-35
WP_077906754.1|1309857_1311015_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	97.9	1.2e-212
WP_053296508.1|1310977_1314178_-	DNA breaking-rejoining protein	NA	H6WRX1	Salmonella_phage	70.6	0.0e+00
WP_000373340.1|1314888_1315095_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	7.4e-17
WP_000368620.1|1315202_1316288_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	38.0	1.5e-60
WP_063325262.1|1316439_1316907_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	86.3	1.2e-67
WP_000145711.1|1316920_1317148_+	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_072143007.1|1317113_1317488_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.8e-62
WP_000024048.1|1317579_1318485_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	96.3	4.4e-170
WP_000788827.1|1318481_1319174_+	Replication protein 14	NA	G8C7U6	Escherichia_phage	60.2	1.8e-78
WP_000065092.1|1319188_1319854_+	ead/Ea22-like family protein	NA	A0A1V0E5L5	Salmonella_phage	44.9	2.8e-25
WP_000852188.1|1319855_1320326_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.1e-68
WP_000208067.1|1320328_1320982_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	52.0	6.3e-62
WP_000002116.1|1320974_1321256_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	95.7	3.2e-47
WP_001217669.1|1321817_1322051_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1322167_1322416_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_063325263.1|1322450_1323062_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	5.8e-110
WP_001096546.1|1323261_1323873_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.0	2.7e-91
WP_001617856.1|1323869_1324016_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_023893238.1|1324005_1324803_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	4.0e-151
WP_001533567.1|1324936_1325623_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	98.2	1.1e-130
WP_001574216.1|1325898_1326228_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984584.1|1326211_1326664_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_001533543.1|1326681_1327134_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_001113128.1|1327358_1327541_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_016716097.1|1327648_1327855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016716096.1|1327959_1328586_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	97.6	2.0e-105
WP_016716095.1|1328588_1330208_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	81.2	7.3e-261
WP_023893014.1|1330207_1331728_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.7	4.8e-105
1331486:1331501	attR	CATGAACTGACGCGTG	NA	NA	NA	NA
WP_016716093.1|1331768_1332458_+	phage protein F	NA	H9C0V1	Aeromonas_phage	48.9	8.4e-57
WP_016716092.1|1332454_1333801_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.5	5.5e-68
WP_023260969.1|1333802_1334285_+	hypothetical protein	NA	K4HYQ5	Acinetobacter_phage	41.2	2.6e-20
WP_001031914.1|1334284_1335313_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.4	8.7e-82
WP_000829560.1|1335316_1335664_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.9e-10
WP_016716089.1|1335670_1336117_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.6	1.8e-15
WP_000247613.1|1336110_1336695_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.3	2.1e-16
WP_001048637.1|1336691_1337057_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.0e-21
WP_000094504.1|1337041_1337587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023893015.1|1337567_1339052_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	40.8	2.6e-95
WP_000016414.1|1339052_1339499_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_000101348.1|1339498_1339903_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228831.1|1339944_1340127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741779.1|1340110_1342282_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_001011706.1|1342278_1342989_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.3	4.7e-26
WP_000890115.1|1342988_1343291_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000122818.1|1343287_1344157_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_023893016.1|1344137_1344815_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.4	1.9e-32
WP_001191865.1|1344827_1345184_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_001293657.1|1345180_1346422_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_001181747.1|1346423_1347026_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	3.3e-33
WP_023893017.1|1347015_1348467_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	72.8	1.7e-46
WP_023893018.1|1348466_1349036_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.8	1.6e-93
WP_023893019.1|1349319_1350327_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	94.9	1.1e-187
WP_071925522.1|1351559_1353050_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	98.4	4.7e-254
>prophage 3
NZ_CP014981	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1880 isolate ST13123 chromosome, complete genome	4815208	1722868	1752452	4815208	holin,tail,protease	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1722868_1723363_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1723776_1724268_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1724257_1724521_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1724517_1727004_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1727010_1727706_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1727692_1728562_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1728677_1729127_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1729136_1729739_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1729759_1730377_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	2.2e-11
WP_000990028.1|1730373_1731033_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1731084_1731822_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1731818_1732031_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1732027_1732507_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1732503_1734435_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1734431_1734989_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001238333.1|1734985_1736029_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1736072_1736720_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1737449_1738013_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1738204_1738408_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1738710_1739502_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1739798_1740002_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1740170_1742537_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1742865_1743855_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1743869_1744238_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_063325264.1|1744266_1745598_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.9	7.2e-20
WP_001120499.1|1745894_1746224_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1746816_1748058_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1748060_1748588_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1748965_1749409_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1749462_1751292_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1751630_1751921_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1751948_1752452_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 4
NZ_CP014981	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1880 isolate ST13123 chromosome, complete genome	4815208	1824504	1833675	4815208	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1824504_1825452_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1825435_1826167_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1826147_1826255_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1826314_1827046_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1827268_1828954_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1828950_1829670_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1829716_1830184_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1830240_1830771_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1830942_1831401_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1831641_1833675_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP014981	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1880 isolate ST13123 chromosome, complete genome	4815208	1901983	1912489	4815208		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1901983_1903387_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1903564_1904458_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1904834_1905920_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1905919_1906819_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1906866_1907745_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1907745_1908297_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1908302_1909295_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1909291_1910065_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1910069_1911149_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1911175_1912489_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP014981	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1880 isolate ST13123 chromosome, complete genome	4815208	1998483	2009086	4815208		Morganella_phage(25.0%)	12	NA	NA
WP_001219015.1|1998483_1998957_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|1999604_1999895_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|2000266_2001064_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000500831.1|2001544_2001706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|2001832_2002252_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|2002254_2003523_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|2003977_2004190_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2004200_2004389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|2004649_2005846_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|2006495_2006795_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|2006886_2007582_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|2007655_2009086_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP014981	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1880 isolate ST13123 chromosome, complete genome	4815208	2907906	2992641	4815208	portal,holin,terminase,lysis,integrase,tail,protease,tRNA	Salmonella_phage(43.64%)	93	2932000:2932019	3003787:3003806
WP_000938191.1|2907906_2908587_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2909207_2909867_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2909953_2910283_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2910279_2910561_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2910609_2911389_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2911414_2911963_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2912177_2913389_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2913446_2913764_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2913808_2914225_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2914395_2915058_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2915152_2915611_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2915646_2917701_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2917824_2918271_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2918289_2920443_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2920429_2921035_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2921251_2921761_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2922117_2923170_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2923241_2923694_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2923879_2925640_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2925708_2926227_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2926326_2926494_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2926749_2927313_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2927309_2928950_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2928954_2930208_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2930222_2932130_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2932000:2932019	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2932142_2934251_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2934349_2935459_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2935455_2935998_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2936163_2937174_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_063325269.1|2937381_2939994_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2940420_2940612_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2940882_2941569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2941553_2941853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2941921_2942548_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001533476.1|2943195_2944164_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000143167.1|2944639_2945221_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|2945220_2947659_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|2947712_2947955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031615525.1|2947993_2948917_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	76.9	5.6e-56
WP_001541992.1|2948895_2951343_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
WP_000246065.1|2951414_2952119_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2952016_2952754_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2952763_2953459_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2953548_2954082_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2954198_2954696_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|2954794_2955127_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_077905305.1|2955123_2958111_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	4.8e-266
WP_010989009.1|2958190_2958520_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2958516_2958915_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|2958960_2959710_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|2959721_2960123_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|2960119_2960686_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2960666_2960966_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2960958_2961282_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2961372_2963454_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_077679777.1|2963377_2964895_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_000196190.1|2964921_2965128_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|2965124_2967263_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|2967219_2967753_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2967960_2968440_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2968457_2968910_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2968893_2969223_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2969498_2970185_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2970545_2970995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2971130_2971256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2971429_2971747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2971813_2972611_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2972600_2972747_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|2972743_2973355_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_000929805.1|2973563_2974166_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2974248_2974470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2974581_2974815_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|2975106_2975397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2975474_2975786_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2975782_2976130_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|2976140_2976890_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|2976892_2977876_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2977960_2978335_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2978300_2978540_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2978659_2979070_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_077905303.1|2979119_2979380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|2979372_2979531_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|2979552_2979852_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000017133.1|2979978_2982864_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|2982826_2983984_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2984026_2984266_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2984306_2984555_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2984599_2985892_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|2986086_2987289_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2987366_2988803_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2989047_2990262_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2990578_2991040_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2991240_2992641_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
3003787:3003806	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 8
NZ_CP014981	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1880 isolate ST13123 chromosome, complete genome	4815208	3056777	3065509	4815208	protease,transposase	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3056777_3058032_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3058495_3058954_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_000934063.1|3059145_3061422_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3061452_3061773_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3062096_3062318_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3062447_3064394_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3064390_3065509_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 9
NZ_CP014981	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1880 isolate ST13123 chromosome, complete genome	4815208	3720134	3780950	4815208	protease,plate,tRNA,transposase	Vibrio_phage(11.11%)	52	NA	NA
WP_000118732.1|3720134_3721478_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001007106.1|3721481_3722018_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119444.1|3722084_3722558_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000379146.1|3722700_3723084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001081550.1|3723068_3723554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312802.1|3723858_3724344_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_014344502.1|3724597_3724930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013881.1|3725229_3726738_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000996817.1|3726761_3727304_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000449778.1|3727403_3730043_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.5	1.1e-77
WP_000806681.1|3730410_3731313_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000750535.1|3731299_3732124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108007.1|3732120_3732615_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000371508.1|3732630_3734514_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000145244.1|3734510_3735506_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000367626.1|3735516_3736572_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001670675.1|3737103_3737835_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	6.4e-39
WP_000917872.1|3737898_3738366_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_000801238.1|3738362_3739085_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052775.1|3739119_3739875_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644706.1|3739946_3741314_+	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.0	1.4e-10
WP_000207224.1|3741369_3742140_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230968.1|3742217_3743018_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001127538.1|3743149_3744325_-	MFS transporter	NA	NA	NA	NA	NA
WP_000648534.1|3744429_3745344_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000154871.1|3745364_3746168_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.4	2.1e-38
WP_001051726.1|3752426_3752993_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000594021.1|3753182_3754214_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
WP_001287486.1|3754206_3754860_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874215.1|3754898_3755714_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202315.1|3755832_3756237_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000093986.1|3756233_3756941_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260683.1|3757051_3758770_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000252573.1|3758843_3759545_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000560527.1|3759576_3759999_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185319.1|3759995_3760541_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000955207.1|3760720_3760939_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062330.1|3760925_3761186_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000210056.1|3761269_3762562_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901088.1|3762624_3763014_-	VOC family protein	NA	NA	NA	NA	NA
WP_001021054.1|3763069_3765211_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000502119.1|3767289_3767748_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_000055753.1|3767942_3768902_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294826.1|3768914_3772397_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569412.1|3772420_3773017_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	1.5e-25
WP_000741212.1|3773013_3774162_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565950.1|3774161_3774950_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210741.1|3774953_3775409_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139265.1|3775514_3776540_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758966.1|3776543_3777029_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240935.1|3777151_3779566_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000949017.1|3779597_3780950_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 10
NZ_CP014981	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1880 isolate ST13123 chromosome, complete genome	4815208	4434419	4481463	4815208	tail,tRNA,plate	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4434419_4435418_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4435505_4436816_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4437062_4437578_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4437676_4437886_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4437907_4438021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4438017_4439343_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4439521_4440130_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4440238_4440607_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017369.1|4440777_4443198_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4443296_4444169_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4444182_4444680_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4444860_4445778_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4445941_4447300_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4447388_4448498_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4448859_4450050_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4450181_4451726_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4451740_4452631_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4452796_4453207_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750803.1|4453349_4455446_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4455445_4456183_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_022742863.1|4456179_4456848_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4456881_4457124_-	outer membrane protein	NA	NA	NA	NA	NA
WP_063325275.1|4457567_4459217_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4459561_4460911_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4461043_4461391_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4461966_4462254_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4462256_4462862_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4462874_4463189_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4463348_4463804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4463800_4463998_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4463987_4465415_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4465414_4465939_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4465990_4466308_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4466267_4466396_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4466492_4468847_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4468846_4469800_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4469799_4470009_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4469996_4471040_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4471049_4471772_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4472099_4472462_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4472458_4473388_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4473387_4474935_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4475098_4475458_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4475448_4476564_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4476556_4477189_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4477191_4478937_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4478941_4479547_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4479543_4479999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4480247_4480538_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4480734_4481463_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
