The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014971	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 chromosome, complete genome	4784385	1261953	1338718	4784385	tail,terminase,holin,capsid,integrase,tRNA,transposase,head,protease,portal,lysis	Salmonella_phage(36.84%)	89	1254034:1254050	1344565:1344581
1254034:1254050	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1261953_1262991_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1263106_1263796_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1264114_1264498_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1264559_1265147_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1265249_1266149_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1266166_1267501_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1267631_1268369_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1268353_1269976_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1270239_1270404_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1270400_1270976_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1271007_1271658_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1271657_1272614_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1272610_1273090_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1273587_1274817_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1274794_1275079_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1275119_1275359_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1275401_1276559_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_078321017.1|1276521_1279449_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.2	0.0e+00
WP_001539619.1|1279575_1279926_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1279947_1280106_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_000950426.1|1280562_1281225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356948.1|1281224_1281611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111772.1|1281603_1282443_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000660736.1|1282501_1282897_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_000643689.1|1282996_1283239_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_010835408.1|1283198_1283573_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000024044.1|1283664_1284549_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_000801764.1|1284545_1285241_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000664368.1|1285254_1285953_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000877757.1|1286060_1286693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1286935_1287169_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1287285_1287534_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929791.1|1287568_1288171_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001096550.1|1288379_1288991_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1288987_1289128_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1289124_1289802_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1290074_1290638_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1291144_1291333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1291547_1292234_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1292509_1292839_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1292822_1293275_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|1293292_1293745_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1293980_1294382_-	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001102153.1|1294668_1295214_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1295185_1297117_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1297100_1297304_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1297300_1298881_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1298870_1300367_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1300379_1300727_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1300781_1301810_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1301867_1302227_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000083294.1|1302237_1302621_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1302648_1303227_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1303275_1304406_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1304514_1304916_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1304923_1305670_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1305720_1306116_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1306112_1306451_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1306422_1309518_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1309520_1309850_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1309859_1310558_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1310564_1311302_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1311199_1311847_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1311908_1315271_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1315309_1315552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1315605_1317978_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1317974_1318799_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1318788_1319367_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1319463_1319691_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1319797_1320010_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|1320762_1320882_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1321594_1321732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1322240_1323734_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1324138_1325938_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1325954_1326929_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1327202_1327883_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1327879_1328785_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1328796_1329525_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1329536_1330268_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1330267_1330648_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1330759_1331020_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1331057_1331984_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|1332099_1333296_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684022.1|1333317_1334235_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1334273_1335122_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1335237_1336131_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1336141_1337503_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1337506_1338142_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1338166_1338718_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1344565:1344581	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP014971	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 chromosome, complete genome	4784385	1692869	1722471	4784385	tail,holin,protease	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1692869_1693364_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1693777_1694269_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1694258_1694522_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1694518_1697005_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1697011_1697707_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_063320122.1|1697693_1698563_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1698678_1699128_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1699137_1699740_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1699760_1700378_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1700374_1701034_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1701085_1701823_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1701819_1702032_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1702028_1702508_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1702504_1704436_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1704432_1704990_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_015589551.1|1704986_1706030_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1706073_1706721_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1707450_1708014_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1708205_1708409_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1708711_1709503_+|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1709799_1710003_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1710171_1712538_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1712866_1713856_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1713870_1714239_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1714267_1715599_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1715895_1716225_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1716817_1718059_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1718061_1718589_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1718966_1719410_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1719463_1721293_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1721649_1721940_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1721967_1722471_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 3
NZ_CP014971	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 chromosome, complete genome	4784385	1794523	1803694	4784385	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1794523_1795471_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824855.1|1795454_1796186_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1796166_1796274_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1796333_1797065_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1797287_1798973_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1798969_1799689_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1799735_1800203_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1800259_1800790_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1800961_1801420_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1801660_1803694_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP014971	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 chromosome, complete genome	4784385	1872002	1882508	4784385		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1872002_1873406_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1873583_1874477_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1874853_1875939_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1875938_1876838_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1876885_1877764_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1877764_1878316_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1878321_1879314_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1879310_1880084_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1880088_1881168_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1881194_1882508_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP014971	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 chromosome, complete genome	4784385	1971851	1979105	4784385		Morganella_phage(33.33%)	8	NA	NA
WP_000394196.1|1971851_1972271_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|1972273_1973542_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1973996_1974209_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1974219_1974408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|1974668_1975865_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|1976514_1976814_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|1976905_1977601_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|1977674_1979105_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP014971	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 chromosome, complete genome	4784385	2083148	2089957	4784385	tail,integrase	Salmonella_phage(33.33%)	11	2085358:2085380	2095073:2095095
WP_000856224.1|2083148_2083379_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2083516_2083891_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2083891_2084767_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2084783_2085137_+	YebY family protein	NA	NA	NA	NA	NA
2085358:2085380	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2085510_2086365_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2086424_2086919_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2087108_2087339_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2087392_2087926_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2088182_2088350_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2088414_2088603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2089075_2089957_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2095073:2095095	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP014971	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 chromosome, complete genome	4784385	2877919	2962654	4784385	tail,terminase,holin,tRNA,protease,portal,lysis	Salmonella_phage(43.64%)	93	NA	NA
WP_000938191.1|2877919_2878600_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2879220_2879880_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2879966_2880296_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2880292_2880574_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2880622_2881402_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000859419.1|2881427_2881976_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2882190_2883402_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2883459_2883777_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2883821_2884235_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2884408_2885071_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2885165_2885624_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2885659_2887714_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2887837_2888284_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2888302_2890456_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2890442_2891048_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2891264_2891774_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2892130_2893183_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2893254_2893707_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2893892_2895653_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2895721_2896240_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2896339_2896507_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2896762_2897326_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2897322_2898963_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2898967_2900221_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2900235_2902143_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2902155_2904264_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2904362_2905472_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2905468_2906011_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2906176_2907187_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2907394_2910007_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2910433_2910625_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2910895_2911582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2911566_2911866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2911934_2912561_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001533476.1|2913208_2914177_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000143167.1|2914652_2915234_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_063320130.1|2915233_2917672_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.6	3.7e-91
WP_000178849.1|2917725_2917968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541993.1|2918006_2918882_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	77.1	1.1e-48
WP_001541992.1|2918908_2921356_-	host specificity protein J	NA	Q687E8	Enterobacteria_phage	68.0	0.0e+00
WP_000246065.1|2921427_2922132_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2922029_2922767_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2922776_2923472_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2923561_2924095_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_063320131.1|2924211_2924709_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.8	3.1e-16
WP_000978296.1|2924807_2925140_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_078321022.1|2925136_2928124_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	4.8e-266
WP_010989009.1|2928203_2928533_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2928529_2928928_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|2928973_2929723_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|2929734_2930136_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|2930132_2930699_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2930679_2930979_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2930971_2931295_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2931385_2933467_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001009207.1|2933390_2934938_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_000196190.1|2934934_2935141_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_078321019.1|2935137_2937276_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.5	1.3e-289
WP_000371784.1|2937232_2937766_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2937973_2938453_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|2938470_2938923_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|2938906_2939236_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2939511_2940198_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2940558_2941008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2941143_2941269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2941442_2941760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2941826_2942624_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2942613_2942760_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|2942756_2943368_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_000929805.1|2943576_2944179_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2944261_2944483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2944594_2944828_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_010989003.1|2945119_2945410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2945487_2945799_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2945795_2946143_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|2946153_2946903_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|2946905_2947889_-	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2947973_2948348_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2948313_2948553_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2948672_2949083_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_010989002.1|2949132_2949393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|2949385_2949544_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|2949565_2949865_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000017133.1|2949991_2952877_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|2952839_2953997_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2954039_2954279_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2954319_2954568_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_061202155.1|2954612_2955905_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.5	2.2e-252
WP_000191399.1|2956099_2957302_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2957379_2958816_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2959060_2960275_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2960591_2961053_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2961253_2962654_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
>prophage 8
NZ_CP014971	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 chromosome, complete genome	4784385	3026790	3035522	4784385	transposase,protease	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3026790_3028045_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3028508_3028967_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_063320133.1|3029158_3031435_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.4e-164
WP_000520789.1|3031465_3031786_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3032109_3032331_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3032460_3034407_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3034403_3035522_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 9
NZ_CP014971	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 chromosome, complete genome	4784385	4403594	4450638	4784385	tail,plate,tRNA	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4403594_4404593_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4404680_4405991_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4406237_4406753_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4406851_4407061_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4407082_4407196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4407192_4408518_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4408696_4409305_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4409413_4409782_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4409952_4412373_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4412471_4413344_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4413357_4413855_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4414035_4414953_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4415116_4416475_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4416563_4417673_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4418034_4419225_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4419356_4420901_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4420915_4421806_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4421971_4422382_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4422524_4424621_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4424620_4425358_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_022742863.1|4425354_4426023_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4426056_4426299_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4426742_4428392_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4428736_4430086_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4430218_4430566_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4431141_4431429_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4431431_4432037_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4432049_4432364_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4432523_4432979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4432975_4433173_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4433162_4434590_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4434589_4435114_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4435165_4435483_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4435442_4435571_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4435667_4438022_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4438021_4438975_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4438974_4439184_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4439171_4440215_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4440224_4440947_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4441274_4441637_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4441633_4442563_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4442562_4444110_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4444273_4444633_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4444623_4445739_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4445731_4446364_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4446366_4448112_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4448116_4448722_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4448718_4449174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4449422_4449713_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4449909_4450638_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP014972	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY1-1898, complete sequence	95780	12780	18169	95780	integrase	Escherichia_phage(33.33%)	8	4631:4643	13645:13657
4631:4643	attL	TACTGTTTAAGCA	NA	NA	NA	NA
WP_063320165.1|12780_13563_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_000239529.1|13700_13976_-	hypothetical protein	NA	NA	NA	NA	NA
13645:13657	attR	TGCTTAAACAGTA	NA	NA	NA	NA
WP_000633913.1|13969_14614_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_063320166.1|14842_15814_+	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000340830.1|15818_16211_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_063320167.1|16215_17487_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.2	3.5e-141
WP_063320168.1|17486_17924_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	1.9e-25
WP_000618110.1|17920_18169_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
>prophage 1
NZ_CP014973	Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY2-1898, complete sequence	93960	40871	50167	93960	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_001541564.1|40871_41288_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|41471_41807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541562.1|41863_42430_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728917.1|42461_43403_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|43817_45023_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000064274.1|45022_45997_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.1e-84
WP_000457541.1|46078_47353_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000925627.1|47352_47775_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|48285_48756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|48748_49105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|49486_50167_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
