The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015436	Anoxybacillus sp. B7M1 chromosome, complete genome	3814080	1103926	1143044	3814080	transposase	Streptomyces_phage(50.0%)	31	NA	NA
WP_044744103.1|1103926_1104439_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_066329471.1|1104587_1104839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066329475.1|1105880_1106444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044745802.1|1106694_1107294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044744209.1|1107995_1108424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044743716.1|1109558_1110155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044743719.1|1110463_1110709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044743717.1|1110959_1111199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156487560.1|1111199_1118003_-	DNRLRE domain-containing protein	NA	NA	NA	NA	NA
WP_044744015.1|1119382_1120891_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_044744014.1|1120998_1122936_-	ATP-dependent DNA helicase	NA	A0A2P1N093	Streptomyces_phage	22.6	1.8e-11
WP_044744786.1|1124238_1124466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044744787.1|1124844_1125063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044744788.1|1125075_1125666_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_082828126.1|1128032_1128329_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_156487504.1|1128368_1128512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082828125.1|1128618_1129020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066329481.1|1129059_1130346_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_044742348.1|1130676_1131021_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052660929.1|1131499_1132270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044742346.1|1132456_1132966_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_044742345.1|1132967_1133444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044742344.1|1133487_1133805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156487503.1|1134330_1134498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156487559.1|1134754_1134850_-	YvrJ family protein	NA	NA	NA	NA	NA
WP_044742382.1|1135120_1136257_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_044742381.1|1136249_1137956_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	37.5	8.0e-24
WP_044742380.1|1139086_1139383_-	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_156487502.1|1139457_1139601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066329411.1|1140008_1141283_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_066329493.1|1141757_1143044_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP015436	Anoxybacillus sp. B7M1 chromosome, complete genome	3814080	1576498	1586342	3814080		Staphylococcus_phage(50.0%)	12	NA	NA
WP_044742188.1|1576498_1577647_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	35.1	7.0e-24
WP_044742187.1|1577968_1578877_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	41.4	7.5e-37
WP_044742186.1|1578992_1579484_-	DUF3907 family protein	NA	NA	NA	NA	NA
WP_044742185.1|1579503_1579923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044742184.1|1580284_1580866_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.7e-16
WP_044742183.1|1580846_1581623_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	27.6	4.6e-11
WP_044742182.1|1581883_1582399_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_044742181.1|1582410_1582758_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_044742180.1|1582862_1583327_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	62.8	9.4e-44
WP_044742179.1|1583378_1584572_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.8	1.1e-117
WP_044742178.1|1584591_1585242_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	45.2	1.2e-41
WP_044742177.1|1585256_1586342_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.5	3.5e-57
>prophage 3
NZ_CP015436	Anoxybacillus sp. B7M1 chromosome, complete genome	3814080	2262703	2278026	3814080	transposase	Staphylococcus_prophage(50.0%)	8	NA	NA
WP_044745120.1|2262703_2264179_+|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	34.4	2.4e-69
WP_052660940.1|2265722_2267039_+|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	36.8	1.1e-57
WP_156487583.1|2267014_2267452_+|transposase	transposase	transposase	Q9MBP7	Staphylococcus_prophage	40.5	5.6e-22
WP_044742529.1|2271775_2272246_+	IstB-like ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.6	3.4e-17
WP_044742528.1|2272270_2273719_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_082063583.1|2273820_2274144_+|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	43.8	4.0e-17
WP_044742527.1|2274325_2275696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156487548.1|2277399_2278026_+|transposase	transposase	transposase	A0A1X9I5T2	Streptococcus_phage	55.0	5.1e-53
>prophage 4
NZ_CP015436	Anoxybacillus sp. B7M1 chromosome, complete genome	3814080	2382701	2388397	3814080		Streptococcus_phage(33.33%)	7	NA	NA
WP_044741440.1|2382701_2383292_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.3	3.4e-54
WP_044741441.1|2383513_2383771_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_044741442.1|2383796_2384753_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.6	2.4e-49
WP_044741443.1|2384810_2385773_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.2	2.5e-62
WP_044741444.1|2385769_2386663_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.8	3.0e-06
WP_044741445.1|2386678_2387137_-	8-oxo-dGTP diphosphatase	NA	K4F7D9	Cronobacter_phage	30.1	6.5e-05
WP_044741446.1|2387449_2388397_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	55.5	8.0e-90
>prophage 5
NZ_CP015436	Anoxybacillus sp. B7M1 chromosome, complete genome	3814080	3066034	3135275	3814080	terminase,portal,tRNA,plate,integrase,protease,holin,tail	Bacillus_phage(13.51%)	82	3092332:3092352	3142945:3142965
WP_044742003.1|3066034_3066637_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_044742002.1|3066934_3067297_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_044742001.1|3067387_3068401_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_156487579.1|3068608_3069775_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.9	1.8e-30
WP_044741999.1|3069913_3070195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003253417.1|3070199_3070550_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	2.0e-14
WP_044741998.1|3070678_3072844_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_139788175.1|3073095_3073221_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_044741997.1|3073304_3073781_+	SprT family protein	NA	NA	NA	NA	NA
WP_044743247.1|3081442_3081901_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_044743246.1|3081897_3082608_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_044743245.1|3082597_3083044_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_044743244.1|3083040_3084054_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.8	7.3e-65
WP_044743243.1|3084457_3086425_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.5	1.4e-59
WP_044743242.1|3086543_3087032_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_044743241.1|3087062_3087722_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_080859420.1|3087718_3087871_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_044743239.1|3087895_3088642_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_044743238.1|3088655_3088856_-	YdiK family protein	NA	NA	NA	NA	NA
WP_044743237.1|3088849_3089581_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_044743236.1|3090356_3090641_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	53.8	1.1e-18
WP_044743235.1|3090722_3092351_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.9	6.7e-161
3092332:3092352	attL	GAATGGGCGGCATGATGTAAT	NA	NA	NA	NA
WP_044743234.1|3092427_3093627_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	54.7	6.7e-110
WP_082063643.1|3094587_3095283_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044743231.1|3095284_3096487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044743230.1|3096486_3097395_-	serine/threonine protein kinase	NA	M1HHG8	Acanthocystis_turfacea_Chlorella_virus	31.8	9.9e-13
WP_044743229.1|3097712_3098153_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	55.9	1.6e-37
WP_044743228.1|3098130_3099231_-	SAP domain-containing protein	NA	NA	NA	NA	NA
WP_044743227.1|3099254_3099692_-	helix-turn-helix domain-containing protein	NA	A0A2P1JU09	Anoxybacillus_phage	46.5	3.7e-26
WP_044743226.1|3099958_3100186_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_156487534.1|3100228_3100393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044743225.1|3100364_3100727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063504913.1|3100768_3101179_-	helix-turn-helix domain-containing protein	NA	S5MTZ5	Brevibacillus_phage	42.6	9.9e-13
WP_044743224.1|3101323_3101548_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082063642.1|3102268_3102574_+	hypothetical protein	NA	S6C476	Thermus_phage	58.8	1.2e-20
WP_044743222.1|3102570_3103269_+	hypothetical protein	NA	A0A1B1P7T7	Bacillus_phage	42.2	3.1e-38
WP_044743221.1|3103320_3103842_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044743220.1|3104249_3104444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044743219.1|3104440_3105400_+	hypothetical protein	NA	Q0H280	Geobacillus_phage	92.5	2.1e-167
WP_044743218.1|3105399_3106245_+	recombination protein RecT	NA	Q0H279	Geobacillus_phage	88.6	4.4e-132
WP_044743217.1|3106295_3107273_+	DnaD domain protein	NA	A0A0U4JX08	Bacillus_phage	71.3	2.1e-37
WP_082063644.1|3107524_3107692_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_082063641.1|3107639_3107864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044743249.1|3108386_3108554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082063640.1|3108616_3108808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082063639.1|3108954_3109056_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_082063637.1|3109330_3109462_+	DUF3954 domain-containing protein	NA	NA	NA	NA	NA
WP_139788024.1|3109514_3109652_-	Spo0E family sporulation regulatory protein-aspartic acid phosphatase	NA	NA	NA	NA	NA
WP_044743216.1|3109892_3110900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044743215.1|3111185_3111338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044743214.1|3111359_3111818_+	hypothetical protein	NA	A0A290FZR5	Caldibacillus_phage	61.2	1.1e-39
WP_044743213.1|3112053_3112257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044743212.1|3112335_3113100_+	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	61.3	6.9e-68
WP_156487578.1|3113102_3114395_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	68.1	1.1e-166
WP_044743210.1|3114398_3115925_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	54.6	2.3e-155
WP_044743209.1|3115921_3116836_+	hypothetical protein	NA	A0A249XXB6	Clostridium_phage	38.7	1.0e-49
WP_044743208.1|3116847_3117057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044743207.1|3117077_3118289_+|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	49.3	2.1e-74
WP_044743206.1|3118307_3119249_+	hypothetical protein	NA	A5GYL9	Lactococcus_phage	33.5	2.3e-41
WP_044743205.1|3119264_3119444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044743204.1|3119450_3119831_+	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	40.5	2.3e-16
WP_044743203.1|3119827_3120181_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_044743202.1|3120177_3120678_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	51.2	1.4e-40
WP_044743201.1|3120688_3121129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099458851.1|3121145_3121331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044743200.1|3121331_3122675_+|portal	phage portal protein	portal	A0A0A7RTT5	Clostridium_phage	45.9	1.6e-91
WP_044743199.1|3122675_3123119_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	43.5	8.4e-26
WP_044743198.1|3123170_3123602_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_052660958.1|3123793_3126970_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	57.4	1.2e-60
WP_044743197.1|3126962_3127640_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4J2N2	uncultured_Caudovirales_phage	35.1	8.4e-25
WP_044743196.1|3127636_3128620_+	hypothetical protein	NA	A0A2H4IZP4	uncultured_Caudovirales_phage	33.9	5.1e-39
WP_044743195.1|3128616_3128886_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_044743194.1|3128890_3129313_+	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_044743193.1|3129305_3130328_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	40.9	4.6e-67
WP_044743192.1|3130317_3130863_+	YmfQ family protein	NA	A0A0A7RUW8	Clostridium_phage	45.2	5.1e-33
WP_044743191.1|3130864_3131287_+	hypothetical protein	NA	A0A0N9S0E3	Mycobacterium_phage	55.8	4.4e-08
WP_044743190.1|3131287_3131593_+	hypothetical protein	NA	A0A0K1Y8A9	Streptomyces_phage	46.5	5.8e-10
WP_044743189.1|3131592_3132162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044743188.1|3132161_3132377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044743187.1|3132553_3132970_+|holin	phage holin family protein	holin	A0A1U9WQR6	Geobacillus_phage	61.2	2.4e-38
WP_066329600.1|3132969_3133707_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	83.1	9.6e-83
WP_052661002.1|3134678_3135275_+	hypothetical protein	NA	A0A290GDU0	Caldibacillus_phage	32.1	5.0e-05
3142945:3142965	attR	GAATGGGCGGCATGATGTAAT	NA	NA	NA	NA
>prophage 6
NZ_CP015436	Anoxybacillus sp. B7M1 chromosome, complete genome	3814080	3160888	3168567	3814080		Synechococcus_phage(50.0%)	7	NA	NA
WP_044741328.1|3160888_3162181_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.2	1.0e-18
WP_044741329.1|3162259_3162988_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	42.6	1.1e-46
WP_044741330.1|3162975_3163230_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	37.0	1.5e-06
WP_044741331.1|3163226_3163913_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_044741332.1|3163896_3166122_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.9	5.2e-164
WP_044741333.1|3166097_3167513_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.3	6.0e-49
WP_044741334.1|3167526_3168567_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	43.4	7.0e-71
>prophage 1
NZ_CP015437	Anoxybacillus sp. B7M1 plasmid unnamed, complete sequence	54976	23403	44611	54976	integrase,head,portal,capsid,protease	Bacillus_phage(44.44%)	34	20577:20592	38943:38958
20577:20592	attL	TAAATTCTACTAACTA	NA	NA	NA	NA
WP_044741826.1|23403_24537_+	hypothetical protein	NA	D2XQ10	Bacillus_virus	28.2	2.1e-28
WP_156489127.1|24650_24788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044741825.1|24896_25091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052660908.1|25103_25463_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P7A0	Bacillus_phage	30.6	1.7e-08
WP_044741871.1|25663_25843_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044741824.1|25900_26215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044741823.1|26214_26568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082063458.1|26549_26822_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044741821.1|26818_27061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044741820.1|27057_27564_+	hypothetical protein	NA	I2E8Y4	Clostridium_phage	38.1	5.0e-06
WP_044741819.1|27588_27798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156489128.1|27801_27939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044741818.1|27935_28175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044741817.1|28175_28358_+	Fur-regulated basic protein FbpA	NA	A0A2P1JU06	Anoxybacillus_phage	52.7	9.7e-05
WP_082063462.1|28382_28493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044741870.1|28494_29013_+	Holliday junction resolvase RecU	NA	A0A1B1P798	Bacillus_phage	54.4	1.3e-49
WP_156489129.1|29009_29171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044741816.1|29396_29579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044741815.1|29817_30081_+	hypothetical protein	NA	O64167	Bacillus_phage	52.8	7.7e-19
WP_044741814.1|30130_30937_+	DNA adenine methylase	NA	Q24LC8	Clostridium_phage	45.6	1.3e-61
WP_044741813.1|30981_31350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044741812.1|31464_31713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156489130.1|32657_33011_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	57.8	2.8e-24
WP_066329676.1|33135_33633_+	hypothetical protein	NA	A0A2P1JU01	Anoxybacillus_phage	38.8	3.6e-09
WP_044741881.1|34017_34203_+	helix-turn-helix domain-containing protein	NA	A6M9A5	Geobacillus_virus	71.9	1.7e-17
WP_044741867.1|35035_36268_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	51.6	9.0e-110
WP_052660916.1|36468_36702_+	hypothetical protein	NA	A0A1B1P7D4	Bacillus_phage	36.2	6.6e-06
WP_044741866.1|36751_37669_+	hypothetical protein	NA	A0A1B1P7C9	Bacillus_phage	43.5	2.3e-49
WP_044741865.1|37682_38516_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	60.6	8.3e-91
WP_044741864.1|38681_38945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044741863.1|39024_40443_+	DEAD/DEAH box helicase family protein	NA	C9E2I7	Enterococcus_phage	59.9	2.8e-163
38943:38958	attR	TAAATTCTACTAACTA	NA	NA	NA	NA
WP_082063460.1|40402_42475_+|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	42.9	4.0e-142
WP_052660914.1|42543_43293_+|head,protease	HK97 family phage prohead protease	head,protease	W8EBB3	Geobacillus_phage	43.9	4.9e-42
WP_052660913.1|43384_44611_+|capsid	phage major capsid protein	capsid	A0A0K1LLG2	Bacillus_phage	56.5	8.4e-116
