The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013955	Staphylococcus aureus strain NCCP14562 isolate Sequencing chromosome, complete genome	2910941	12792	73960	2910941	tRNA,transposase,integrase	Bacillus_phage(28.57%)	51	11032:11048	75694:75710
11032:11048	attL	ATTATTGAAAATGAGGA	NA	NA	NA	NA
WP_000884332.1|12792_14079_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	4.5e-88
WP_000190726.1|14729_15425_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_000628051.1|15421_15751_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000186490.1|16113_17082_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_001800884.1|17374_18313_+	YybS family protein	NA	NA	NA	NA	NA
WP_001081640.1|18327_20295_+	cyclic-di-AMP phosphodiesterase GdpP	NA	NA	NA	NA	NA
WP_000864305.1|20291_20738_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000375647.1|20769_22170_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
WP_000095328.1|22447_23731_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000101976.1|24933_25635_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_063664714.1|25647_27474_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	30.9	3.6e-30
WP_001060140.1|27466_28801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104165.1|28801_29590_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_000088649.1|29978_30779_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_000645787.1|31005_33324_+	LPXTG-anchored adenosine synthase AdsA	NA	NA	NA	NA	NA
WP_000704775.1|33691_34171_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_000566670.1|34492_35749_+	DUF3578 domain-containing protein	NA	NA	NA	NA	NA
WP_001282728.1|36163_36403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001106057.1|36434_37109_-|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.1	2.6e-127
WP_001817892.1|37199_37397_-	protein rep	NA	A0A286QS97	Streptococcus_phage	62.0	1.2e-08
WP_000336290.1|37409_38183_-	protein rep	NA	NA	NA	NA	NA
WP_000119405.1|38427_39690_-	plasmid recombination protein	NA	NA	NA	NA	NA
WP_001242578.1|40196_40601_-	bleomycin binding protein	NA	NA	NA	NA	NA
WP_001795128.1|40817_41588_-	aminoglycoside O-nucleotidyltransferase ANT(4')-Ia	NA	NA	NA	NA	NA
WP_001106057.1|41780_42455_-|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.1	2.6e-127
WP_000958858.1|43596_44340_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_000872606.1|44436_44865_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_001801873.1|44910_46920_-	PBP2a family beta-lactam-resistant peptidoglycan transpeptidase MecA	NA	NA	NA	NA	NA
WP_000952923.1|47016_48774_+	beta-lactam sensor/signal transducer MecR1	NA	NA	NA	NA	NA
WP_000369214.1|48773_49145_+	mecA-type methicillin resistance repressor MecI	NA	NA	NA	NA	NA
WP_014532405.1|49229_49298_-	phenol-soluble modulin PSM-mec	NA	NA	NA	NA	NA
WP_010922808.1|49631_50762_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_000438836.1|52242_53307_-	DsrE/DsrF/DrsH-like family protein	NA	NA	NA	NA	NA
WP_000220507.1|53442_53703_+	persulfide-sensing transcriptional repressor CstR	NA	NA	NA	NA	NA
WP_000350222.1|53702_54347_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001092058.1|54685_55348_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001072201.1|55778_56510_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
WP_000067268.1|56635_57418_-	aminoglycoside nucleotidyltransferase ANT(9)-Ia	NA	NA	NA	NA	NA
WP_000361059.1|57568_57946_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001557544.1|57952_59845_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000868132.1|59841_60927_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
WP_000659050.1|61045_61363_-	RadC family protein	NA	NA	NA	NA	NA
WP_001092169.1|61383_61890_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_000700853.1|61907_62219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000859155.1|62305_62656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001186602.1|63173_64802_-	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	31.4	2.4e-46
WP_000815646.1|64823_66173_-	recombinase family protein	NA	Q9T200	Bacillus_phage	25.1	1.4e-18
WP_000195100.1|66406_68200_-	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_000273824.1|68199_68496_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001060127.1|68688_69735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000195429.1|72787_73960_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
75694:75710	attR	TCCTCATTTTCAATAAT	NA	NA	NA	NA
>prophage 2
NZ_CP013955	Staphylococcus aureus strain NCCP14562 isolate Sequencing chromosome, complete genome	2910941	425888	469088	2910941	transposase,integrase	Streptococcus_phage(69.57%)	42	420012:420028	464175:464191
420012:420028	attL	TCTCATTTAATTGCTGT	NA	NA	NA	NA
WP_000195429.1|425888_427061_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_001287099.1|427368_428124_+	NADPH-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000991018.1|428203_429592_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_001792089.1|429676_429775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001557163.1|430438_431758_+|transposase	ISL3-like element IS1181 family transposase	transposase	NA	NA	NA	NA
WP_000956137.1|432089_433046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000394698.1|433163_433826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000763767.1|433968_434376_-	general stress protein	NA	NA	NA	NA	NA
WP_000421410.1|434888_435467_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000793018.1|435466_436735_+	purine permease	NA	NA	NA	NA	NA
WP_000264071.1|436772_438239_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
WP_000424963.1|438263_439805_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000237797.1|439872_441066_-|integrase	site-specific integrase	integrase	A0A0S2MV79	Bacillus_phage	34.2	8.3e-44
WP_000633907.1|441092_441293_-	DUF3173 domain-containing protein	NA	NA	NA	NA	NA
WP_000845143.1|441790_442021_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	78.9	1.0e-27
WP_000804879.1|442017_442440_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	68.6	7.5e-48
WP_001227350.1|442970_443324_+	helix-turn-helix domain-containing protein	NA	A0A1S5SFA6	Streptococcus_phage	89.7	2.2e-53
WP_032506803.1|443381_443570_-	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	61.4	7.4e-16
WP_001817446.1|443667_444708_-	hypothetical protein	NA	A0A1S5SF82	Streptococcus_phage	95.7	3.6e-192
WP_001791010.1|445601_445718_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000584387.1|445962_446892_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	56.6	1.1e-83
WP_000768373.1|446908_447931_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	75.5	2.4e-132
WP_000192393.1|447927_449955_-	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	65.3	5.1e-195
WP_000331165.1|449951_452405_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	78.9	0.0e+00
WP_000723887.1|452388_452784_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	72.6	5.9e-47
WP_000248477.1|452855_453494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000870467.1|453549_454044_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	63.4	2.8e-54
WP_000675717.1|454110_454890_-	abortive infection family protein	NA	NA	NA	NA	NA
WP_001009054.1|454931_455153_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	93.2	3.1e-29
WP_000055376.1|455149_455440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426689.1|455436_456621_-	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	68.1	6.3e-161
WP_001130244.1|456801_458205_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	66.5	2.2e-176
WP_000185761.1|458226_459000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001234191.1|459009_459387_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	76.4	9.6e-47
WP_000421279.1|459407_459722_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	77.7	1.2e-42
WP_002303350.1|460022_460982_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_063663398.1|460945_462781_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	23.8	7.1e-26
WP_000470931.1|462777_464967_-	AAA family ATPase	NA	NA	NA	NA	NA
464175:464191	attR	TCTCATTTAATTGCTGT	NA	NA	NA	NA
WP_000997694.1|465100_466291_-|transposase	IS256-like element ISLgar5 family transposase	transposase	NA	NA	NA	NA
WP_000551643.1|466784_467321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000041880.1|467712_468417_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	U5U4R0	Staphylococcus_phage	37.1	5.8e-29
WP_000159787.1|468815_469088_-|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	50.6	1.3e-13
>prophage 3
NZ_CP013955	Staphylococcus aureus strain NCCP14562 isolate Sequencing chromosome, complete genome	2910941	793414	801235	2910941		Hokovirus(16.67%)	10	NA	NA
WP_000244415.1|793414_794470_-	two-component system sensor histidine kinase SaeS	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_000149344.1|794469_795156_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001037807.1|795130_795604_-	DoxX family protein	NA	NA	NA	NA	NA
WP_001093562.1|795946_796387_-	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_000604990.1|796666_797251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062972.1|797349_798063_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000941336.1|798066_798486_-	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_000446724.1|798487_799156_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000604514.1|799506_800100_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
WP_001217796.1|800083_801235_+	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	35.7	6.0e-23
>prophage 4
NZ_CP013955	Staphylococcus aureus strain NCCP14562 isolate Sequencing chromosome, complete genome	2910941	814726	829367	2910941		uncultured_Caudovirales_phage(50.0%)	14	NA	NA
WP_000663030.1|814726_815785_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	7.9e-22
WP_000197262.1|816123_816666_+	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000429006.1|817544_818462_-	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	2.1e-07
WP_031760357.1|818552_818654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193751.1|818731_820237_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_000930014.1|820577_821078_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
WP_001068501.1|821097_821964_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000692521.1|822764_823163_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_000855514.1|823125_825231_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000562498.1|825348_826320_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000499195.1|826500_826656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876318.1|826694_827666_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
WP_001245577.1|827652_828609_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
WP_000616840.1|828605_829367_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	6.5e-18
>prophage 5
NZ_CP013955	Staphylococcus aureus strain NCCP14562 isolate Sequencing chromosome, complete genome	2910941	880157	894974	2910941	coat,terminase,integrase	Staphylococcus_phage(75.0%)	21	879825:879840	886247:886262
879825:879840	attL	ATTGATAATGAAATGG	NA	NA	NA	NA
WP_001050048.1|880157_882530_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	4.3e-92
WP_001085183.1|882551_883016_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	98.7	1.6e-80
WP_000121223.1|883578_884685_-|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	44.2	5.9e-76
WP_072474260.1|884690_885338_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001060953.1|885495_885702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000164237.1|885737_885965_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000784893.1|885961_886108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058487.1|886100_886310_+	hypothetical protein	NA	Q4ZE76	Staphylococcus_phage	92.8	2.2e-29
886247:886262	attR	ATTGATAATGAAATGG	NA	NA	NA	NA
WP_001103933.1|886312_886630_+	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	48.1	1.2e-18
WP_001002695.1|886696_887566_+	primase C-terminal domain-containing protein	NA	A0A1W6JQL5	Staphylococcus_phage	96.9	3.2e-162
WP_001668899.1|887582_889052_+	hypothetical protein	NA	A0A1W6JQD6	Staphylococcus_phage	99.6	3.4e-289
WP_001039169.1|889337_889700_+	hypothetical protein	NA	A0A1W6JQD5	Staphylococcus_phage	98.3	5.8e-65
WP_000998179.1|889701_889986_+	hypothetical protein	NA	A0A1W6JQE4	Staphylococcus_phage	100.0	1.2e-49
WP_063663413.1|889982_890624_+	pathogenicity island protein	NA	Q4ZE67	Staphylococcus_phage	87.3	6.5e-104
WP_001190615.1|891073_891415_+	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	99.1	1.4e-57
WP_000846280.1|891426_892005_+	hypothetical protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.9	4.8e-29
WP_000448770.1|892022_892241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000771368.1|892291_892819_+|coat	spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	97.1	3.5e-87
WP_000358774.1|892821_893163_+	hypothetical protein	NA	A0A1W6JQM3	Staphylococcus_phage	99.1	1.4e-57
WP_001293076.1|893159_893729_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.9	9.3e-102
WP_000801979.1|894005_894974_+	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	27.3	5.9e-24
>prophage 6
NZ_CP013955	Staphylococcus aureus strain NCCP14562 isolate Sequencing chromosome, complete genome	2910941	1000147	1060379	2910941	tRNA,bacteriocin,transposase,protease	Planktothrix_phage(30.0%)	55	NA	NA
WP_000195429.1|1000147_1001320_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_001037440.1|1001799_1002921_+	membrane protein	NA	NA	NA	NA	NA
WP_000700882.1|1002898_1003414_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000769694.1|1003724_1004159_+	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000682089.1|1004415_1004601_-	YjzD family protein	NA	NA	NA	NA	NA
WP_001100526.1|1004895_1005837_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_000081231.1|1005848_1007093_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_000915157.1|1007147_1007519_-	DUF3899 domain-containing protein	NA	NA	NA	NA	NA
WP_000521533.1|1007761_1008688_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_042108581.1|1008687_1009758_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000140050.1|1009773_1010856_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.4e-19
WP_000786734.1|1010845_1011787_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.9	8.3e-23
WP_000197018.1|1011805_1013461_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517183.1|1013672_1015388_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001067052.1|1015438_1016425_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.6	1.4e-15
WP_000427767.1|1016427_1017408_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	4.6e-16
WP_000915997.1|1017400_1018363_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001180280.1|1018374_1019256_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000448934.1|1019297_1020287_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000258003.1|1020580_1020976_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_001217728.1|1021346_1022066_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_000959282.1|1022186_1023173_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_000082725.1|1023220_1025029_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	5.5e-47
WP_000896697.1|1025488_1026295_-	DsbA family protein	NA	NA	NA	NA	NA
WP_000214070.1|1026317_1026683_-	truncated hemoglobin	NA	NA	NA	NA	NA
WP_000224619.1|1026786_1027380_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_001242103.1|1027565_1027913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077683.1|1027929_1028565_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_001270834.1|1028581_1029391_+	NAD kinase	NA	NA	NA	NA	NA
WP_042108604.1|1029387_1030242_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000062407.1|1030262_1031648_+	magnesium transporter	NA	NA	NA	NA	NA
WP_000395153.1|1031657_1033502_+	monovalent cation:proton antiporter family protein	NA	NA	NA	NA	NA
WP_000933195.1|1033779_1034550_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000933105.1|1034746_1035832_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000570687.1|1036173_1037742_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_001288675.1|1037886_1038645_+	esterase family protein	NA	NA	NA	NA	NA
WP_000600387.1|1038838_1039348_+	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_001154223.1|1039460_1040651_-	MFS transporter	NA	NA	NA	NA	NA
WP_000258645.1|1040628_1041804_-	diglucosyl diacylglycerol synthase	NA	NA	NA	NA	NA
WP_000340119.1|1042236_1043721_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_001795833.1|1043701_1043962_+	YueH family protein	NA	NA	NA	NA	NA
WP_001049950.1|1043961_1045524_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	1.7e-36
WP_000928413.1|1045825_1046629_+	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001795272.1|1046847_1049172_+|protease	serine protease	protease	W5SAB9	Pithovirus	27.4	2.8e-11
WP_000021865.1|1049188_1050547_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_000414165.1|1050685_1052197_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000287265.1|1052683_1053253_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000876826.1|1053462_1053681_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_000668818.1|1053761_1054748_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_000214898.1|1054946_1055123_+	YkvS family protein	NA	NA	NA	NA	NA
WP_001033865.1|1055137_1055740_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001792055.1|1056655_1056757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000195429.1|1056815_1057988_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_063663434.1|1058050_1058371_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_042108633.1|1058414_1060379_+|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
>prophage 7
NZ_CP013955	Staphylococcus aureus strain NCCP14562 isolate Sequencing chromosome, complete genome	2910941	1092681	1101154	2910941		Synechococcus_phage(33.33%)	9	NA	NA
WP_000861572.1|1092681_1093164_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	6.2e-22
WP_001010413.1|1093150_1094275_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000174053.1|1094278_1094983_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
WP_000848350.1|1094982_1095246_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666806.1|1095247_1095919_+	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
WP_000032740.1|1095911_1098101_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	3.5e-141
WP_000483720.1|1098079_1099564_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	1.9e-45
WP_000030811.1|1099556_1100585_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.7	3.4e-62
WP_000238669.1|1100587_1101154_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
>prophage 8
NZ_CP013955	Staphylococcus aureus strain NCCP14562 isolate Sequencing chromosome, complete genome	2910941	1152949	1235936	2910941	capsid,holin,transposase,terminase,plate,tRNA,portal,tail,head	Staphylococcus_phage(87.5%)	100	NA	NA
WP_000401377.1|1152949_1153432_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_000843611.1|1153493_1154633_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000872158.1|1154759_1155317_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_000290472.1|1155396_1155570_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_000861313.1|1155686_1157072_-	recombinase family protein	NA	I1W625	Staphylococcus_phage	100.0	2.5e-265
WP_000392109.1|1157278_1157959_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2H4PQQ5	Staphylococcus_phage	100.0	5.1e-123
WP_000358224.1|1157994_1158714_-	helix-turn-helix transcriptional regulator	NA	A0A2H4PQQ2	Staphylococcus_phage	100.0	1.3e-132
WP_001198673.1|1158855_1159074_+	helix-turn-helix transcriptional regulator	NA	Q8SDX1	Staphylococcus_phage	100.0	2.9e-35
WP_029753389.1|1159089_1159878_+	phage antirepressor KilAC domain-containing protein	NA	I1W621	Staphylococcus_phage	99.6	7.2e-145
WP_001094935.1|1160142_1160319_+	hypothetical protein	NA	S4SVC9	Staphylococcus_phage	100.0	9.7e-26
WP_000395457.1|1160293_1160524_-	hypothetical protein	NA	R4IG40	Staphylococcus_phage	100.0	2.3e-35
WP_000230552.1|1160573_1160711_+	hypothetical protein	NA	S4SX85	Staphylococcus_phage	100.0	3.2e-16
WP_052995610.1|1160703_1160865_+	DUF1270 family protein	NA	C8CGY5	Staphylococcus_phage	98.1	5.6e-20
WP_000291489.1|1160959_1161220_+	DUF1108 family protein	NA	A0A1W6JQ03	Staphylococcus_phage	100.0	7.6e-43
WP_001205732.1|1161228_1161492_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000700554.1|1161500_1163444_+	AAA family ATPase	NA	A0A1P8L6F1	Staphylococcus_phage	100.0	0.0e+00
WP_042109507.1|1163445_1164366_+	recombinase RecT	NA	A0A1P8L6F6	Staphylococcus_phage	99.7	1.9e-165
WP_064135358.1|1164446_1165064_+	MBL fold metallo-hydrolase	NA	A0A1P8L6F7	Staphylococcus_phage	100.0	1.2e-86
WP_000934759.1|1165064_1165535_+	single-stranded DNA-binding protein	NA	A0A1P8L6D9	Staphylococcus_phage	100.0	5.7e-81
WP_000148333.1|1165564_1166458_+	DnaD domain-containing protein	NA	A0A1P8L6F0	Staphylococcus_phage	100.0	3.2e-141
WP_000338528.1|1166464_1166683_+	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
WP_000401969.1|1166691_1167096_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A075M042	Staphylococcus_phage	100.0	8.4e-73
WP_031786348.1|1167108_1167486_+	phage protein	NA	S4V974	Staphylococcus_phage	96.8	5.8e-52
WP_001126832.1|1167486_1167735_+	hypothetical protein	NA	S4SVD3	Staphylococcus_phage	100.0	4.2e-43
WP_015978402.1|1167747_1168149_+	hypothetical protein	NA	S4V6D5	Staphylococcus_phage	100.0	6.6e-70
WP_001105618.1|1168145_1168430_+	hypothetical protein	NA	S4V9L1	Staphylococcus_phage	100.0	3.2e-47
WP_001065026.1|1168422_1168671_+	DUF1024 family protein	NA	S4V7K0	Staphylococcus_phage	100.0	4.1e-38
WP_000185669.1|1168663_1169200_+	dUTP diphosphatase	NA	R4IG63	Staphylococcus_phage	100.0	9.4e-96
WP_053040393.1|1169236_1169473_+	DUF1381 domain-containing protein	NA	R4IH26	Staphylococcus_phage	100.0	1.1e-35
WP_000483477.1|1169497_1169734_+	hypothetical protein	NA	A7TWB3	Staphylococcus_phage	100.0	1.9e-37
WP_001606759.1|1169726_1169900_+	transcriptional activator RinB	NA	R4IFL3	Staphylococcus_phage	100.0	2.9e-22
WP_000989954.1|1169900_1170266_+	hypothetical protein	NA	Q4ZBJ9	Staphylococcus_phage	100.0	3.6e-59
WP_000989960.1|1170266_1170413_+	hypothetical protein	NA	Q4ZBJ8	Staphylococcus_phage	100.0	7.5e-16
WP_000162702.1|1170436_1170859_+	RinA family phage transcriptional activator	NA	Q4ZBJ7	Staphylococcus_phage	100.0	1.2e-74
WP_000594082.1|1171186_1171681_+|terminase	terminase	terminase	R4IH30	Staphylococcus_phage	100.0	1.1e-74
WP_001606760.1|1171673_1172882_+|terminase	PBSX family phage terminase large subunit	terminase	R4IG95	Staphylococcus_phage	100.0	6.1e-236
WP_044425754.1|1172835_1174314_+|portal	phage portal protein	portal	Q4ZB45	Staphylococcus_virus	99.4	9.6e-284
WP_001795666.1|1174252_1175233_+|head	phage head morphogenesis protein	head	Q4ZAW9	Staphylococcus_virus	98.2	3.3e-179
WP_000366932.1|1175330_1175927_+	phage scaffolding protein	NA	R4IG73	Staphylococcus_phage	100.0	5.6e-73
WP_001135558.1|1175947_1176772_+|capsid	N4-gp56 family major capsid protein	capsid	R4IH32	Staphylococcus_phage	100.0	5.6e-148
WP_000278799.1|1176788_1177115_+	Rho termination factor N-terminal domain-containing protein	NA	A0A0E3TAL3	Staphylococcus_phage	100.0	4.3e-51
WP_000338935.1|1177114_1177429_+|head,tail	phage head-tail connector protein	head,tail	R4IFL8	Staphylococcus_phage	100.0	4.0e-54
WP_000482986.1|1177421_1177757_+|head	phage head closure protein	head	A0A2H4PQL0	Staphylococcus_phage	100.0	3.0e-60
WP_001151335.1|1177743_1178157_+	HK97 gp10 family phage protein	NA	R4IG77	Staphylococcus_phage	100.0	2.0e-77
WP_000270196.1|1178169_1178607_+	DUF3168 domain-containing protein	NA	A0A0E3T9M9	Staphylococcus_phage	100.0	2.1e-77
WP_000046067.1|1178593_1179154_+	hypothetical protein	NA	A0A0H4ITY2	Staphylococcus_phage	100.0	5.9e-101
WP_000141082.1|1179215_1179710_+	hypothetical protein	NA	R4IFM1	Staphylococcus_phage	100.0	4.3e-87
WP_063664743.1|1179730_1180072_+	hypothetical protein	NA	R4II68	Staphylococcus_phage	100.0	9.3e-57
WP_044425803.1|1180074_1183044_+|terminase	terminase	terminase	R4IG82	Staphylococcus_phage	100.0	5.3e-281
WP_000560196.1|1183058_1183994_+|tail	phage tail family protein	tail	R4IH41	Staphylococcus_phage	100.0	8.2e-180
WP_063664746.1|1184004_1185891_+|tail	phage tail protein	tail	R4IGA4	Staphylococcus_phage	100.0	0.0e+00
WP_063664751.1|1185903_1187802_+	hypothetical protein	NA	R4IFM4	Staphylococcus_phage	100.0	0.0e+00
WP_031783642.1|1187801_1189625_+|plate	phage baseplate upper protein	plate	A0A0F6N3G2	Staphylococcus_phage	99.8	0.0e+00
WP_044425645.1|1189624_1190032_+	DUF2977 domain-containing protein	NA	R4IG87	Staphylococcus_phage	100.0	2.9e-57
WP_001790193.1|1190006_1190180_+	XkdX family protein	NA	Q8LTH6	Staphylococcus_phage	100.0	1.7e-27
WP_000466769.1|1190220_1190520_+	DUF2951 domain-containing protein	NA	Q4ZBP8	Staphylococcus_phage	100.0	1.3e-46
WP_000524044.1|1190656_1192531_+	glucosaminidase domain-containing protein	NA	A0A2I6PCX0	Staphylococcus_phage	100.0	0.0e+00
WP_001619945.1|1192543_1193782_+|plate	BppU family phage baseplate upper protein	plate	Q4ZB96	Staphylococcus_virus	98.8	1.5e-208
WP_000387943.1|1193786_1194182_+	hypothetical protein	NA	A0A0H4IPB8	Staphylococcus_phage	97.7	8.8e-67
WP_000354128.1|1194236_1194674_+|holin	phage holin	holin	S4SVG2	Staphylococcus_phage	99.3	4.1e-73
WP_001148121.1|1194654_1196100_+	SH3 domain-containing protein	NA	S4SVG5	Staphylococcus_phage	100.0	6.3e-296
WP_000990948.1|1197863_1198046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000180531.1|1198042_1198726_+	hypothetical protein	NA	A0A0A7S0U2	Clostridium_phage	28.3	1.1e-13
WP_001041583.1|1198858_1200796_-	heme uptake protein IsdB	NA	NA	NA	NA	NA
WP_000160859.1|1200998_1202051_-	LPXTG-anchored heme-scavenging protein IsdA	NA	NA	NA	NA	NA
WP_000789821.1|1202259_1202943_+	heme uptake protein IsdC	NA	NA	NA	NA	NA
WP_001246685.1|1202942_1204019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001220199.1|1204015_1204894_+	heme ABC transporter substrate-binding protein IsdE	NA	NA	NA	NA	NA
WP_001548422.1|1204903_1205872_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_001242427.1|1205933_1206668_+	class B sortase	NA	NA	NA	NA	NA
WP_000670950.1|1206686_1207010_+	staphylobilin-forming heme oxygenase IsdG	NA	NA	NA	NA	NA
WP_001788617.1|1207046_1207154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435374.1|1207393_1208134_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_000003566.1|1208513_1209572_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
WP_000908969.1|1209571_1211974_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001284282.1|1212405_1213344_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_000046704.1|1213713_1213980_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_000234068.1|1213980_1214502_+	CvpA family protein	NA	NA	NA	NA	NA
WP_000161938.1|1214574_1216287_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	6.8e-15
WP_001249275.1|1216296_1218645_+	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.4	3.2e-15
WP_001018928.1|1218817_1219132_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_001788625.1|1219194_1219290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390524.1|1219455_1221237_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_000079317.1|1221560_1222175_+	succinate dehydrogenase cytochrome b558 subunit	NA	NA	NA	NA	NA
WP_000818278.1|1222226_1223993_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_000139712.1|1223992_1224808_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001039659.1|1225043_1225844_+	glutamate racemase	NA	NA	NA	NA	NA
WP_000659319.1|1225855_1226443_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000049484.1|1226435_1226939_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_001791787.1|1227066_1227234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739210.1|1227427_1227757_+	complement convertase inhibitor Ecb	NA	NA	NA	NA	NA
WP_000739564.1|1228125_1228527_-	formyl peptide receptor-like 1 inhibitory protein	NA	NA	NA	NA	NA
WP_000195429.1|1228941_1230114_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_000584398.1|1230528_1231035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791581.1|1231294_1231792_+	complement convertase inhibitor Efb	NA	NA	NA	NA	NA
WP_000669537.1|1231941_1232292_+	complement inhibitor SCIN-B	NA	NA	NA	NA	NA
WP_001195973.1|1232653_1232851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032817.1|1233057_1233243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000231632.1|1233864_1234098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001557163.1|1234616_1235936_+|transposase	ISL3-like element IS1181 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP013955	Staphylococcus aureus strain NCCP14562 isolate Sequencing chromosome, complete genome	2910941	1587288	1673872	2910941	capsid,portal,holin,terminase,integrase,plate,tRNA,protease,tail,head	Staphylococcus_phage(83.12%)	105	1623568:1623593	1668269:1668294
WP_000858779.1|1587288_1588581_-|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	31.3	8.7e-55
WP_000525078.1|1588902_1591596_-	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_063664762.1|1591619_1592591_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000361540.1|1592577_1593780_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	43.3	4.2e-35
WP_000690025.1|1593784_1594927_-	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA	NA	NA	NA	NA	NA
WP_000839926.1|1595170_1595488_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_001827022.1|1595823_1596504_-	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_000154683.1|1596575_1597163_-	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_000005212.1|1597152_1597728_-	YpiB family protein	NA	G3MAV7	Bacillus_virus	27.2	2.1e-08
WP_000389524.1|1597741_1598986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000253231.1|1598992_1600291_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000776312.1|1600300_1601365_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_001269921.1|1601390_1602557_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	31.8	5.8e-34
WP_000789522.1|1602942_1603143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000442480.1|1603351_1603801_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_001096471.1|1603892_1604852_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000774684.1|1604853_1605579_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_000450555.1|1605581_1606154_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_001043863.1|1606584_1606857_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000161745.1|1607027_1608026_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000165530.1|1608042_1609353_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_000133961.1|1609574_1610750_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_001800578.1|1611006_1611198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001795818.1|1611278_1611431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000644391.1|1611461_1612121_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000681757.1|1612197_1613166_+	asparaginase	NA	NA	NA	NA	NA
WP_001174258.1|1613280_1614267_-	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_001792205.1|1614427_1614544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000069289.1|1614668_1616129_-	elastin-binding protein EbpS	NA	NA	NA	NA	NA
WP_042109065.1|1616281_1617661_-	ATP-dependent DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	33.3	5.4e-55
WP_001163801.1|1617650_1618604_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001151997.1|1618711_1618960_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001186912.1|1619065_1619611_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_000913243.1|1620012_1620969_-	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001557351.1|1621109_1621364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476346.1|1621439_1622336_-	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_000476865.1|1622393_1623299_-	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_000126130.1|1623388_1623604_-	hypothetical protein	NA	A0ZS61	Staphylococcus_virus	100.0	2.0e-25
1623568:1623593	attL	TAAACATATCATCATAATGTGATGGT	NA	NA	NA	NA
WP_000909213.1|1624325_1625780_-	N-acetylmuramoyl-L-alanine amidase	NA	U5U7D2	Staphylococcus_phage	100.0	2.6e-289
WP_000339146.1|1625790_1626093_-|holin	phage holin	holin	A0A2I6PET6	Staphylococcus_phage	100.0	7.0e-48
WP_000466784.1|1626228_1626528_-	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
WP_000916020.1|1626573_1626738_-	XkdX family protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
WP_001166599.1|1626730_1627120_-	DUF2977 domain-containing protein	NA	A0A2I6PER1	Staphylococcus_phage	100.0	2.2e-62
WP_031775920.1|1627119_1628586_-|plate	phage baseplate upper protein	plate	M1TB09	Staphylococcus_phage	99.8	1.0e-253
WP_044425964.1|1628585_1630496_-	hypothetical protein	NA	U5U4Q1	Staphylococcus_phage	100.0	0.0e+00
WP_000179858.1|1630511_1630802_-	hypothetical protein	NA	U5U457	Staphylococcus_phage	100.0	2.1e-49
WP_000384474.1|1630801_1632385_-|tail	phage tail protein	tail	A0A2I6PEQ5	Staphylococcus_phage	100.0	9.3e-309
WP_001190533.1|1632393_1633218_-|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	100.0	4.1e-159
WP_031860857.1|1633217_1639418_-|tail	phage tail tape measure protein	tail	U5U762	Staphylococcus_phage	99.8	0.0e+00
WP_000438833.1|1639431_1639590_-	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
WP_000589166.1|1639640_1639982_-	hypothetical protein	NA	A0A2I6PEQ2	Staphylococcus_phage	100.0	1.5e-54
WP_000169128.1|1640039_1640495_-	Ig domain-containing protein	NA	A0A2I6PF45	Staphylococcus_phage	100.0	1.3e-77
WP_000807536.1|1640586_1641228_-|tail	tail protein	tail	A0A2I6PEP6	Staphylococcus_phage	100.0	5.9e-121
WP_001023806.1|1641262_1641658_-	DUF3168 domain-containing protein	NA	A0A2I6PEQ4	Staphylococcus_phage	100.0	8.8e-67
WP_000110023.1|1641658_1642060_-	hypothetical protein	NA	A0A2I6PF54	Staphylococcus_phage	100.0	8.1e-68
WP_000395498.1|1642056_1642389_-	hypothetical protein	NA	A0A2I6PES3	Staphylococcus_phage	100.0	4.1e-57
WP_000050973.1|1642400_1642679_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PEQ1	Staphylococcus_phage	100.0	2.1e-46
WP_001142734.1|1642747_1643911_-|capsid	phage major capsid protein	capsid	A0A2I6PEQ3	Staphylococcus_phage	100.0	1.2e-217
WP_000061866.1|1643922_1644696_-|protease	Clp protease ClpP	protease	A0A2I6PEQ7	Staphylococcus_phage	100.0	2.4e-137
WP_001100669.1|1644679_1645918_-|portal	phage portal protein	portal	A0A2K9VBP0	Staphylococcus_phage	100.0	6.9e-235
WP_063664765.1|1645922_1647614_-|terminase	terminase large subunit	terminase	A0A2K9VBQ1	Staphylococcus_phage	99.8	0.0e+00
WP_000778935.1|1647603_1647909_-|terminase	P27 family phage terminase small subunit	terminase	U5U414	Staphylococcus_phage	100.0	2.9e-49
WP_000596031.1|1648033_1648354_-	HNH endonuclease	NA	A0A2K9VBV6	Staphylococcus_phage	100.0	3.0e-57
WP_000513704.1|1648510_1648948_-	transcriptional regulator	NA	A0A2K9VBV2	Staphylococcus_phage	100.0	6.1e-77
WP_001793488.1|1648960_1650328_-	DEAD/DEAH box helicase	NA	A0A2I6PE95	Staphylococcus_phage	100.0	1.7e-263
WP_000665205.1|1650308_1650599_-	VRR-NUC domain-containing protein	NA	U5U7A3	Staphylococcus_phage	100.0	4.9e-51
WP_001801650.1|1650732_1650831_+	hypothetical protein	NA	A0A2I6PDP6	Staphylococcus_phage	100.0	3.7e-11
WP_000884870.1|1650939_1653387_-	virulence-associated E family protein	NA	A0A2I6PEP4	Staphylococcus_phage	100.0	0.0e+00
WP_000265252.1|1653674_1653875_-	DUF1514 family protein	NA	A0A2I6PEP5	Staphylococcus_phage	100.0	4.9e-26
WP_000595263.1|1653942_1654095_-	transcriptional activator RinB	NA	A0A2I6PEM5	Staphylococcus_phage	100.0	2.0e-19
WP_000195810.1|1654091_1654298_-	DUF1381 domain-containing protein	NA	S4V684	Staphylococcus_phage	100.0	7.6e-30
WP_063456476.1|1654334_1654871_-	dUTP diphosphatase	NA	A0A2K9VBU6	Staphylococcus_phage	98.9	3.0e-94
WP_001065026.1|1654863_1655112_-	DUF1024 family protein	NA	S4V7K0	Staphylococcus_phage	100.0	4.1e-38
WP_063664769.1|1655104_1655413_-	hypothetical protein	NA	U5U489	Staphylococcus_phage	100.0	2.8e-52
WP_000979209.1|1655409_1655757_-	hypothetical protein	NA	D2JGL4	Staphylococcus_phage	100.0	5.9e-59
WP_001668982.1|1655753_1656134_-	hypothetical protein	NA	A0A2K9VBT5	Staphylococcus_phage	100.0	8.4e-67
WP_000693989.1|1656136_1656343_-	hypothetical protein	NA	A0A2K9VBT9	Staphylococcus_phage	100.0	3.0e-34
WP_060474161.1|1656356_1656605_-	hypothetical protein	NA	A0A2K9VBX5	Staphylococcus_phage	100.0	1.2e-40
WP_000022722.1|1656604_1656859_-	DUF3310 domain-containing protein	NA	A0A2K9VBW1	Staphylococcus_phage	100.0	1.6e-42
WP_044426014.1|1656855_1657260_-	phage DNA polymerase	NA	A0A2K9VBY6	Staphylococcus_phage	100.0	3.3e-69
WP_001164629.1|1657259_1657445_-	DUF3113 family protein	NA	A0A2I6PEM8	Staphylococcus_phage	100.0	7.0e-27
WP_078064460.1|1657457_1659410_-	DNA polymerase	NA	A0A2K9VBT3	Staphylococcus_phage	100.0	0.0e+00
WP_000645045.1|1659477_1660035_-	DUF2815 family protein	NA	A0A2K9VBT2	Staphylococcus_phage	100.0	1.8e-97
WP_000762525.1|1660060_1661227_-	DUF2800 domain-containing protein	NA	A0A2K9VBU5	Staphylococcus_phage	100.0	7.0e-221
WP_000279445.1|1661223_1661586_-	hypothetical protein	NA	A0A2K9VBV1	Staphylococcus_phage	100.0	6.4e-56
WP_000174995.1|1661600_1661924_-	hypothetical protein	NA	A7TWG2	Staphylococcus_phage	100.0	5.0e-52
WP_015986189.1|1662002_1662164_-	DUF1270 family protein	NA	A7TWG1	Staphylococcus_phage	100.0	6.6e-21
WP_044426023.1|1662175_1662439_-	helix-turn-helix domain-containing protein	NA	A0A2K9VBS9	Staphylococcus_phage	100.0	5.7e-46
WP_001097552.1|1662463_1662679_-	hypothetical protein	NA	A0A2I6PF01	Staphylococcus_phage	100.0	1.9e-31
WP_001128433.1|1662733_1663099_+	hypothetical protein	NA	A0A2I6PF07	Staphylococcus_phage	100.0	2.4e-63
WP_001025401.1|1663067_1663313_-	DUF2829 domain-containing protein	NA	A0A2I6PF15	Staphylococcus_phage	100.0	5.1e-41
WP_000642492.1|1663368_1663578_+	hypothetical protein	NA	W5R9J5	Staphylococcus_phage	100.0	1.2e-30
WP_000939498.1|1663567_1663711_-	hypothetical protein	NA	W5R8I6	Staphylococcus_phage	100.0	2.5e-16
WP_044414793.1|1663725_1664169_-	hypothetical protein	NA	U5U777	Staphylococcus_phage	100.0	2.3e-76
WP_031887876.1|1664192_1664414_-	DUF739 family protein	NA	U5U4R4	Staphylococcus_phage	100.0	5.8e-36
WP_031887877.1|1664574_1665345_+	helix-turn-helix domain-containing protein	NA	U5U470	Staphylococcus_phage	100.0	6.2e-141
WP_001049401.1|1665356_1665503_+	hypothetical protein	NA	U5U441	Staphylococcus_phage	100.0	4.3e-19
WP_000109189.1|1665499_1665685_+	hypothetical protein	NA	U5U7D6	Staphylococcus_phage	100.0	2.3e-25
WP_000705241.1|1665754_1665922_+	hypothetical protein	NA	U5U774	Staphylococcus_phage	100.0	1.7e-24
WP_000440838.1|1666061_1666766_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	U5U4R0	Staphylococcus_phage	100.0	4.6e-127
WP_031766111.1|1666976_1668182_+|integrase	site-specific integrase	integrase	U5U466	Staphylococcus_phage	100.0	1.0e-222
WP_001813515.1|1668224_1670252_-	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	99.5	8.1e-116
1668269:1668294	attR	TAAACATATCATCATAATGTGATGGT	NA	NA	NA	NA
WP_001557355.1|1670244_1671171_-	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_000987774.1|1671414_1673166_-	two-component system sensor histidine kinase SrrB	NA	A0A1V0SGX0	Hokovirus	33.2	2.2e-21
WP_000064078.1|1673146_1673872_-	two-component system response regulator SrrA	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
>prophage 10
NZ_CP013955	Staphylococcus aureus strain NCCP14562 isolate Sequencing chromosome, complete genome	2910941	1812772	1821815	2910941	tRNA	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
WP_000364542.1|1812772_1813291_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_000595011.1|1813312_1815586_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	8.1e-64
WP_000749795.1|1815788_1818068_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_001160682.1|1818342_1818603_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_001112045.1|1818621_1819761_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001019178.1|1819783_1820809_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001005768.1|1820810_1821815_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
>prophage 11
NZ_CP013955	Staphylococcus aureus strain NCCP14562 isolate Sequencing chromosome, complete genome	2910941	1953423	2013136	2910941	tRNA,protease,transposase	Staphylococcus_phage(95.45%)	55	NA	NA
WP_001050566.1|1953423_1959984_-	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	98.3	6.1e-306
WP_000836461.1|1960309_1960621_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	99.0	4.8e-52
WP_001557386.1|1960642_1963060_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.5	0.0e+00
WP_001025067.1|1963347_1964529_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	7.3e-218
WP_000526539.1|1964638_1965592_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
WP_000764419.1|1965588_1966152_+	class I SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
WP_000757543.1|1966274_1966676_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000266096.1|1967246_1968074_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001790712.1|1968076_1968196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001196362.1|1968307_1969309_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.4	2.6e-184
WP_001008549.1|1969430_1969895_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	100.0	4.5e-70
WP_001159037.1|1969907_1971089_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.5	5.6e-226
WP_000493887.1|1971099_1971732_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	98.6	5.5e-111
WP_000077358.1|1971738_1972782_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.8	5.3e-196
WP_001261668.1|1973262_1974765_-	FAD/NAD(P)-binding protein	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	1.9e-29
WP_000221177.1|1975287_1975602_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	9.8e-53
WP_000989121.1|1975601_1976894_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	5.0e-228
WP_063664778.1|1976980_1977835_-	glucosaminidase domain-containing protein	NA	Q4ZCC7	Staphylococcus_virus	39.0	3.4e-39
WP_000384171.1|1978110_1978335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000671057.1|1978533_1979004_+	RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	98.1	8.8e-82
WP_001153742.1|1979116_1979560_+	competence protein ComK	NA	NA	NA	NA	NA
WP_001030469.1|1979546_1979990_-	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.6	2.4e-57
WP_001168903.1|1980285_1980921_+|protease	CPBP family intramembrane metalloprotease SdpA	protease	NA	NA	NA	NA
WP_001096495.1|1981360_1982074_-	transaldolase	NA	M1PR54	Cyanophage	35.3	9.4e-19
WP_000091442.1|1982333_1982636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001200542.1|1982891_1983257_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000623470.1|1983253_1983607_+	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	94.0	3.8e-21
WP_000453306.1|1985603_1986437_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	7.8e-158
WP_000366163.1|1986648_1987557_-	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	100.0	3.4e-138
WP_000933820.1|1987678_1988875_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
WP_000109906.1|1989246_1990839_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
WP_001822900.1|1991216_1991963_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.8	1.4e-142
WP_000672013.1|1991967_1992441_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.7	7.2e-84
WP_000718107.1|1992506_1992764_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000778528.1|1992760_1993762_-	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.3	5.3e-185
WP_000348364.1|1993766_1995245_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.6	2.8e-283
WP_012840523.1|1995403_1995859_-	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	99.3	3.6e-80
WP_001795210.1|1996161_1996812_+	excalibur calcium-binding domain-containing protein	NA	A0A2H4PQM8	Staphylococcus_phage	94.0	2.9e-51
WP_000070642.1|1996892_1997888_+	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.9	2.6e-67
WP_000669024.1|1997962_1998589_+	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	79.8	3.1e-74
WP_000627540.1|1998629_1998971_+	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	1.1e-54
WP_000414216.1|1999071_1999644_+	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	93.1	2.3e-23
WP_001801861.1|2000998_2001094_+	type I toxin-antitoxin system Fst family toxin PepA1	NA	NA	NA	NA	NA
WP_001792025.1|2001216_2001318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000072627.1|2002393_2003623_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	64.7	4.0e-134
WP_000028669.1|2003615_2005172_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	100.0	1.6e-289
WP_001791797.1|2005335_2005470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038752.1|2005532_2006252_-|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	99.6	1.9e-131
WP_011447030.1|2006353_2006461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038704.1|2006409_2007129_-|protease	serine protease SplD	protease	A0A2H4PQP9	Staphylococcus_phage	99.6	4.6e-130
WP_001038872.1|2007249_2007969_-|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	98.7	1.3e-129
WP_001039454.1|2008026_2008749_-|protease	serine protease SplB	protease	A0A2H4PQN0	Staphylococcus_phage	98.3	3.5e-130
WP_001039427.1|2008873_2009581_-|protease	serine protease SplA	protease	A0A2H4PQN3	Staphylococcus_phage	97.0	7.9e-127
WP_001092780.1|2010543_2011125_+	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	64.8	9.6e-54
WP_000195429.1|2011963_2013136_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
>prophage 12
NZ_CP013955	Staphylococcus aureus strain NCCP14562 isolate Sequencing chromosome, complete genome	2910941	2109402	2181371	2910941	transposase,coat,terminase,integrase,tRNA,protease	Staphylococcus_phage(61.11%)	74	2108738:2108762	2184563:2184587
2108738:2108762	attL	ACCCCAACTTGCATTGTCTGTAGAA	NA	NA	NA	NA
WP_000545370.1|2109402_2110830_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_000027919.1|2110842_2112300_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_000170162.1|2112301_2112604_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_000957020.1|2112970_2114509_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_000831700.1|2114597_2115797_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_000774556.1|2115809_2117813_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.2	1.2e-114
WP_000992924.1|2117816_2120009_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000272056.1|2120005_2120698_-	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_001165363.1|2120869_2121172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000572878.1|2121280_2122576_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_000195429.1|2123423_2124596_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_000827746.1|2124767_2125934_+|protease	cysteine protease staphopain A	protease	NA	NA	NA	NA
WP_000434933.1|2125964_2126291_+	staphostatin A	NA	NA	NA	NA	NA
WP_000669862.1|2126582_2126756_-	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_000011542.1|2126736_2127339_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_000040866.1|2127609_2128431_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
WP_000284436.1|2128423_2129893_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	5.9e-108
WP_000897635.1|2130076_2131153_+	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_001177828.1|2131172_2131967_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_001802312.1|2132038_2132146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323161.1|2132156_2133719_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_000275727.1|2133923_2135021_-	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	3.3e-47
WP_000149686.1|2135389_2135950_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_001140871.1|2136002_2136932_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_001792184.1|2137124_2137298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001021210.1|2137349_2138729_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000181315.1|2138848_2139877_-	lactonase family protein	NA	NA	NA	NA	NA
WP_000205106.1|2140146_2140548_+	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
WP_000267034.1|2141120_2141294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001188043.1|2141744_2142785_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_000713072.1|2142841_2143684_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_001033971.1|2143680_2144238_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000966288.1|2144297_2144822_-	membrane protein	NA	NA	NA	NA	NA
WP_000182842.1|2144942_2145506_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001221651.1|2145571_2146312_-	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
WP_000763043.1|2146311_2147184_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	36.0	1.0e-27
WP_000645727.1|2147180_2147861_-	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000991306.1|2147861_2148758_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	5.0e-17
WP_000691584.1|2148754_2149135_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000681968.1|2149392_2149569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000990056.1|2149811_2149910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068542.1|2150109_2151396_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000671712.1|2151674_2151965_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_001557458.1|2151979_2153410_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_078242670.1|2153755_2154790_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	99.6	2.5e-161
WP_000595392.1|2155027_2156044_-	bi-component leukocidin LukGH subunit G	NA	A0A1X9IGW5	Staphylococcus_phage	30.2	6.7e-26
WP_000791411.1|2156065_2157121_-	bi-component leukocidin LukGH subunit H	NA	A0A1X9IGW5	Staphylococcus_phage	34.3	2.8e-35
WP_000206625.1|2157556_2158780_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_001045079.1|2159223_2160531_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_000195429.1|2160651_2161824_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_000746599.1|2162879_2163602_+	staphylococcal enterotoxin type L	NA	A0A1X9H080	Staphylococcus_phage	34.9	2.1e-26
WP_000278088.1|2163770_2164571_-	staphylococcal enterotoxin type C3	NA	A0A097PAT7	Streptococcus_pyogenes_phage	47.5	6.1e-51
WP_000195429.1|2164896_2166069_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_001035616.1|2166690_2167251_+	DUF4888 domain-containing protein	NA	Q4ZBG8	Staphylococcus_virus	68.1	5.4e-62
WP_001035599.1|2168129_2168834_+	toxic shock syndrome toxin TSST-1	NA	NA	NA	NA	NA
WP_001293088.1|2168988_2169558_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	97.4	7.9e-101
WP_000358774.1|2169554_2169896_-	hypothetical protein	NA	A0A1W6JQM3	Staphylococcus_phage	99.1	1.4e-57
WP_000771368.1|2169898_2170426_-|coat	spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	97.1	3.5e-87
WP_000448770.1|2170476_2170695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000846280.1|2170712_2171291_-	hypothetical protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.9	4.8e-29
WP_001190615.1|2171302_2171644_-	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	99.1	1.4e-57
WP_063663566.1|2172093_2172735_-	pathogenicity island protein	NA	Q4ZE67	Staphylococcus_phage	92.5	2.1e-110
WP_000356942.1|2172731_2173112_-	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	96.8	1.7e-67
WP_000447473.1|2173421_2175131_-	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	92.8	1.4e-302
WP_001002689.1|2175144_2176014_-	primase C-terminal domain-containing protein	NA	Q4ZE74	Staphylococcus_phage	96.2	1.5e-164
WP_001078344.1|2176078_2176405_-	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	89.8	1.5e-48
WP_025175789.1|2176407_2176557_-	hypothetical protein	NA	Q4ZE76	Staphylococcus_phage	93.9	2.5e-19
WP_000784885.1|2176609_2176756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000481967.1|2176752_2177070_-	helix-turn-helix domain-containing protein	NA	A0A1W6JQE0	Staphylococcus_phage	98.1	9.2e-51
WP_000153640.1|2177074_2177293_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JB11	uncultured_Caudovirales_phage	66.7	1.3e-19
WP_000620857.1|2177465_2178140_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	45.8	1.6e-39
WP_000179343.1|2178153_2179326_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	96.2	5.8e-215
WP_000240642.1|2179394_2181011_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	3.4e-157
WP_000917289.1|2181086_2181371_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
2184563:2184587	attR	ACCCCAACTTGCATTGTCTGTAGAA	NA	NA	NA	NA
