The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015515	Rathayibacter tritici strain NCPPB 1953 chromosome, complete genome	3354681	71440	83161	3354681	transposase	Burkholderia_virus(100.0%)	13	NA	NA
WP_167542317.1|71440_71554_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_084415693.1|71591_72347_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_084416214.1|72493_72973_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	41.5	2.5e-23
WP_084415695.1|73245_73536_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167542318.1|73815_74268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068250175.1|74264_75812_+	MFS transporter	NA	NA	NA	NA	NA
WP_068250178.1|75808_77377_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_068250179.1|77373_77766_+	PPOX class F420-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_068250182.1|77838_78306_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068250185.1|78396_79419_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_068250189.1|80691_81177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068250191.1|82405_82648_+|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_084415698.1|82687_83161_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP015515	Rathayibacter tritici strain NCPPB 1953 chromosome, complete genome	3354681	678046	740278	3354681	tRNA,transposase	uncultured_virus(27.27%)	58	NA	NA
WP_068251550.1|678046_678490_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_068251553.1|678511_679132_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_068251555.1|679128_679602_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_068251558.1|679598_680663_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.7	8.2e-59
WP_068251561.1|680778_681036_+	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_084416147.1|681209_681446_+	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_068251568.1|681496_681985_+	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_068251571.1|681978_683184_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_068251574.1|683343_683640_+	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	49.5	2.5e-18
WP_068251576.1|683877_684771_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_068251578.1|684940_686227_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_068251581.1|686925_687816_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068251584.1|687828_688425_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_068251588.1|688421_689837_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_167542336.1|689817_691785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167542337.1|692004_692577_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_068251596.1|692573_693812_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_167542313.1|693823_694999_+	pyruvate carboxyltransferase	NA	NA	NA	NA	NA
WP_068251602.1|694995_696018_+	taurine catabolism dioxygenase TauD	NA	NA	NA	NA	NA
WP_068251605.1|696077_696458_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_104258999.1|696537_697767_+	MFS transporter	NA	NA	NA	NA	NA
WP_146076770.1|697956_698160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068251614.1|698509_699286_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	2.8e-16
WP_084415783.1|699282_700314_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.7	5.7e-09
WP_068251617.1|700306_701293_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_084415784.1|701299_702721_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_068251623.1|703100_704603_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.8	2.9e-94
WP_068251625.1|705132_706251_+	GuaB3 family IMP dehydrogenase-related protein	NA	NA	NA	NA	NA
WP_068251629.1|706613_706811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068251632.1|707984_709346_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.1	5.8e-33
WP_068251638.1|710560_711550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068256939.1|711770_712289_+	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_068251641.1|712291_713707_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_068251643.1|713788_714592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068256941.1|714602_715085_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_068251645.1|715080_716679_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.7	1.3e-15
WP_068251647.1|716936_717299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068251649.1|717308_718337_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_068251650.1|718460_719243_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_068251651.1|719448_720489_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_068251652.1|720600_721485_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_068251654.1|721527_723984_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.1	4.7e-110
WP_068251657.1|723988_724579_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_068251661.1|724675_726274_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	8.0e-18
WP_068251663.1|726493_726790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068251666.1|726756_727551_-	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_068251670.1|727759_728923_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_068251673.1|728957_729845_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_068251675.1|730050_731265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146085065.1|731799_732741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068251678.1|732848_733334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167542338.1|733919_734294_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_068251632.1|734863_736225_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.1	5.8e-33
WP_157593779.1|737159_737372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068250249.1|737379_738690_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	73.7	3.0e-188
WP_068251681.1|738727_739000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084415787.1|739214_739955_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084415695.1|739987_740278_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP015515	Rathayibacter tritici strain NCPPB 1953 chromosome, complete genome	3354681	805180	811606	3354681		Lactococcus_phage(33.33%)	8	NA	NA
WP_068251812.1|805180_805462_+	DUF3263 domain-containing protein	NA	A0A0A7RXU7	Mycobacterium_phage	43.1	3.2e-07
WP_068251813.1|805506_806049_+	LytR C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_068210468.1|806217_806421_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	57.8	5.8e-14
WP_068251814.1|806600_808223_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.1	5.3e-150
WP_068251815.1|808406_810059_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.4	9.2e-17
WP_055787731.1|810129_810819_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	1.0e-38
WP_068256966.1|810907_811105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068251819.1|811225_811606_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	38.7	6.4e-06
>prophage 4
NZ_CP015515	Rathayibacter tritici strain NCPPB 1953 chromosome, complete genome	3354681	821145	941567	3354681	tRNA,integrase,transposase	Tupanvirus(28.57%)	58	905823:905882	941568:941676
WP_068251840.1|821145_821838_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084415799.1|821962_822718_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_068251841.1|823159_823978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167542340.1|824297_824444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146085117.1|824632_825151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068251843.1|825243_825819_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_084415800.1|826254_826443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068251847.1|826446_827580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068251850.1|827706_827955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068251853.1|828420_828912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084415801.1|829168_830029_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_084415802.1|830039_831545_-	amidase	NA	NA	NA	NA	NA
WP_068251856.1|831596_832439_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_068256981.1|832456_833110_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_146085118.1|833096_833855_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_157593782.1|834068_845261_+	KR domain-containing protein	NA	D0R7J2	Paenibacillus_phage	31.9	3.6e-32
WP_068251859.1|845257_864550_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.8	5.1e-50
WP_167542341.1|864663_877839_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	32.8	7.3e-32
WP_068251865.1|877835_885509_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.8	2.8e-60
WP_068251867.1|885505_894721_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	22.3	8.0e-78
WP_068251870.1|894717_894981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068251872.1|894973_896260_+	polyketide beta-ketoacyl:ACP synthase	NA	NA	NA	NA	NA
WP_068251875.1|896256_897513_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_068251877.1|897503_899696_+	enoyl-CoA hydratase/isomerase	NA	NA	NA	NA	NA
WP_084415805.1|899692_901609_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_068251880.1|901846_902026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068251884.1|902086_902335_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146085114.1|902750_903464_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	35.7	1.8e-30
WP_068251892.1|903697_903898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068251632.1|903906_905268_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.1	5.8e-33
WP_068251895.1|905264_905600_-	hypothetical protein	NA	NA	NA	NA	NA
905823:905882	attL	CCCACGATCACGACCGAAAGAACCGTCACCACCAAATCCGCCAAACCGTCACCGATGTCC	NA	NA	NA	NA
WP_068251898.1|905985_909900_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.3	2.7e-43
WP_068251902.1|910021_910273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068251906.1|910350_912195_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_167542342.1|912181_913069_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_068251911.1|913169_914549_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_084415808.1|914631_915669_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_068251914.1|917211_917781_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_084416154.1|917783_919148_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	29.0	4.8e-11
WP_068251916.1|919216_920218_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_068256992.1|920196_921801_-	phospholipid carrier-dependent glycosyltransferase	NA	NA	NA	NA	NA
WP_068251919.1|921953_922775_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	40.1	1.2e-38
WP_068256995.1|922868_924446_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	36.0	1.4e-78
WP_084415810.1|924588_925359_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146085098.1|925734_926043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068251920.1|926080_927004_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_104259586.1|927039_927999_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_068251921.1|928008_928944_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_068251922.1|929244_930810_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_068251925.1|930896_932687_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	25.8	5.6e-36
WP_068251926.1|932767_933259_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068251933.1|933487_934963_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	NA	NA	NA	NA
WP_068251935.1|934959_935937_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.4	3.2e-49
WP_084415812.1|936015_937473_-	NADP-dependent phosphogluconate dehydrogenase	NA	M1T2E7	Synechococcus_phage	31.1	5.4e-29
WP_068251938.1|937638_938655_-	glutathione-dependent reductase	NA	NA	NA	NA	NA
WP_104259583.1|938929_939538_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_068251940.1|939631_940216_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_068251942.1|940280_941567_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
941568:941676	attR	CCCACGATCACGACCGAAAGAACCGTCACCACCAAATCCGCCAAACCGTCACCGATGTCCTGAGACAGAACCGTCACCCATGTCCCGAGACTTCACAGTCGAGGGAGCC	NA	NA	NA	NA
>prophage 5
NZ_CP015515	Rathayibacter tritici strain NCPPB 1953 chromosome, complete genome	3354681	2347817	2359676	3354681	transposase	Shigella_phage(50.0%)	12	NA	NA
WP_084415693.1|2347817_2348573_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167542314.1|2348576_2349056_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.3	7.2e-23
WP_084415971.1|2349328_2349619_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_068254714.1|2350023_2350644_-	Pr6Pr family membrane protein	NA	NA	NA	NA	NA
WP_157593798.1|2351589_2352237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157593799.1|2352643_2353102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157593800.1|2353209_2354313_-	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_157593801.1|2354793_2355977_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	38.0	4.7e-39
WP_167542372.1|2356115_2357306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084415693.1|2357386_2358142_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157593802.1|2358342_2358948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084415932.1|2358905_2359676_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP015515	Rathayibacter tritici strain NCPPB 1953 chromosome, complete genome	3354681	2369073	2412968	3354681	integrase,transposase	Bacillus_phage(33.33%)	47	2380502:2380561	2398493:2399404
WP_084415693.1|2369073_2369829_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084415979.1|2369800_2370958_-	insulinase family protein	NA	NA	NA	NA	NA
WP_157593806.1|2370941_2371781_-	insulinase family protein	NA	NA	NA	NA	NA
WP_084415693.1|2372029_2372785_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084415980.1|2372756_2373116_-	insulinase family protein	NA	NA	NA	NA	NA
WP_068254727.1|2373112_2373622_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_167542374.1|2373651_2374500_-	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	33.1	3.8e-27
WP_157593807.1|2374496_2376302_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_167542375.1|2376364_2377561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084415984.1|2377606_2378710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068254731.1|2378737_2379643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084415985.1|2379645_2380569_-	hypothetical protein	NA	NA	NA	NA	NA
2380502:2380561	attL	TGAGGCTTATGCAAAATTGGTTTTTTGCCGAGTGAAAAAGATGAGTCCGCGGACGGCGTT	NA	NA	NA	NA
WP_084415693.1|2380507_2381263_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_084415693.1|2381509_2382265_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157593808.1|2382412_2382586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068254737.1|2383459_2383795_-	Lsr2 family protein	NA	A0A160DF84	Gordonia_phage	47.2	4.6e-16
WP_068254738.1|2383921_2384137_-	Lsr2 family protein	NA	NA	NA	NA	NA
WP_068254739.1|2385046_2385346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068254740.1|2385499_2385718_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068254741.1|2385864_2387004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084415986.1|2387326_2388097_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084415986.1|2388939_2389710_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157593809.1|2390064_2390520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084415987.1|2390783_2391554_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084415988.1|2391877_2392198_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_068254748.1|2392589_2393240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068254751.1|2393236_2394319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068254754.1|2394474_2395017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068254756.1|2395269_2395866_+	methyltransferase	NA	M4QNV0	Tetraselmis_viridis_virus	34.7	5.3e-23
WP_084415693.1|2396169_2396925_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_068254758.1|2397076_2397700_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084415693.1|2397790_2398546_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_068254762.1|2398554_2398746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068254765.1|2398791_2399004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068254768.1|2398996_2401153_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
2398493:2399404	attR	AACGCCGTCCGCGGACTCATCTTTTTCACTCGGCAAAAAACCAATTTTGCATAAGCCTCAGTATGTCCGAGAAGAAGAACGACTCGTGGCTTTCGAGCGCACTGCGTGGAGCCGTCGTCCTGTGTGGAATCGCCGTGCTCGTGTCGATCGCCGCCCGGCTCCTGCTCGAGGTGTGGTGGATCGTGATGATCGTCCTCGCGGTCGGGCTCGGCCTGTGGCTGCTCGTGCGCTTCATCCGCAGGAACGACCTGTGACCCAGCCGAGCAGCGAAACGAGCAGGCAGGCGGAAGGTGGGCGGAATGGCCGGCCGTAAGCAGAAGCCGGGCACGTCGGCGTCGAGTCAGGTCCGCGTGCAGCCGATCTGGAATCAGCCGATCGACCGCCGCAAGTTCGCCCGCGCCGTCATCGCGCTCGTCCTCTGGCAGATGGAGCAGGACCCGGCGAAACGGCGCCCAGCCGCCGACGAGAACTCGACCGACAACTCCCGGATGGACGGGGCATCGGATGCGTAGCGCTCCCCCGCTCATTTGGCGCGAGGTGCACTGGCAGCGTCCCTTCCCGATTGATGCGGCGATGGAGTTGCTGCAGCGGATCGCGACCGAGCCTTCGCTCGGCGCGGTCCGCCTCGAAGCCCGCGCCAGTGCCGCCGGGATCCGCTGGCTCATCGGTCTCGAGAAGCCGCAGATTGGCGTCGGCACGTTGATGGTCAAGCAACTGACCGGCGCCCGCCTCACCGCGCCCATCGGTCCCCGCATCGCTGTCCTCAGCGCCGGCCGCATCCGGCTTCGCCACCCCGCGCTCAGCCTCACCACCGAGCGGATCGGCGCAATCACGCGATCGGTGCTGGCGGCTCTCGCTCAGGCCAATCGAGACGGCGACAAGCTCGTGGTGCAGATCGTCCTGGGTGCACGG	NA	NA	NA	NA
WP_068254771.1|2401313_2402252_+	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_084415693.1|2402161_2402917_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157593810.1|2403189_2404372_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	38.3	2.1e-39
WP_146085131.1|2404311_2404644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068254777.1|2404691_2405033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084415693.1|2405157_2405913_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_146085070.1|2406090_2406456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068254787.1|2408539_2408950_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068254790.1|2408946_2409822_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-13
WP_167542376.1|2410886_2411174_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_084415991.1|2411321_2411612_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_068254797.1|2411630_2412968_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.1	8.5e-29
>prophage 7
NZ_CP015515	Rathayibacter tritici strain NCPPB 1953 chromosome, complete genome	3354681	2498644	2510138	3354681	bacteriocin,transposase	Shigella_phage(66.67%)	10	NA	NA
WP_084416005.1|2498644_2498956_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_146085102.1|2499136_2500132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084416202.1|2500212_2500815_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.8	6.5e-13
WP_146085103.1|2500814_2501855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068254982.1|2501860_2502460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084416006.1|2503648_2504419_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_084416007.1|2504633_2505404_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157593812.1|2505507_2506690_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	37.5	1.4e-38
WP_157593813.1|2507560_2508744_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	37.1	2.0e-37
WP_084415932.1|2509367_2510138_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP015515	Rathayibacter tritici strain NCPPB 1953 chromosome, complete genome	3354681	2539439	2578748	3354681	transposase	Mycobacterium_phage(20.0%)	37	NA	NA
WP_084415693.1|2539439_2540195_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_068255028.1|2540587_2541463_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_146085105.1|2542418_2542571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068255031.1|2542673_2543984_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	73.7	3.0e-188
WP_068255033.1|2544088_2544304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104261923.1|2544300_2544777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068255036.1|2545109_2546567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167542377.1|2547295_2547928_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157593815.1|2548760_2549944_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	37.5	8.0e-39
WP_068255042.1|2550192_2551560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146085106.1|2551929_2553429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104261924.1|2553674_2554994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068255048.1|2555353_2556781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167542378.1|2556938_2557253_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_146085108.1|2557431_2557806_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068255051.1|2558552_2560019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068255056.1|2560172_2560715_+	DUF1992 domain-containing protein	NA	NA	NA	NA	NA
WP_146085109.1|2560965_2561172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068255060.1|2561150_2561345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068255061.1|2561453_2561825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068255062.1|2561886_2562666_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_068255065.1|2562658_2563591_+	oxidoreductase	NA	NA	NA	NA	NA
WP_068255068.1|2563694_2564885_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_068255071.1|2564901_2565753_-	UbiA family prenyltransferase	NA	NA	NA	NA	NA
WP_068255074.1|2565789_2566983_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.0	4.3e-08
WP_068255076.1|2567241_2567907_+	nicotinamide mononucleotide transporter	NA	NA	NA	NA	NA
WP_068255080.1|2568079_2568361_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068255088.1|2568536_2569580_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	34.8	3.0e-45
WP_068255095.1|2569753_2570875_+	sugar-binding protein	NA	NA	NA	NA	NA
WP_068255099.1|2571092_2572622_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	2.2e-17
WP_068255102.1|2572618_2573854_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_068255105.1|2573865_2574483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084416011.1|2574839_2576060_-	MFS transporter	NA	NA	NA	NA	NA
WP_167542379.1|2576091_2576712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084415693.1|2576888_2577644_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_167542380.1|2577615_2577810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084415693.1|2577992_2578748_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP015515	Rathayibacter tritici strain NCPPB 1953 chromosome, complete genome	3354681	3050176	3107057	3354681	protease,holin,transposase	Microbacterium_phage(14.29%)	63	NA	NA
WP_068256049.1|3050176_3051358_+|protease	MarP family serine protease	protease	NA	NA	NA	NA
WP_084416081.1|3051362_3052835_-	phospholipid carrier-dependent glycosyltransferase	NA	NA	NA	NA	NA
WP_068256055.1|3052865_3055160_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	80.1	0.0e+00
WP_068256058.1|3055256_3055481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068256062.1|3055631_3056639_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_068256067.1|3056667_3057525_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_068256068.1|3057626_3058511_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068256071.1|3058552_3059212_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068256074.1|3059377_3062182_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_068256076.1|3062185_3064417_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_104261813.1|3064556_3065534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068256082.1|3065567_3065888_-	chorismate mutase	NA	NA	NA	NA	NA
WP_068256085.1|3065985_3066405_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_068256088.1|3066588_3067764_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_068256091.1|3067824_3067995_-	CsbD family protein	NA	NA	NA	NA	NA
WP_068256094.1|3068141_3068342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068256096.1|3068338_3069223_-	manganese catalase	NA	NA	NA	NA	NA
WP_068256099.1|3069505_3070327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068256102.1|3070323_3070758_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_068256105.1|3070754_3071342_+	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_068256106.1|3071447_3072086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068256107.1|3072124_3072763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068256112.1|3072801_3073467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068256113.1|3073502_3075350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068256116.1|3075502_3076516_+	NADPH:quinone reductase	NA	NA	NA	NA	NA
WP_068256119.1|3076582_3077599_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_104261815.1|3078019_3078169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157593825.1|3078240_3079424_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	37.5	8.0e-39
WP_084416083.1|3079456_3080089_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_068250191.1|3080673_3080916_+|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_084415698.1|3080955_3081429_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084416084.1|3081474_3081975_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_084416085.1|3082309_3083053_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084415695.1|3083071_3083362_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084416214.1|3083634_3084114_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	41.5	2.5e-23
WP_146085129.1|3084117_3084726_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_146085130.1|3084969_3085269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068251632.1|3085783_3087145_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	37.1	5.8e-33
WP_146085122.1|3087692_3087890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068256135.1|3087907_3088354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146085121.1|3088534_3089311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146085120.1|3089326_3090079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068256143.1|3090075_3090528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068256146.1|3090538_3090814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146085119.1|3090849_3091014_-	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
WP_068256148.1|3091188_3091812_-	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	37.2	8.0e-22
WP_068256151.1|3092017_3092614_-	recombinase family protein	NA	A0A219YB42	Aeromonas_phage	44.6	3.3e-33
WP_068257709.1|3092902_3093094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157593826.1|3093133_3093805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068256156.1|3094346_3096965_+	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	22.9	1.5e-29
WP_068256159.1|3097213_3097933_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_068256162.1|3098139_3098664_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_104261838.1|3098656_3099532_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_068256165.1|3099973_3100198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146085046.1|3101008_3101626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146085045.1|3101629_3102400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068256175.1|3102764_3103016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146085044.1|3103430_3103673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084416087.1|3103757_3104528_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084416088.1|3104813_3105257_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_146085043.1|3105246_3105786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068256186.1|3105817_3106039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084416089.1|3106286_3107057_-|transposase	transposase	transposase	NA	NA	NA	NA
