The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011387	Deinococcus puniceus strain DY1, complete genome	2971983	319904	382547	2971983	transposase,integrase	Streptomyces_phage(20.0%)	59	316365:316410	353504:353549
316365:316410	attL	CTCTTAATCAGCGGGTTGTAGGTTCGATTCCTACACGATCCACCAC	NA	NA	NA	NA
WP_157451039.1|319904_320366_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_064013709.1|320408_321236_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_064013710.1|321351_321990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082869598.1|322434_322713_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064015778.1|323709_324120_+|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_082869599.1|324116_324515_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_064013714.1|324566_325253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064015779.1|325541_328778_+	type I restriction-modification system endonuclease	NA	A0A2D1GP10	Streptomyces_phage	28.1	2.1e-12
WP_157451040.1|328829_330173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157451041.1|330275_330416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157451042.1|330467_331223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064013718.1|331264_332740_+	type I restriction-modification system subunit M	NA	NA	NA	NA	NA
WP_157451043.1|332904_334467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064013720.1|334476_334890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064013721.1|334920_335691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064013722.1|336133_336706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064013723.1|336919_337144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064013724.1|337274_340580_+	DUF4157 domain-containing protein	NA	NA	NA	NA	NA
WP_064013725.1|340582_341041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157451044.1|341322_341547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064013727.1|341711_342257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082869601.1|342356_342659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082869602.1|343078_344266_-|integrase	site-specific integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	29.9	3.7e-36
WP_064013729.1|344358_344718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157451045.1|344865_345633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064013731.1|345610_346369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082869603.1|347013_347970_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_082869604.1|347966_349118_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_064013732.1|349748_352085_-	hypothetical protein	NA	A0A2I7S7M1	Vibrio_phage	27.6	2.1e-11
WP_157451046.1|352202_352406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064013733.1|352509_353364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064013734.1|353588_354320_-	HD domain-containing protein	NA	NA	NA	NA	NA
353504:353549	attR	CTCTTAATCAGCGGGTTGTAGGTTCGATTCCTACACGATCCACCAC	NA	NA	NA	NA
WP_082869605.1|354376_354979_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_064013736.1|355017_355608_+	DinB family protein	NA	NA	NA	NA	NA
WP_064013737.1|355715_356795_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_157451047.1|356831_356993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157451048.1|356995_357493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064013739.1|357489_361500_-	DNA polymerase III subunit alpha	NA	A0A0K1Y8J9	Streptomyces_phage	36.1	8.0e-208
WP_082869606.1|361727_361919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064013740.1|361939_362671_-	bifunctional dihydropteridine reductase/dihydrofolate reductase TmpR	NA	NA	NA	NA	NA
WP_064013741.1|362667_363078_-	NUDIX domain-containing protein	NA	Q6IWU4	Burkholderia_phage	28.6	3.4e-05
WP_064015780.1|363181_364687_-	ABC transporter permease subunit	NA	G3M9Y6	Bacillus_virus	34.0	3.8e-25
WP_157451187.1|364689_365550_-	EamA family transporter	NA	NA	NA	NA	NA
WP_064013743.1|365845_366163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064013744.1|366350_367205_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	37.2	2.6e-15
WP_064013745.1|367373_368615_-	MFS transporter	NA	NA	NA	NA	NA
WP_064015781.1|368611_369334_-	endonuclease III	NA	NA	NA	NA	NA
WP_064013746.1|369560_370772_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_157451049.1|370810_371371_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.8	1.1e-19
WP_064013747.1|371447_372584_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_064013748.1|372669_373833_+	vancomycin resistance protein	NA	NA	NA	NA	NA
WP_064013749.1|373910_375158_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_064013750.1|375498_376416_+	class II fructose-1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_064013751.1|376498_377275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064013752.1|377400_379926_+	S8 family serine peptidase	NA	U5J9E4	Bacillus_phage	31.9	9.7e-26
WP_064013753.1|380262_380685_+	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	39.7	1.3e-15
WP_064013754.1|380744_381380_-	LysE family translocator	NA	NA	NA	NA	NA
WP_082869802.1|381297_381984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157451050.1|381887_382547_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011387	Deinococcus puniceus strain DY1, complete genome	2971983	2116498	2123920	2971983	tRNA	Thermobifida_phage(16.67%)	7	NA	NA
WP_064015076.1|2116498_2117341_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	34.5	6.8e-08
WP_082869846.1|2117487_2118744_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	37.4	2.3e-44
WP_064015077.1|2118922_2119954_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_064015078.1|2120028_2121978_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	37.2	8.9e-120
WP_064015079.1|2122250_2122649_-	DUF805 domain-containing protein	NA	D6PSS5	Lactobacillus_phage	28.1	4.3e-05
WP_064015080.1|2122784_2123030_-	NrdH-redoxin	NA	A0A0S2MYD3	Enterococcus_phage	34.6	7.0e-06
WP_064015081.1|2123272_2123920_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.3	1.6e-12
