The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015240	Escherichia coli strain 2011C-3911 chromosome, complete genome	4863599	513	18045	4863599	head,holin,tail,plate	Enterobacteria_phage(83.33%)	19	NA	NA
WP_187648955.1|513_663_+|head	phage head completion protein	head	A0A0A7NPU2	Enterobacteria_phage	97.7	1.2e-16
WP_149024474.1|1207_1504_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.0	1.1e-45
WP_024206773.1|2494_2932_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	5.3e-81
WP_077883434.1|3571_4138_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.9	3.9e-100
WP_001067548.1|4155_4485_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_064055979.1|4488_5385_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	8.7e-155
WP_001761060.1|5377_5908_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	2.1e-92
WP_064055980.1|5910_8061_+|tail	tail fiber protein	tail	Q7Y4D4	Escherichia_virus	82.7	1.3e-300
WP_001164120.1|8064_8592_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	97.7	7.3e-93
WP_000972142.1|8620_9154_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	99.4	1.4e-96
WP_000905061.1|9932_10532_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|10560_11049_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000333503.1|13854_14010_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651580.1|14018_14393_-	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	73.2	4.0e-37
WP_000290450.1|14448_14961_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005358.1|14960_16145_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	9.6e-226
WP_000132788.1|16302_17412_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	2.8e-195
WP_000488107.1|17454_17715_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|17904_18045_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
>prophage 2
NZ_CP015240	Escherichia coli strain 2011C-3911 chromosome, complete genome	4863599	123186	129492	4863599		Enterobacteria_phage(50.0%)	6	NA	NA
WP_032259843.1|123186_123732_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.8	4.0e-54
WP_032259845.1|123736_124615_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	5.6e-106
WP_032259847.1|124672_125572_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	2.8e-28
WP_032259848.1|125571_126657_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.2e-102
WP_000183060.1|127029_127923_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_032326744.1|128097_129492_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 3
NZ_CP015240	Escherichia coli strain 2011C-3911 chromosome, complete genome	4863599	221074	230516	4863599		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292767.1|221074_222211_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
WP_001351453.1|222207_224208_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001295429.1|224332_224794_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|224834_225305_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|225351_226071_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|226067_227753_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|227974_228706_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|228765_228873_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|228853_229585_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_032326746.1|229589_230516_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	31.2	1.3e-23
>prophage 4
NZ_CP015240	Escherichia coli strain 2011C-3911 chromosome, complete genome	4863599	688037	765952	4863599	head,capsid,transposase,terminase,tRNA,portal,tail,integrase,plate,lysis	Salmonella_phage(70.59%)	85	733050:733095	767103:767148
WP_001297411.1|688037_688775_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|688906_690241_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000399648.1|690511_691492_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000365855.1|691728_692610_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|692712_693300_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|693355_693739_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262723.1|694043_694733_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997411.1|694780_695818_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|696024_696444_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001343689.1|696512_697211_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082964.1|697242_699903_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|700016_701372_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|701417_701741_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|701737_703036_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|708814_711388_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|711517_712249_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|712245_713226_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|713360_714098_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|714403_714745_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001700969.1|714848_714896_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200100.1|714994_716155_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|716197_717319_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168044.1|717329_718400_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|718609_718975_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|719124_719643_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969032.1|719632_720859_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|720874_721357_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|721433_721781_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|721822_722590_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|722620_723169_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|723187_723436_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|723572_724934_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|725100_725892_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_032149952.1|725912_727199_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|727253_727847_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|727969_728848_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|728933_730595_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|730743_731085_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|731146_731437_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|731426_731903_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|732034_732517_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
733050:733095	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
WP_000391794.1|733217_733700_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	1.6e-17
WP_000980501.1|733726_733945_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_001011796.1|734013_735114_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.5	3.4e-177
WP_000980413.1|735110_735596_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_032326687.1|735592_738670_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000763311.1|738662_738782_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|738796_739099_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|739153_739669_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_032326686.1|739678_740851_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_032326684.1|740993_741560_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	4.2e-86
WP_001716845.1|741982_742426_+|tail	tail fiber assembly protein	tail	M1SNQ2	Escherichia_phage	62.6	2.7e-48
WP_032326681.1|742397_743000_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	2.7e-99
WP_064055985.1|742999_744508_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	73.3	1.9e-202
WP_001086824.1|744504_745110_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_064055986.1|745102_746011_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	5.0e-142
WP_001399236.1|745997_746357_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_000993775.1|746353_746932_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000829122.1|747000_747447_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	5.1e-63
WP_001039944.1|747439_747871_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	4.4e-72
WP_001399238.1|747966_748395_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	6.4e-47
WP_032326675.1|748391_748769_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	1.8e-16
WP_001069929.1|748770_749283_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	5.2e-88
WP_000171569.1|749263_749479_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	78.9	3.1e-26
WP_000868175.1|749482_749686_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673523.1|749685_750150_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_064055987.1|750245_750896_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	5.6e-111
WP_000742511.1|750899_751958_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216237.1|751974_752808_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_001399240.1|752950_754717_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	98.1	0.0e+00
WP_001717244.1|754716_755442_+|terminase	terminase-like family protein	terminase	A4JWU9	Burkholderia_virus	32.6	3.2e-22
WP_001399242.1|755438_756479_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	90.3	3.4e-174
WP_032326674.1|756513_757947_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_001217575.1|758249_758483_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|758493_758682_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_032326673.1|758835_761250_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
WP_000104153.1|761246_762104_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	8.6e-160
WP_000752613.1|762100_762328_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244228.1|762327_762561_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_032326672.1|762628_762970_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	93.8	6.9e-52
WP_000956174.1|763087_763384_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.1e-21
WP_000460850.1|763391_763901_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.7	3.3e-82
WP_000102105.1|763933_764176_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_032326671.1|764299_764929_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	55.0	6.1e-62
WP_021534483.1|764932_765952_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	94.0	6.4e-186
767103:767148	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAA	NA	NA	NA	NA
>prophage 5
NZ_CP015240	Escherichia coli strain 2011C-3911 chromosome, complete genome	4863599	845520	852660	4863599		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|845520_848082_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141325.1|848187_848844_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	1.6e-49
WP_001297141.1|848894_849662_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|849857_850766_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_064055988.1|850762_852025_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|852021_852660_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 6
NZ_CP015240	Escherichia coli strain 2011C-3911 chromosome, complete genome	4863599	1148173	1159656	4863599	transposase	Stx2-converting_phage(50.0%)	11	NA	NA
WP_032326815.1|1148173_1152268_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	44.0	7.7e-299
WP_000997724.1|1152773_1153139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000264910.1|1153148_1153340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323309.1|1153373_1153583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032327097.1|1153981_1154659_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	4.3e-21
WP_000624622.1|1154658_1155006_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381335.1|1155025_1156597_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.3	2.0e-170
WP_001376509.1|1156787_1157432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226517.1|1157452_1157722_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000502848.1|1157800_1158439_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.5	1.5e-55
WP_001285503.1|1158423_1159656_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.8	7.7e-61
>prophage 7
NZ_CP015240	Escherichia coli strain 2011C-3911 chromosome, complete genome	4863599	2509652	2560422	4863599	protease,tRNA,transposase	Vibrio_phage(12.5%)	55	NA	NA
WP_001294219.1|2509652_2510792_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001307537.1|2510790_2512338_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|2512309_2512771_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990321.1|2512789_2514127_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122510.1|2514136_2515984_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|2515976_2516927_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|2517012_2517321_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|2517396_2518677_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|2518762_2520022_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|2520024_2521029_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|2521110_2521308_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|2521411_2522710_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|2522914_2523340_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|2523378_2525820_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|2525999_2526731_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|2526857_2527259_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|2527277_2527976_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012556.1|2528026_2528686_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547764.1|2528703_2529102_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101654.1|2529111_2529750_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943992.1|2529752_2530916_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	4.9e-81
WP_001339483.1|2530999_2532625_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|2532741_2533017_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|2533165_2533495_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569710.1|2533676_2534426_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|2534422_2535178_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|2535285_2536350_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001300695.1|2536704_2538102_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|2538117_2538423_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|2538432_2538897_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|2538910_2539561_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|2539570_2540425_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|2540424_2541111_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000996729.1|2541207_2541759_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000492914.1|2541833_2542109_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|2542435_2542831_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|2542837_2543152_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|2543156_2543384_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|2543425_2543875_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001351393.1|2543945_2544740_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604912.1|2545362_2545794_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_001367946.1|2545801_2547010_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_001119478.1|2547144_2547783_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|2548001_2548622_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228343.1|2548930_2550343_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331456.1|2550387_2551050_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001351395.1|2551157_2552123_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560552.1|2552231_2553092_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|2553180_2553561_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589460.1|2553689_2555633_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|2555822_2556563_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|2556552_2557110_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|2557434_2557641_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|2557702_2559046_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000399648.1|2559441_2560422_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP015240	Escherichia coli strain 2011C-3911 chromosome, complete genome	4863599	2945053	3018101	4863599	plate,protease,tRNA,transposase	Emiliania_huxleyi_virus(12.5%)	56	NA	NA
WP_001346129.1|2945053_2946406_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|2946435_2948868_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|2948989_2949475_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|2949478_2950504_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|2950608_2951064_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|2951067_2951856_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139659.1|2951855_2953004_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|2953000_2953597_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|2953633_2957116_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|2957128_2958088_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|2958186_2960328_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|2960384_2960774_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|2960838_2962137_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|2962185_2962446_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|2962432_2962633_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|2962798_2963344_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|2963340_2963763_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|2963776_2964487_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001260712.1|2965518_2967237_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|2967348_2968056_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|2968052_2968457_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|2968574_2969390_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|2969429_2970083_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|2970075_2971107_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140174.1|2971294_2971867_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997037.1|2977617_2978421_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.6e-38
WP_000648576.1|2978417_2979332_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|2979572_2980373_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211727.1|2980450_2981221_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|2981268_2982627_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|2982698_2983454_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|2983487_2984210_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|2984206_2984674_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|2984738_2985470_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|2986005_2986791_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|2986927_2987407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032326932.1|2987416_2988331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|2988374_2988857_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087754.1|2988880_2990233_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_063103658.1|2990243_2993678_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240545.1|2993786_2995199_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_005139470.1|2995203_2995896_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000343302.1|2998638_2999400_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246421.1|2999404_3000736_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|3000738_3001263_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|3001259_3002540_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|3002564_3003647_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393854.1|3003610_3005461_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|3005464_3005878_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056978.1|3005884_3007360_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|3007410_3007635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037389.1|3007669_3008170_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|3008867_3009386_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103304.1|3009595_3011737_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.8	3.7e-26
WP_000786991.1|3016307_3016565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420782.1|3016964_3018101_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP015240	Escherichia coli strain 2011C-3911 chromosome, complete genome	4863599	3315297	3381565	4863599	head,capsid,protease,transposase,terminase,portal,tRNA,tail,integrase,lysis	Enterobacteria_phage(64.81%)	76	3325459:3325505	3373039:3373085
WP_000912345.1|3315297_3316683_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|3316718_3317240_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|3317347_3317560_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|3317561_3318428_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|3318908_3319451_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988379.1|3319670_3320363_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001347862.1|3320393_3323003_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691054.1|3323015_3324023_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_032326780.1|3324033_3324549_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|3324551_3325184_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3325459:3325505	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_032326779.1|3325518_3326682_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.5	3.4e-199
WP_000488407.1|3326880_3327159_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|3327206_3327425_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001443983.1|3327523_3327805_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|3327815_3328007_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|3327979_3328162_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|3328158_3328839_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_032326778.1|3328835_3329621_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	3.1e-148
WP_000995455.1|3329626_3329923_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	8.1e-49
WP_023148105.1|3329998_3330289_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001226567.1|3330685_3331066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000858975.1|3331295_3331985_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067459.1|3332089_3332320_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	8.5e-22
WP_001182883.1|3332389_3332929_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.7	6.8e-62
WP_000147932.1|3332925_3333945_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	2.8e-109
WP_000788884.1|3333941_3334643_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	100.0	3.4e-130
WP_000145916.1|3334639_3334942_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	98.9	2.7e-44
WP_001070439.1|3335009_3335342_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|3335389_3335539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032326777.1|3335596_3337123_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	6.1e-31
WP_001385712.1|3337587_3338139_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|3338148_3338946_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|3339062_3339164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054342.1|3339160_3339616_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_000224916.1|3339615_3339786_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|3339778_3340069_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|3340065_3340428_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971068.1|3340424_3340565_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|3340650_3341034_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737275.1|3341222_3342305_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_000839596.1|3342894_3343110_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|3343109_3343607_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|3343823_3344006_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001385713.1|3344096_3344390_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	89.7	2.9e-43
WP_001307652.1|3344750_3344945_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|3345333_3345879_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027269.1|3345853_3347779_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|3347775_3347982_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_032326776.1|3347978_3349580_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	4.6e-308
WP_028985732.1|3349560_3350880_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.6e-232
WP_001295978.1|3350889_3351222_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063280.1|3351277_3352303_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158905.1|3352344_3352743_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_000752979.1|3352754_3353108_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|3353119_3353698_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683145.1|3353694_3354090_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_021514938.1|3354097_3354838_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	4.7e-130
WP_032326775.1|3354853_3355276_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	3.1e-70
WP_000459480.1|3355257_3355692_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_000840354.1|3355684_3358246_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.8	0.0e+00
WP_000847347.1|3358242_3358572_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	3.6e-58
WP_001152653.1|3358571_3359270_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	4.7e-132
WP_032211877.1|3359274_3360018_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	1.1e-142
WP_000090856.1|3359954_3360587_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	5.0e-96
WP_028985733.1|3360647_3364046_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_001230388.1|3364112_3364712_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.5e-110
WP_028985734.1|3364776_3368139_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000885603.1|3368138_3368723_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	2.5e-102
WP_000239881.1|3368777_3369446_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226370.1|3369991_3371476_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201841.1|3371662_3372616_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177469.1|3373128_3373890_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3373039:3373085	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|3374072_3374963_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662366.1|3374963_3377936_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383951.1|3377922_3380160_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420810.1|3380428_3381565_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP015240	Escherichia coli strain 2011C-3911 chromosome, complete genome	4863599	3977324	4041128	4863599	head,capsid,transposase,terminase,portal,tRNA,tail,integrase,holin	Escherichia_phage(30.19%)	73	3968590:3968607	4030362:4030379
3968590:3968607	attL	TGGATGATTTTTCAGATT	NA	NA	NA	NA
WP_000578146.1|3977324_3978518_+	ATP-binding protein	NA	A0A0P0IKU8	Acinetobacter_phage	36.6	5.6e-56
WP_000042165.1|3978517_3979060_+	hypothetical protein	NA	A0A0P0I467	Acinetobacter_phage	25.9	4.5e-05
WP_028985807.1|3979240_3980359_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.7	2.6e-84
WP_000003739.1|3980327_3980597_-	excisionase	NA	NA	NA	NA	NA
WP_000102188.1|3980658_3983202_-	exonuclease	NA	V5UQJ3	Shigella_phage	69.8	1.6e-233
WP_000199482.1|3983294_3983483_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450219.1|3983479_3983668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000559918.1|3984196_3984712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000380318.1|3984825_3984978_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
WP_000367559.1|3985147_3985537_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|3985640_3985916_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000693899.1|3985899_3986325_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_032211818.1|3986347_3987301_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	50.8	3.1e-73
WP_032326795.1|3987307_3988048_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	82.7	1.8e-113
WP_000450863.1|3988077_3988848_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.2	1.8e-84
WP_001141100.1|3988863_3989256_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	61.2	3.8e-38
WP_000072553.1|3989361_3989574_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	90.0	4.4e-33
WP_000209146.1|3989606_3989825_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	90.3	1.2e-28
WP_000224231.1|3989826_3990090_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	70.1	2.2e-29
WP_000207997.1|3990100_3990268_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_001380403.1|3990375_3990609_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	98.7	8.0e-36
WP_000902695.1|3990843_3991056_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	95.7	1.4e-26
WP_000998188.1|3991336_3991504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024210728.1|3991569_3991848_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	3.7e-11
WP_001265189.1|3991849_3992899_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_000904136.1|3992911_3993274_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.9	2.4e-34
WP_001064918.1|3993266_3993932_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.0	1.6e-60
WP_000342737.1|3994184_3994898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917733.1|3995071_3995269_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_000483503.1|3995420_3996479_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	4.4e-206
WP_000271627.1|3996959_3997388_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000382066.1|3998083_3998809_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874443.1|4000673_4002638_+	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.3	8.0e-294
WP_000284506.1|4003006_4003222_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_032211991.1|4003226_4003760_+	lysozyme	NA	S5MQK2	Escherichia_phage	96.0	1.8e-99
WP_001208682.1|4003976_4004183_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735656.1|4004247_4004472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001102157.1|4004917_4005466_+|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	60.0	4.6e-58
WP_072148041.1|4005458_4007366_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.8	1.9e-260
WP_000259002.1|4007349_4007556_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_042965445.1|4007552_4009145_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	7.6e-186
WP_064056014.1|4009134_4010640_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.5	1.0e-99
WP_000256795.1|4010676_4011024_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	57.0	4.4e-22
WP_000522632.1|4011081_4012110_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	2.9e-114
WP_028985947.1|4012161_4012545_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_028985946.1|4012537_4012891_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	5.7e-41
WP_042965441.1|4012906_4013482_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	4.9e-50
WP_028985944.1|4013478_4013874_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	83.2	1.4e-59
WP_001563054.1|4013881_4014631_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	96.0	6.6e-132
WP_000479076.1|4014647_4015079_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	3.1e-41
WP_028985942.1|4015105_4015519_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	5.1e-41
WP_047084558.1|4015499_4018079_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.8	0.0e+00
WP_000847280.1|4018075_4018405_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_001370900.1|4018404_4019103_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.8	3.1e-131
WP_001380365.1|4019113_4019857_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.6	2.3e-148
WP_077632782.1|4019802_4020435_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.4	3.0e-101
WP_064056015.1|4020676_4024144_+	host specificity protein J	NA	S5MW25	Escherichia_phage	98.4	0.0e+00
WP_000078852.1|4024342_4024483_+	type I toxin-antitoxin system Hok family toxin	NA	S5M7Q0	Escherichia_phage	97.8	7.7e-18
WP_000381335.1|4025841_4027413_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.3	2.0e-170
WP_000624622.1|4027432_4027780_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_032327097.1|4027779_4028457_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	4.3e-21
WP_001367204.1|4029313_4029538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047084173.1|4029534_4030209_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	87.9	1.4e-112
WP_001367470.1|4030372_4030702_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
4030362:4030379	attR	TGGATGATTTTTCAGATT	NA	NA	NA	NA
WP_000799399.1|4030866_4031730_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|4031713_4032850_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359447.1|4033099_4034329_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|4034474_4035596_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|4035671_4037132_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|4037131_4037803_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|4037970_4039341_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|4039344_4039986_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|4040021_4041128_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP015240	Escherichia coli strain 2011C-3911 chromosome, complete genome	4863599	4704488	4800658	4863599	head,protease,capsid,terminase,portal,tRNA,tail,holin,lysis	Enterobacteria_phage(28.17%)	105	NA	NA
WP_000984517.1|4704488_4705370_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001315679.1|4705561_4707610_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|4707629_4708328_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|4708424_4708922_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001301337.1|4709051_4710335_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001297532.1|4710303_4712937_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001307251.1|4713016_4714456_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|4714573_4714810_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|4714914_4715106_+	YebW family protein	NA	NA	NA	NA	NA
WP_000976492.1|4716158_4716500_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879285.1|4716512_4717385_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|4717388_4717763_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|4717901_4718132_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011652.1|4718233_4718890_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|4718913_4719576_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000936915.1|4719572_4721633_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|4721841_4722501_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|4722827_4723184_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|4723250_4723541_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173511.1|4723674_4724853_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|4724908_4725550_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|4725586_4727398_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301720.1|4727632_4729108_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
WP_001056694.1|4729445_4730315_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091176.1|4730442_4731885_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|4732015_4732987_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|4733106_4734429_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|4734444_4735377_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|4735455_4736211_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|4736207_4736993_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|4737139_4738150_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580328.1|4738158_4738770_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|4738908_4738974_-	stress response small protein YobI	NA	NA	NA	NA	NA
WP_001024910.1|4739044_4739647_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|4739648_4740170_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|4740204_4740945_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001300367.1|4740973_4741426_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|4741543_4743316_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891620.1|4743625_4744192_+	hydrolase	NA	NA	NA	NA	NA
WP_001261927.1|4744509_4744758_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	85.4	5.2e-33
WP_000547693.1|4745028_4745700_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	100.0	1.4e-125
WP_052920791.1|4745741_4747469_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	S5MDN9	Escherichia_phage	98.6	1.4e-230
WP_000078853.1|4747613_4747754_-	type I toxin-antitoxin system Hok family toxin	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_064056025.1|4747952_4751420_-	host specificity protein J	NA	S5MW25	Escherichia_phage	98.9	0.0e+00
WP_122993547.1|4752334_4752967_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	90.0	7.4e-100
WP_024210906.1|4752912_4753656_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.6	7.7e-149
WP_001385822.1|4753666_4754365_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	99.1	2.1e-132
WP_000738904.1|4754575_4755739_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	66.9	1.6e-140
WP_000343412.1|4755937_4756279_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	82.1	2.6e-51
WP_064056026.1|4756271_4759538_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	78.9	0.0e+00
WP_122993267.1|4759585_4759795_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	1.5e-33
WP_000710952.1|4759890_4760265_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275447.1|4760279_4760996_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	1.4e-126
WP_000133383.1|4761062_4761407_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_000573359.1|4761403_4761850_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	2.0e-75
WP_001029274.1|4761846_4762197_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	6.0e-59
WP_000125990.1|4762206_4762533_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_028985736.1|4762529_4765115_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	96.9	0.0e+00
WP_001063099.1|4765060_4765282_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172990.1|4765326_4767264_-|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.7	0.0e+00
WP_024210905.1|4767327_4768989_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.3	0.0e+00
WP_000958387.1|4768985_4769549_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000829192.1|4769840_4770206_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	96.7	1.6e-62
WP_000095744.1|4770247_4770448_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	97.0	1.3e-29
WP_000828069.1|4770579_4770906_-	TonB family protein	NA	H6WZK5	Escherichia_phage	97.2	1.8e-54
WP_000999673.1|4771349_4771730_-	hypothetical protein	NA	Q716B1	Shigella_phage	98.4	5.5e-66
WP_001109018.1|4771888_4772431_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	99.4	3.1e-99
WP_001385819.1|4772633_4773071_-|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	97.9	2.5e-70
WP_000455399.1|4773078_4773228_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	97.9	2.6e-16
WP_001056870.1|4773227_4773800_-	hypothetical protein	NA	A0A088CD55	Shigella_phage	98.9	2.5e-107
WP_001092896.1|4774074_4774608_-	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	1.4e-99
WP_001385817.1|4774644_4775202_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	83.5	2.1e-50
WP_000284506.1|4775205_4775421_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_064056027.1|4775915_4777880_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	78.6	7.2e-295
WP_032212063.1|4778124_4778448_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	98.1	1.7e-60
WP_000738080.1|4778745_4779015_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649753.1|4779026_4779986_-	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_047084243.1|4780368_4781427_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	4.0e-207
WP_000917768.1|4781577_4781775_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_000043971.1|4782029_4783061_+	hypothetical protein	NA	A0A0P0ZDC5	Stx2-converting_phage	100.0	1.3e-189
WP_001385857.1|4783131_4783593_+	hypothetical protein	NA	A0A0P0ZCX2	Stx2-converting_phage	98.7	6.2e-72
WP_001205471.1|4783614_4783956_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	100.0	1.6e-61
WP_001385858.1|4783973_4784963_-	DUF968 domain-containing protein	NA	A0A0P0ZD76	Stx2-converting_phage	99.4	1.1e-193
WP_001065348.1|4785014_4785272_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	69.7	6.2e-21
WP_000184327.1|4785268_4786669_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	91.8	7.1e-244
WP_064056028.1|4786665_4787556_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	64.1	2.6e-82
WP_000095570.1|4787575_4788487_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	90.3	1.9e-141
WP_000618002.1|4788483_4788708_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	52.1	9.8e-15
WP_039259895.1|4788704_4789556_-	Rha family phage regulatory protein	NA	K7PLX4	Enterobacteria_phage	83.6	1.3e-123
WP_000794367.1|4789552_4790377_-	transporter	NA	Q8W644	Enterobacteria_phage	99.6	1.0e-157
WP_064056029.1|4790429_4791137_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	84.3	8.8e-110
WP_000944728.1|4791218_4791452_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_000800141.1|4791608_4792298_+	helix-turn-helix transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.6	4.0e-115
WP_000387833.1|4792445_4793138_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	63.6	1.0e-38
WP_000147367.1|4793143_4793344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000553978.1|4793541_4793724_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	1.1e-08
WP_032253186.1|4793729_4794302_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	70.7	1.0e-76
WP_021293439.1|4794671_4795499_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	99.3	2.1e-131
WP_001484100.1|4795539_4795911_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.1	2.3e-61
WP_001193437.1|4796102_4796357_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_062873021.1|4796390_4797677_+	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	99.3	3.4e-253
WP_069190626.1|4797681_4798458_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.7e-72
WP_000252980.1|4798510_4798906_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|4798946_4799690_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564745.1|4799686_4800658_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP015240	Escherichia coli strain 2011C-3911 chromosome, complete genome	4863599	4806306	4859793	4863599	capsid,head,plate,terminase,portal,tRNA,tail,integrase,holin	Enterobacteria_phage(70.59%)	65	4811453:4811468	4839230:4839245
WP_001025342.1|4806306_4808040_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001315683.1|4808216_4808705_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|4808824_4809217_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066983.1|4809216_4811295_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278954.1|4811287_4812436_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
4811453:4811468	attL	ACCAATCTCCGCATGT	NA	NA	NA	NA
WP_000983609.1|4812637_4813282_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|4813292_4813682_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|4813696_4814746_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|4814748_4815609_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483202.1|4815627_4817229_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	4.9e-15
WP_001307261.1|4817274_4818936_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|4819080_4819584_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001355823.1|4819604_4821569_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|4821573_4822500_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906336.1|4822496_4823384_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|4823510_4824089_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|4824091_4824442_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122408.1|4825221_4825650_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|4825656_4827081_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|4827055_4827856_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|4828022_4829009_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187810.1|4829023_4830538_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548679.1|4830607_4831597_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|4832393_4832897_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|4832975_4833227_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|4833341_4833428_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237869.1|4833689_4834013_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_000917208.1|4834183_4834681_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377225.1|4834718_4834958_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797573.1|4835148_4836360_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|4836421_4837087_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|4837443_4838445_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|4838450_4838798_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290349.1|4838827_4839478_-	hypothetical protein	NA	NA	NA	NA	NA
4839230:4839245	attR	ACCAATCTCCGCATGT	NA	NA	NA	NA
WP_022581687.1|4839493_4839898_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.3	9.4e-24
WP_001673482.1|4839987_4840125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|4840196_4840400_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_021563448.1|4840421_4840772_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	1.1e-49
WP_000514277.1|4841080_4841323_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021656.1|4841319_4841433_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_064056030.1|4841526_4841937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|4841960_4842164_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_001397288.1|4842160_4842427_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	76.1	4.4e-30
WP_000104305.1|4842423_4842723_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_027663510.1|4842734_4843352_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_021563452.1|4843348_4843714_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	2.5e-60
WP_064056031.1|4843720_4846543_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.3	0.0e+00
WP_001504475.1|4846619_4847579_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.3e-177
WP_000211282.1|4847583_4847898_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000193205.1|4847981_4848824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064056032.1|4848863_4849361_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000087812.1|4850009_4851056_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_025653444.1|4851055_4852807_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262686.1|4852961_4853798_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.6	1.9e-119
WP_064056033.1|4853821_4854874_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.4	7.5e-198
WP_001297575.1|4854919_4855720_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	98.1	7.8e-139
WP_001297578.1|4855821_4856316_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	3.0e-88
WP_000864897.1|4856315_4856516_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000104350.1|4856518_4856842_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|4856838_4857231_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_064056034.1|4857227_4857635_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	1.4e-64
WP_000920594.1|4857772_4858240_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_032145235.1|4858232_4858868_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
WP_077883434.1|4858879_4859446_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.9	3.9e-100
WP_001067548.1|4859463_4859793_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
>prophage 1
NZ_CP015239	Escherichia coli strain 2011C-3911 plasmid unnamed1, complete sequence	125977	0	1435	125977	integrase	Macacine_betaherpesvirus(100.0%)	1	310:322	3717:3729
310:322	attL	CTGCGGAAAAAGT	NA	NA	NA	NA
WP_001066934.1|694_1435_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.9	5.4e-25
WP_001066934.1|694_1435_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.9	5.4e-25
3717:3729	attR	CTGCGGAAAAAGT	NA	NA	NA	NA
>prophage 2
NZ_CP015239	Escherichia coli strain 2011C-3911 plasmid unnamed1, complete sequence	125977	6489	8802	125977	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_032326968.1|6489_6870_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.6e-65
WP_000612591.1|6866_7214_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_064055970.1|7263_8802_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.0	1.0e-296
>prophage 3
NZ_CP015239	Escherichia coli strain 2011C-3911 plasmid unnamed1, complete sequence	125977	11974	12544	125977		Enterobacteria_phage(100.0%)	1	NA	NA
WP_028985823.1|11974_12544_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	33.3	1.1e-14
>prophage 4
NZ_CP015239	Escherichia coli strain 2011C-3911 plasmid unnamed1, complete sequence	125977	27300	29448	125977		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_001620877.1|27300_29448_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	27.7	2.7e-24
>prophage 5
NZ_CP015239	Escherichia coli strain 2011C-3911 plasmid unnamed1, complete sequence	125977	34259	39570	125977	transposase	Stx2-converting_phage(100.0%)	5	NA	NA
WP_064055972.1|34259_35831_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.1	3.3e-165
WP_028985869.1|35850_36198_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	75.7	9.8e-46
WP_032326996.1|36197_36848_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	40.5	1.2e-17
WP_032326997.1|36977_38534_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.1	2.3e-158
WP_032326998.1|38895_39570_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	3.6e-12
>prophage 6
NZ_CP015239	Escherichia coli strain 2011C-3911 plasmid unnamed1, complete sequence	125977	52317	52779	125977		Moraxella_phage(100.0%)	1	NA	NA
WP_000760076.1|52317_52779_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	35.1	6.1e-19
>prophage 7
NZ_CP015239	Escherichia coli strain 2011C-3911 plasmid unnamed1, complete sequence	125977	85383	85605	125977		Erwinia_phage(100.0%)	1	NA	NA
WP_001278977.1|85383_85605_-	conjugal transfer protein TraR	NA	A0A218M4I6	Erwinia_phage	41.7	7.4e-07
>prophage 8
NZ_CP015239	Escherichia coli strain 2011C-3911 plasmid unnamed1, complete sequence	125977	93615	94437	125977		Yersinia_phage(100.0%)	1	NA	NA
WP_001234499.1|93615_94437_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.6	8.8e-45
>prophage 9
NZ_CP015239	Escherichia coli strain 2011C-3911 plasmid unnamed1, complete sequence	125977	97869	100729	125977		Emiliania_huxleyi_virus(50.0%)	3	NA	NA
WP_064055974.1|97869_99834_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.8	2.1e-23
WP_000005990.1|99899_100133_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_032326923.1|100189_100729_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.1	7.1e-43
>prophage 10
NZ_CP015239	Escherichia coli strain 2011C-3911 plasmid unnamed1, complete sequence	125977	104514	110615	125977		Macacine_betaherpesvirus(75.0%)	6	NA	NA
WP_032326920.1|104514_105198_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.5e-29
WP_010891292.1|105274_105580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077836284.1|105583_106483_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817031.1|107134_108106_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000772446.1|108105_109272_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|109859_110615_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
>prophage 11
NZ_CP015239	Escherichia coli strain 2011C-3911 plasmid unnamed1, complete sequence	125977	117854	120470	125977	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_032327097.1|117854_118532_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	4.3e-21
WP_000624622.1|118531_118879_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381335.1|118898_120470_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.3	2.0e-170
>prophage 12
NZ_CP015239	Escherichia coli strain 2011C-3911 plasmid unnamed1, complete sequence	125977	123636	124850	125977	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_149024473.1|123636_124850_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	56.8	9.2e-99
