The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015753	Klebsiella pneumoniae strain W14 chromosome, complete genome	5220857	2470	63852	5220857	head,protease,integrase,tail	Klebsiella_phage(70.59%)	55	10931:10945	43826:43840
WP_049009922.1|2470_2797_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	60.2	1.1e-27
WP_064081070.1|2868_3081_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	58.6	3.4e-09
WP_008806068.1|3082_3433_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	62.9	3.9e-34
WP_048290420.1|3425_3911_+	HK97 gp10 family phage protein	NA	A0A0U3TGT7	Pseudomonas_phage	64.6	2.0e-52
WP_008806070.1|3907_4270_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	77.7	2.9e-48
WP_048290422.1|4334_4817_+|tail	phage major tail protein	tail	A0A286S1Q8	Klebsiella_phage	61.2	3.3e-52
WP_048290424.1|4858_5212_+|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	70.9	1.3e-42
WP_048290427.1|5244_5508_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	88.4	1.4e-39
WP_064081071.1|5572_6040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064081072.1|6081_8505_+	hypothetical protein	NA	A0A286S1S3	Klebsiella_phage	49.3	1.9e-175
WP_048290435.1|8504_8975_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	2.3e-90
WP_064081073.1|9155_9638_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	95.0	5.3e-82
WP_004190616.1|9647_10028_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	77.0	1.5e-55
10931:10945	attL	GCTGCTGACGGAGAT	NA	NA	NA	NA
WP_148719046.1|16148_19283_-	SGNH/GDSL hydrolase family protein	NA	A0A1I9SEN3	Klebsiella_phage	32.4	4.5e-105
WP_057774832.1|19392_19941_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	96.1	2.7e-90
WP_077265035.1|20216_20483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004146386.1|20693_21794_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.8	2.9e-115
WP_023313074.1|21922_23041_-	AbgT family transporter	NA	NA	NA	NA	NA
WP_004176321.1|23164_24610_-	amidohydrolase	NA	NA	NA	NA	NA
WP_064081075.1|24609_25920_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_032435360.1|26086_26995_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064081076.1|27096_27660_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_004143057.1|27656_28463_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002903522.1|28632_29319_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_004151559.1|29329_29986_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_004179693.1|29996_31199_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_032419982.1|31208_32561_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_004151556.1|32550_33315_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_004143067.1|33307_33697_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_064081077.1|34856_36473_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_064081078.1|36636_38289_-	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_004148278.1|38343_39855_-	anion permease	NA	NA	NA	NA	NA
WP_064081079.1|40496_43274_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	6.2e-66
WP_064081080.1|43341_44292_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
43826:43840	attR	ATCTCCGTCAGCAGC	NA	NA	NA	NA
WP_004176303.1|44272_44992_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_048270653.1|44988_46605_-	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_004176301.1|46760_47117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004183912.1|47280_48201_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_048270654.1|48465_50121_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_015958364.1|50281_50677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148719037.1|50684_51908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004148289.1|52510_53437_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064081081.1|53426_54329_-	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_064081082.1|54328_54946_-	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_004148291.1|54949_55909_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
WP_020317020.1|56045_56846_-	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_004143105.1|56845_57679_-	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_004143106.1|57671_57971_-	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
WP_004143107.1|57988_58831_-	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_004176297.1|58830_60486_-	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_002903679.1|60710_61745_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002903681.1|62187_62550_+	multidrug efflux SMR transporter subunit KpnE	NA	NA	NA	NA	NA
WP_002903683.1|62536_62866_+	multidrug efflux SMR transporter subunit KpnF	NA	NA	NA	NA	NA
WP_064081083.1|62915_63026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002903687.1|63039_63852_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP015753	Klebsiella pneumoniae strain W14 chromosome, complete genome	5220857	99061	109966	5220857		Escherichia_phage(87.5%)	9	NA	NA
WP_004892174.1|99061_99682_-	aldolase	NA	A0A077SK32	Escherichia_phage	99.5	1.8e-114
WP_023283677.1|99674_100940_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	4.3e-232
WP_002903955.1|100951_101854_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|102114_102876_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_001620095.1|102914_103775_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004176262.1|104072_104333_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|104419_105508_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176258.1|105538_106804_-	MFS transporter	NA	NA	NA	NA	NA
WP_023283679.1|106858_109966_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.4	0.0e+00
>prophage 3
NZ_CP015753	Klebsiella pneumoniae strain W14 chromosome, complete genome	5220857	868181	949685	5220857	tail,portal,head,terminase,integrase,capsid,holin,tRNA	Klebsiella_phage(45.65%)	84	874576:874593	952980:952997
WP_002911479.1|868181_869969_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
WP_004145564.1|870236_870803_+	hydrolase	NA	NA	NA	NA	NA
WP_004200337.1|870799_871618_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
WP_023157964.1|871670_872066_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_002911486.1|872105_872849_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_064081143.1|872845_873850_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_044245909.1|873931_874675_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
874576:874593	attL	CTTCCTGCGGCGCGGCGC	NA	NA	NA	NA
WP_064081144.1|874751_875321_-	VOC family protein	NA	NA	NA	NA	NA
WP_004151452.1|875556_877290_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
WP_002911497.1|877351_878491_-	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_048290673.1|878495_880079_-	MFS transporter	NA	NA	NA	NA	NA
WP_002911500.1|880432_880861_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_004175414.1|880884_882309_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_002911505.1|882283_883072_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_002911507.1|883233_884214_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_002911516.1|884228_885743_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	6.9e-11
WP_002911518.1|885805_886786_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160540596.1|887147_887246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004175413.1|887677_888187_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_004148869.1|888257_888416_-	succinate dehydrogenase	NA	NA	NA	NA	NA
WP_002911522.1|888481_889993_+	MFS transporter	NA	NA	NA	NA	NA
WP_002911524.1|890030_890282_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_064081145.1|890432_891854_+	MFS transporter	NA	NA	NA	NA	NA
WP_002911528.1|891903_892542_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_020801895.1|892713_892893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004141101.1|892950_893448_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_004175410.1|893483_893723_-	YecH family protein	NA	NA	NA	NA	NA
WP_004151453.1|893914_895126_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_004141106.1|895150_895819_-	YecA family protein	NA	NA	NA	NA	NA
WP_048969316.1|895917_896799_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_159426867.1|896791_897103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064081146.1|897485_897821_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_031280392.1|897810_898524_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	71.7	7.3e-96
WP_017880243.1|898532_899078_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_017880244.1|899153_899516_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_187415970.1|899542_901294_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_064081148.1|901418_901955_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_017880248.1|901989_902415_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	1.7e-52
WP_017880249.1|902427_903717_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	6.6e-172
WP_017880250.1|903764_905516_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_064081149.1|905533_905896_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_064081150.1|905943_906294_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	4.8e-24
WP_017880251.1|906644_908084_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	56.7	7.8e-105
WP_064081151.1|908144_920678_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	46.6	0.0e+00
WP_032432808.1|920740_921346_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	71.8	2.9e-77
WP_031280393.1|921397_921733_-	hypothetical protein	NA	Q6UAW3	Klebsiella_phage	44.1	2.1e-21
WP_017880253.1|921768_922479_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.3	8.5e-137
WP_023289191.1|922480_923236_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	2.7e-125
WP_017880254.1|923232_923571_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	6.4e-58
WP_064081455.1|923570_926906_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.2	0.0e+00
WP_014228914.1|927138_927504_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_014228913.1|927561_928023_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_031280394.1|928054_928447_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	93.1	3.5e-60
WP_017880258.1|928452_928842_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_017880259.1|928822_929161_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.1e-53
WP_020317538.1|929157_929475_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_014907814.1|929455_929716_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
WP_017898995.1|929774_931061_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.5	2.0e-216
WP_064081152.1|931138_932059_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.3	6.9e-147
WP_064081153.1|932095_933355_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	6.2e-223
WP_017880262.1|933354_933534_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	59.6	5.2e-11
WP_012542168.1|935238_935673_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_077265978.1|935922_936354_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.0	3.7e-42
WP_023159881.1|936350_936674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017880264.1|936625_936988_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	84.2	1.8e-58
WP_148719039.1|936971_937178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|938121_938472_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_064081154.1|938468_938963_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	5.8e-76
WP_017880269.1|938962_939178_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_064081155.1|940055_940985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040196267.1|940971_941511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040196270.1|941533_941875_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	86.7	7.8e-56
WP_064081156.1|941893_942874_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	7.1e-134
WP_064081157.1|942898_943708_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	2.7e-110
WP_064081158.1|943704_944619_-	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	59.6	3.1e-30
WP_071925327.1|944581_944788_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.1	2.4e-15
WP_064081160.1|945025_945478_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.5	1.5e-67
WP_064081161.1|945512_945710_-	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	87.7	1.6e-24
WP_040188688.1|945809_946466_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	88.1	1.5e-108
WP_064081162.1|947081_947381_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.6	6.5e-14
WP_042345976.1|947380_948166_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.0	1.3e-61
WP_040188683.1|948162_948354_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	88.9	7.3e-27
WP_071925326.1|948420_948651_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_048324946.1|948650_949685_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	64.0	1.6e-123
952980:952997	attR	CTTCCTGCGGCGCGGCGC	NA	NA	NA	NA
>prophage 4
NZ_CP015753	Klebsiella pneumoniae strain W14 chromosome, complete genome	5220857	4535332	4544795	5220857	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|4535332_4536448_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|4536444_4538385_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|4538461_4538683_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|4539008_4539326_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|4539356_4541636_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|4541755_4541974_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|4542327_4543029_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004179158.1|4543073_4544795_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 5
NZ_CP015753	Klebsiella pneumoniae strain W14 chromosome, complete genome	5220857	4953189	4964210	5220857	integrase	Salmonella_phage(50.0%)	11	4945043:4945056	4965603:4965616
4945043:4945056	attL	CAGTTAACACCGCA	NA	NA	NA	NA
WP_004140269.1|4953189_4953999_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|4954000_4954993_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|4954992_4955883_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_064081404.1|4956029_4957247_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	5.6e-120
WP_022631172.1|4957467_4957707_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	6.8e-22
WP_022631173.1|4957747_4958857_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.7	1.0e-184
WP_064081405.1|4958869_4961923_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	56.0	1.4e-281
WP_014228879.1|4962064_4962409_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016160636.1|4962451_4962646_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_064081464.1|4963463_4963853_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	64.3	3.2e-37
WP_004147982.1|4963988_4964210_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	75.3	1.2e-28
4965603:4965616	attR	CAGTTAACACCGCA	NA	NA	NA	NA
>prophage 6
NZ_CP015753	Klebsiella pneumoniae strain W14 chromosome, complete genome	5220857	4969425	4993912	5220857	terminase,tail,holin	Pseudomonas_phage(20.83%)	31	NA	NA
WP_023279529.1|4969425_4969659_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	72.4	1.3e-25
WP_071925330.1|4969721_4969961_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	60.0	5.0e-17
WP_064081410.1|4970001_4970394_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	4.7e-12
WP_064081411.1|4970593_4971625_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.0	2.4e-95
WP_064081412.1|4971641_4972244_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	4.9e-77
WP_004147997.1|4972487_4972691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017880269.1|4973655_4973871_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_064081413.1|4974360_4974711_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	2.3e-10
WP_004218558.1|4975620_4975866_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_064081414.1|4976728_4977733_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	2.0e-38
WP_004190663.1|4977710_4979018_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_064081415.1|4979017_4980418_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.3	4.1e-127
WP_064081416.1|4980401_4981514_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.9	2.1e-110
WP_032429435.1|4981598_4982384_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	6.0e-67
WP_004190653.1|4982394_4983348_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_159426866.1|4983356_4983629_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_064081417.1|4983669_4984065_+	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	40.8	1.6e-12
WP_004217344.1|4984066_4984450_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_039110587.1|4984451_4985003_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	2.3e-28
WP_064081418.1|4984999_4985392_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217341.1|4985415_4986588_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004226994.1|4986641_4987124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074185736.1|4987261_4987456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032429437.1|4987895_4988075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032417044.1|4988084_4988570_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_032417045.1|4988608_4989091_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	35.4	1.4e-13
WP_077254381.1|4989254_4989596_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	43.3	2.6e-06
WP_064081419.1|4989697_4992580_+|tail	phage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.7e-103
WP_032429439.1|4992579_4993053_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	69.2	1.0e-61
WP_032429440.1|4993039_4993522_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	98.1	5.1e-85
WP_032429442.1|4993531_4993912_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	95.2	1.5e-68
>prophage 7
NZ_CP015753	Klebsiella pneumoniae strain W14 chromosome, complete genome	5220857	5187107	5220546	5220857	terminase,protease,capsid,holin	Salmonella_phage(31.58%)	47	NA	NA
WP_004224598.1|5187107_5187623_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
WP_002903398.1|5187915_5188074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016946280.1|5188685_5188946_-	pyocin activator PrtN family protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
WP_064081437.1|5189079_5189796_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	52.6	5.2e-09
WP_016946283.1|5189968_5190295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064081438.1|5190401_5190662_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	1.6e-29
WP_064081439.1|5190658_5190898_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	83.5	6.8e-30
WP_064081440.1|5190890_5191094_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	89.6	1.7e-29
WP_064081441.1|5191081_5191876_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	9.7e-65
WP_064081442.1|5191868_5192069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060853931.1|5192068_5192596_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	70.3	2.7e-63
WP_064081443.1|5192731_5193562_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	79.5	4.8e-123
WP_020804341.1|5193614_5193986_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	79.5	7.0e-50
WP_064081444.1|5194925_5195420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032429029.1|5195794_5196454_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	87.2	1.2e-113
WP_023343174.1|5196541_5196742_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	80.0	4.3e-22
WP_064081445.1|5196786_5197338_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	69.4	3.8e-68
WP_023322342.1|5197510_5197690_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.6e-13
WP_064081446.1|5197679_5198591_+	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	74.5	3.4e-53
WP_008806045.1|5198587_5199046_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_187415971.1|5199066_5200416_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	48.4	6.6e-106
WP_064081448.1|5200408_5202379_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	54.0	8.2e-198
WP_025713403.1|5202375_5202852_+|protease	SOS-response repressor and protease LexA	protease	U5P451	Shigella_phage	61.8	1.4e-15
WP_042934062.1|5202848_5203247_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	70.6	1.2e-44
WP_020804343.1|5203336_5204158_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	65.8	4.0e-90
WP_077265989.1|5204239_5205226_+	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	49.5	1.0e-92
WP_060853862.1|5205244_5206075_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	47.2	9.8e-60
WP_064081449.1|5206278_5207076_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	48.6	2.1e-67
WP_172616953.1|5207359_5208205_+	hypothetical protein	NA	A0A1B2IGT1	Erwinia_phage	72.8	6.2e-110
WP_048290390.1|5208207_5208360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038808195.1|5208712_5209102_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	79.8	1.2e-47
WP_015874667.1|5209091_5209370_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	76.1	1.8e-34
WP_060853935.1|5209369_5209999_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	75.4	1.1e-87
WP_060853934.1|5210001_5210277_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	39.3	4.9e-08
WP_060853933.1|5210418_5210703_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	76.6	2.3e-32
WP_060853932.1|5211157_5211379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017880217.1|5211667_5211913_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	54.3	1.8e-14
WP_064081450.1|5211975_5212635_-	DUF4145 domain-containing protein	NA	V5URE2	Shigella_phage	47.7	2.3e-56
WP_064081467.1|5212633_5212834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060853867.1|5212950_5213292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064081451.1|5213295_5214753_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	87.6	2.8e-259
WP_071925305.1|5214759_5215269_+	HNH endonuclease	NA	K7PJS8	Enterobacterial_phage	53.8	2.5e-45
WP_064081452.1|5215249_5215843_+	hypothetical protein	NA	S4TR53	Salmonella_phage	70.9	7.0e-84
WP_048290404.1|5215835_5216204_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	79.8	1.8e-50
WP_060853944.1|5216381_5216891_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	68.0	9.3e-53
WP_060853945.1|5216894_5218553_+|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	70.6	5.8e-237
WP_048290409.1|5218611_5220546_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	93.5	0.0e+00
>prophage 1
NZ_CP015755	Klebsiella pneumoniae strain W14 plasmid unnamed2, complete sequence	109349	448	107858	109349	integrase,protease,tail,terminase,portal	Salmonella_phage(87.5%)	116	15237:15258	89986:90007
WP_072196935.1|448_1159_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	59.7	6.6e-73
WP_021313773.1|1168_1738_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.1e-94
WP_060611498.1|1813_4117_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.9	0.0e+00
WP_014342181.1|4247_5390_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
WP_023279499.1|5467_6343_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	85.1	1.2e-140
WP_023279500.1|6536_7640_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	80.1	6.7e-181
WP_072196937.1|7659_8055_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	75.6	5.2e-51
WP_023279502.1|8051_8528_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.6	4.9e-72
WP_023279503.1|8527_9172_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	77.6	4.7e-94
WP_023279504.1|9235_9655_+	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	6.5e-52
WP_023279505.1|9664_10222_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
WP_023279506.1|10347_11181_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	56.4	5.1e-64
WP_023279507.1|11365_11959_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.3	5.9e-99
WP_023279508.1|12156_12390_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.0	7.8e-31
WP_019704565.1|12962_13550_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.2	3.4e-91
WP_071925342.1|13707_14247_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	48.0	6.4e-28
WP_019704567.1|14547_14973_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
WP_060611495.1|14972_15128_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	61.2	2.8e-05
15237:15258	attL	AACAAGTAAGGAAAAACACATG	NA	NA	NA	NA
WP_021313149.1|15255_15834_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	57.0	3.0e-55
WP_060611493.1|15962_17648_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	91.3	0.0e+00
WP_110226589.1|17736_18438_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	70.7	1.2e-79
WP_047066264.1|18553_19195_+	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	85.0	2.0e-97
WP_060611488.1|19191_19728_+	hypothetical protein	NA	J9Q748	Salmonella_phage	76.0	2.2e-76
WP_060611486.1|19724_20093_+	hypothetical protein	NA	F1C5B5	Cronobacter_phage	55.4	9.2e-10
WP_060611484.1|20089_20347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060611483.1|20477_20741_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	72.7	4.4e-30
WP_001554382.1|20921_21350_+	GFA family protein	NA	NA	NA	NA	NA
WP_060611481.1|21548_21866_+	hypothetical protein	NA	J9Q750	Salmonella_phage	74.3	7.1e-43
WP_071925343.1|21904_22204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019704577.1|23790_24009_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	2.9e-27
WP_023279445.1|24021_24234_+	hypothetical protein	NA	J9Q804	Salmonella_phage	77.9	4.4e-25
WP_162493099.1|24382_24682_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	68.7	5.5e-29
WP_004109918.1|24801_25209_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	45.0	2.8e-23
WP_021313141.1|25335_25617_+	ABC transporter	NA	J9Q753	Salmonella_phage	84.9	2.4e-42
WP_049594351.1|25822_26305_+	hypothetical protein	NA	J9Q805	Salmonella_phage	76.9	2.3e-69
WP_004109904.1|26897_27101_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_004109892.1|27151_27802_-	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_123827665.1|28126_28426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342147.1|28435_28966_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	3.5e-71
WP_004109889.1|29121_29559_+	hypothetical protein	NA	A0A1V0E8D6	Vibrio_phage	37.0	9.5e-14
WP_004109887.1|29609_29885_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	3.1e-26
WP_023279440.1|29887_31447_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	93.1	3.1e-280
WP_023279439.1|31506_32211_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	89.3	1.4e-107
WP_014342142.1|32210_32879_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	91.4	1.9e-106
WP_023279437.1|32875_33517_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.2	2.3e-109
WP_023279436.1|33506_34058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004109872.1|34054_34945_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
WP_004109869.1|34954_35221_+	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_004109866.1|35396_36038_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109863.1|36040_37297_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_019704587.1|37329_38904_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	88.7	1.3e-275
WP_023279435.1|38926_39826_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	6.1e-124
WP_004109857.1|39852_40731_+	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_023279434.1|40809_41238_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	70.6	1.8e-28
WP_023279433.1|41285_41720_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
WP_060611525.1|41719_42553_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.0	4.1e-130
WP_004109848.1|42650_42995_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_021313126.1|42985_43459_+	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_047066294.1|43460_43853_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	68.3	2.0e-47
WP_023279430.1|43920_44667_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	82.6	8.1e-106
WP_004109835.1|44728_45046_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_014342129.1|45171_45396_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.2	2.0e-31
WP_064081534.1|45403_49939_+	tape measure protein	NA	J9Q712	Salmonella_phage	69.9	0.0e+00
WP_004109823.1|49982_50318_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	84.5	3.4e-51
WP_064081535.1|50404_51103_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.5e-122
WP_004109817.1|51095_51893_+	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_019704527.1|51880_52492_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
WP_064081536.1|52508_64646_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	57.5	2.4e-29
WP_050597328.1|64698_66144_+|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	38.6	8.0e-41
WP_004109805.1|66234_66558_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_021313119.1|66571_67264_+	structural protein P5	NA	J9Q7Y7	Salmonella_phage	89.6	4.1e-120
WP_021313118.1|67266_67518_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	72.3	5.8e-24
WP_064081551.1|67714_68272_-	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	43.2	3.6e-34
WP_021313115.1|68591_69257_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
WP_072196454.1|69262_69619_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.2e-43
WP_064081537.1|69662_71375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279420.1|71552_72278_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.8	2.5e-128
WP_187415972.1|72342_73401_+	hypothetical protein	NA	J9Q7G4	Salmonella_phage	95.3	8.4e-181
WP_187415973.1|73459_73672_+	hypothetical protein	NA	J9Q7G4	Salmonella_phage	97.1	6.6e-29
WP_162493097.1|73819_74944_+	DNA primase	NA	J9Q720	Salmonella_phage	91.6	2.4e-202
WP_064081539.1|74986_76153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040170962.1|76441_77230_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.5	3.6e-72
WP_064081540.1|77309_77777_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	62.7	7.0e-47
WP_064081541.1|77776_79099_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	86.1	1.0e-228
WP_072241499.1|79110_79275_+	hypothetical protein	NA	J9Q729	Salmonella_phage	72.5	8.7e-13
WP_023279477.1|79258_79474_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	78.6	8.5e-24
WP_047066207.1|79619_79919_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	65.6	6.7e-27
WP_064081542.1|81152_82067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048269888.1|82226_83003_+	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	66.1	1.0e-90
WP_040170138.1|83012_83399_+	phage family protein	NA	Q716B1	Shigella_phage	72.0	4.9e-46
WP_064081543.1|83395_83641_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	46.2	3.5e-13
WP_048269887.1|83735_84353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060853801.1|84362_84773_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_052455483.1|84836_85196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064081544.1|85550_86651_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	1.6e-17
WP_014342091.1|86645_87026_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_064081545.1|87628_89908_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	63.3	2.7e-245
WP_019704545.1|90004_91237_+	AAA family ATPase	NA	J9Q733	Salmonella_phage	86.6	1.3e-212
89986:90007	attR	AACAAGTAAGGAAAAACACATG	NA	NA	NA	NA
WP_064081546.1|91417_94936_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.2	0.0e+00
WP_023279487.1|94950_95376_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	82.3	2.8e-58
WP_023279488.1|95528_95744_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	4.5e-25
WP_014342081.1|96093_96525_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	91.6	1.4e-65
WP_040213770.1|96644_97652_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	88.0	6.0e-144
WP_048331505.1|97712_98657_+	exonuclease	NA	J9Q7S6	Salmonella_phage	93.0	1.4e-171
WP_064081547.1|98656_98923_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	83.0	6.6e-34
WP_064081549.1|100098_100302_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	69.2	1.2e-14
WP_064081550.1|100301_101132_+|protease	serine protease	protease	J9Q7Z4	Salmonella_phage	94.9	9.6e-124
WP_187415974.1|101449_102184_+	hypothetical protein	NA	G4KK93	Yersinia_phage	31.5	3.8e-23
WP_021313782.1|102180_102357_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	68.8	6.1e-12
WP_039817757.1|102719_103055_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	67.6	3.6e-37
WP_014342074.1|103054_103267_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_162493096.1|103718_104936_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	47.3	1.3e-73
WP_042935022.1|105136_105781_+	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	4.9e-99
WP_032440511.1|105856_106351_+	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	72.6	1.6e-65
WP_021313776.1|106539_107625_+	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	84.8	1.1e-183
WP_072196416.1|107624_107858_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	4.4e-18
