The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015724	Salmonella enterica strain C629 chromosome, complete genome	4791723	629518	685489	4791723	head,capsid,tail,plate,portal,terminase,integrase,holin,tRNA	Cronobacter_phage(62.5%)	60	638719:638740	687798:687819
WP_023226578.1|629518_629917_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000031219.1|629919_630225_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000877297.1|630266_630635_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000917512.1|630779_631163_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422141.1|631166_631829_-	DedA family protein	NA	NA	NA	NA	NA
WP_000235363.1|632278_633523_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098833.1|633777_634746_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_023226577.1|635015_636014_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000951045.1|636101_636794_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000202966.1|636945_637443_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_023226576.1|637528_638665_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
638719:638740	attL	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
WP_023226575.1|638745_640764_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_001520281.1|640934_642314_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
WP_064441647.1|642743_644264_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
WP_000478462.1|645428_646997_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.2e-12
WP_089541743.1|646993_647641_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001748617.1|648849_649887_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	65.6	7.1e-124
WP_001748619.1|649873_650767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748620.1|650795_651374_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
WP_001247709.1|651493_651715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|651745_652249_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|652258_652486_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_024139063.1|652475_652901_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.9e-23
WP_001748623.1|652900_653302_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
WP_071592686.1|653448_653625_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|653615_654212_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_000153512.1|654208_654538_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
WP_001748626.1|654527_655388_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
WP_064441649.1|655384_657406_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
WP_064441651.1|657525_657732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|657705_658029_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_001650413.1|658025_659087_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	3.0e-162
WP_051129117.1|659083_660859_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	7.5e-291
WP_000018798.1|661019_661820_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|661881_662904_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218534.1|662907_663612_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000398492.1|663615_663810_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_023181179.1|663906_664359_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	2.3e-63
WP_000084220.1|664355_664862_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560081.1|664858_665566_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000166743.1|666685_667141_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|667150_667444_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|667440_667782_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376374.1|667781_668114_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_000411340.1|668260_668518_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_051129153.1|668705_670676_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.8	3.6e-270
WP_001002797.1|670672_671002_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|670998_672183_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|672175_672763_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|672772_674785_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|674787_675318_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267954.1|675307_676033_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|676004_676550_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_000977529.1|676549_678253_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
WP_001128281.1|678840_679002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|679424_679931_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|680054_681902_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|682051_683797_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|684032_684248_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_023200351.1|684475_685489_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	8.2e-109
687798:687819	attR	TAAGCGCAGCGCCATCAGGCAA	NA	NA	NA	NA
>prophage 2
NZ_CP015724	Salmonella enterica strain C629 chromosome, complete genome	4791723	1181329	1262627	4791723	head,capsid,tail,plate,portal,terminase,integrase,holin,tRNA	Cronobacter_phage(48.72%)	80	1189306:1189321	1216994:1217009
WP_000469807.1|1181329_1182097_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1182137_1182485_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1182640_1183861_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212379.1|1183853_1184372_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1184811_1185882_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023227266.1|1185891_1187013_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210991.1|1187070_1187979_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200077.1|1187939_1189100_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1189199_1189247_-	hypothetical protein	NA	NA	NA	NA	NA
1189306:1189321	attL	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_054175282.1|1189410_1190403_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.1e-109
WP_000085723.1|1190469_1190769_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_002954289.1|1190877_1191216_+	phage regulatory protein	NA	NA	NA	NA	NA
WP_000645096.1|1191241_1191574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1191583_1192153_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_000922120.1|1192155_1192374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054175272.1|1192412_1195070_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	47.6	7.1e-245
WP_001264830.1|1195097_1195367_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	78.4	5.1e-34
WP_054175273.1|1195420_1196440_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
WP_054175274.1|1196436_1198221_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_023375469.1|1198431_1199268_+|capsid	capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	3.6e-46
WP_001176503.1|1199302_1200331_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1200342_1201041_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_000491223.1|1201139_1201592_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_000080871.1|1201588_1202071_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|1202067_1202772_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_054175275.1|1203891_1204347_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1204359_1204656_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1204652_1204994_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|1204993_1205326_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|1205472_1205730_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|1205917_1207885_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|1207881_1208211_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|1208207_1209392_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|1209384_1209972_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|1209981_1211994_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1211996_1212527_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_054175280.1|1212516_1213242_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200789.1|1213213_1213759_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_001748131.1|1216494_1216881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1217038_1217377_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
1216994:1217009	attR	AAAACGCGCCCGAAGG	NA	NA	NA	NA
WP_000197660.1|1217648_1218386_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1218517_1219498_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992640.1|1219494_1220226_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235094.1|1220355_1222929_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_023227274.1|1228876_1229332_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.9e-34
WP_000807818.1|1229435_1230737_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	1.2e-43
WP_001264473.1|1230733_1231057_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1231101_1232457_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082642.1|1232571_1235232_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023227275.1|1235285_1235966_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023227276.1|1236038_1236458_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1236661_1237699_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1237814_1238504_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1238822_1239206_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023227277.1|1239267_1239855_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_023227278.1|1239957_1240857_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023227279.1|1240874_1242209_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083338.1|1242338_1243076_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_023227280.1|1243060_1244683_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1244946_1245111_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1245107_1245683_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1245714_1246365_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812021.1|1246364_1247321_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589049.1|1247317_1247797_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000790154.1|1248048_1249848_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1249864_1250839_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1251112_1251793_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102230.1|1251789_1252695_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1252706_1253435_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818964.1|1253446_1254178_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1254177_1254558_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1254669_1254930_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022463.1|1254967_1255894_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276364.1|1256009_1257206_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_023227281.1|1257227_1258145_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1258182_1259031_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048531.1|1259146_1260040_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361660.1|1260050_1261412_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1261415_1262051_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_023216173.1|1262075_1262627_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP015724	Salmonella enterica strain C629 chromosome, complete genome	4791723	1712779	1721950	4791723	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1712779_1713727_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1713710_1714442_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1714422_1714530_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1714589_1715321_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1715543_1717229_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1717225_1717945_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950415.1|1717991_1718459_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	6.7e-74
WP_023226723.1|1718515_1719046_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1719217_1719676_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023226722.1|1719916_1721950_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 4
NZ_CP015724	Salmonella enterica strain C629 chromosome, complete genome	4791723	1800981	1811488	4791723		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023226691.1|1800981_1802385_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1802562_1803456_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1803832_1804918_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_023226690.1|1804917_1805817_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.8e-30
WP_023226689.1|1805864_1806743_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_000973709.1|1806743_1807295_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_023200991.1|1807300_1808275_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1808290_1809064_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565903.1|1809068_1810148_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000126349.1|1810174_1811488_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP015724	Salmonella enterica strain C629 chromosome, complete genome	4791723	1921607	1932897	4791723	integrase	Burkholderia_phage(25.0%)	12	1915861:1915876	1930208:1930223
1915861:1915876	attL	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023226634.1|1921607_1922789_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	26.9	2.4e-35
WP_023226633.1|1922789_1923536_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_023226632.1|1923637_1924894_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	41.3	3.4e-80
WP_023226631.1|1925374_1925536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1925662_1926082_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023194544.1|1926084_1927353_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.7	3.8e-228
WP_000208509.1|1927807_1928020_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1928030_1928219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154957.1|1928477_1929656_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	8.6e-110
WP_023227458.1|1930306_1930618_+	hypothetical protein	NA	NA	NA	NA	NA
1930208:1930223	attR	GAACAGGTGGATAAGG	NA	NA	NA	NA
WP_023227459.1|1930697_1931393_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001157305.1|1931466_1932897_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP015724	Salmonella enterica strain C629 chromosome, complete genome	4791723	2084263	2152798	4791723	integrase,transposase,tRNA,protease	Shigella_phage(37.5%)	60	2130080:2130096	2144667:2144683
WP_023227145.1|2084263_2084959_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290594.1|2085030_2085612_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_000758418.1|2085816_2087502_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
WP_023227146.1|2087574_2088702_+	ribonuclease D	NA	NA	NA	NA	NA
WP_001185666.1|2088822_2089089_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000101047.1|2089092_2089905_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001579595.1|2089928_2090636_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_001525604.1|2090761_2091055_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_001519895.1|2091104_2091764_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000785857.1|2091841_2092303_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001519337.1|2092654_2092792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001083582.1|2092983_2093157_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000018967.1|2093228_2093570_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000943475.1|2093678_2094209_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000406438.1|2094350_2095895_-	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000234826.1|2096114_2096834_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_001240763.1|2096880_2098413_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_001266935.1|2098735_2100034_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000197909.1|2100047_2101118_+	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_000338376.1|2101180_2102914_-	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_023227608.1|2103010_2103925_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000776974.1|2104095_2104707_+	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_023227609.1|2104720_2105455_-	flagellar brake protein YcgR	NA	NA	NA	NA	NA
WP_000511323.1|2105623_2105878_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_023227610.1|2105940_2107653_-	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_001526439.1|2107866_2109141_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_000270301.1|2109535_2109625_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_023227611.1|2109637_2110774_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_023227612.1|2110785_2112330_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000063363.1|2112404_2113253_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_023227613.1|2113249_2113654_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_023227614.1|2113643_2114240_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000147031.1|2114236_2114968_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000070982.1|2114986_2116780_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_023227615.1|2116776_2117895_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_023227616.1|2118388_2119654_+	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
WP_089541817.1|2122216_2123444_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.7e-170
WP_000136607.1|2124882_2127393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442952.1|2127396_2129961_+	hypothetical protein	NA	NA	NA	NA	NA
2130080:2130096	attL	TCAAACTGTTTTATTGA	NA	NA	NA	NA
WP_000716184.1|2130267_2130582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001232453.1|2130593_2131112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108266.1|2131165_2131693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442951.1|2131705_2131975_-	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	61.9	4.1e-15
WP_000093666.1|2132095_2132476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174655.1|2132633_2133176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142750.1|2133198_2133687_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_050516501.1|2133814_2134210_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_019841938.1|2134270_2134630_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000744655.1|2134739_2135357_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000213673.1|2135433_2136381_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	31.3	6.2e-10
WP_000870315.1|2136594_2137041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999224.1|2137305_2137500_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000468111.1|2137501_2138374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165488789.1|2138583_2139812_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	3.2e-176
WP_001218334.1|2140068_2143971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087212.1|2144292_2145978_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
2144667:2144683	attR	TCAATAAAACAGTTTGA	NA	NA	NA	NA
WP_000151475.1|2145987_2146653_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000699006.1|2146653_2148051_-	hypothetical protein	NA	A0A2H4UW05	Bodo_saltans_virus	24.8	6.6e-08
WP_069067343.1|2151388_2151727_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	92.5	2.4e-33
WP_001443045.1|2151646_2152798_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	4.1e-40
>prophage 7
NZ_CP015724	Salmonella enterica strain C629 chromosome, complete genome	4791723	2247129	2252941	4791723		Escherichia_phage(33.33%)	8	NA	NA
WP_000230462.1|2247129_2247936_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2247937_2248930_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2248929_2249820_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_023227163.1|2249943_2250345_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	3.8e-33
WP_170967352.1|2250644_2251529_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.5	5.6e-37
WP_023227161.1|2251838_2252108_+	recombination protein NinG	NA	S4TSR3	Salmonella_phage	92.1	1.8e-26
WP_071525147.1|2252462_2252603_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	1.1e-08
WP_071601154.1|2252641_2252941_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	57.1	2.2e-14
>prophage 8
NZ_CP015724	Salmonella enterica strain C629 chromosome, complete genome	4791723	2721245	2728708	4791723	transposase	Escherichia_phage(42.86%)	8	NA	NA
WP_000497451.1|2721245_2721485_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_023226907.1|2722358_2723168_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	9.2e-63
WP_001277616.1|2723240_2723618_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_023226906.1|2723765_2724308_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	1.1e-70
WP_023218771.1|2724499_2725228_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	1.4e-62
WP_023226904.1|2725244_2725658_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
WP_023226903.1|2726608_2727733_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000502119.1|2728249_2728708_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 9
NZ_CP015724	Salmonella enterica strain C629 chromosome, complete genome	4791723	3553133	3643072	4791723	tail,plate,portal,protease,terminase,integrase,holin,lysis,coat	Enterobacteria_phage(46.34%)	131	3552800:3552845	3639181:3639226
3552800:3552845	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000915528.1|3553133_3553496_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3553492_3554425_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3554414_3555872_+	glucosyltransferase domain-containing protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000129933.1|3555930_3557934_-	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000532177.1|3558069_3558318_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|3558338_3558632_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_001029860.1|3558770_3560747_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_000246977.1|3560746_3562183_-	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_000964904.1|3562193_3562883_-	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000627593.1|3562885_3563341_-	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000774917.1|3563340_3564042_-	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_001122420.1|3564045_3565464_-	packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_001166103.1|3565423_3565924_-	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538670.1|3565907_3566468_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001196937.1|3566508_3567801_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_051129359.1|3567800_3568709_-	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	94.1	4.3e-149
WP_051129358.1|3568722_3570888_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.6	0.0e+00
WP_051129357.1|3570888_3572388_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.4	9.1e-306
WP_000729923.1|3572365_3572854_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3572857_3573262_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3573261_3573651_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3573654_3573897_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_000877028.1|3574119_3574650_-	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_001687043.1|3574862_3575330_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3575326_3575824_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3575801_3576005_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047566.1|3576435_3577209_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|3577205_3577385_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|3577365_3577569_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|3577565_3577790_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001108073.1|3577786_3578398_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000950963.1|3578390_3578567_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001532927.1|3578559_3578901_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000113770.1|3578903_3579080_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679703.1|3579046_3579220_-	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000736891.1|3579216_3579654_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_001036030.1|3579727_3579997_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_001248410.1|3579993_3581370_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_000539342.1|3581366_3582188_-	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_000166961.1|3582174_3582336_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_001103492.1|3582370_3582652_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3582762_3582978_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3583088_3583778_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|3583942_3585022_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000834175.1|3585060_3585264_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_000216178.1|3585627_3585930_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_001066179.1|3585942_3586530_-	super-infection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000213982.1|3586743_3586938_+	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_072097849.1|3587021_3587636_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	94.4	7.0e-47
WP_000713613.1|3587669_3587957_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_000776963.1|3588232_3588547_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3588631_3588790_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_051129356.1|3588770_3588926_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	4.7e-24
WP_000902092.1|3588948_3589092_+	hypothetical protein	NA	A0A2H5BFM6	Salmonella_phage	100.0	6.4e-20
WP_001046968.1|3589088_3589796_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|3589795_3590080_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|3590126_3590420_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|3590430_3590601_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_000812203.1|3590597_3591107_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_071533029.1|3591103_3591337_+	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_025617570.1|3591323_3591968_+	ead/Ea22-like family protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_000371199.1|3591967_3592252_+	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_000002104.1|3592244_3592529_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_155675089.1|3592597_3592738_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000051897.1|3592967_3594131_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_129406984.1|3594689_3595892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064441708.1|3595951_3597190_-	hypothetical protein	NA	S4TRC1	Salmonella_phage	44.6	1.0e-92
WP_031604121.1|3597191_3597623_-|tail	tail assembly chaperone	tail	K7P7H0	Enterobacteria_phage	37.1	1.1e-11
WP_064441710.1|3597635_3598403_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	58.0	1.4e-44
WP_064441712.1|3598402_3599083_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	77.9	1.8e-104
WP_064441714.1|3599079_3600270_-|plate	baseplate J/gp47 family protein	plate	A0A2H4J5T1	uncultured_Caudovirales_phage	75.6	2.5e-165
WP_064441716.1|3600270_3600624_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	75.2	5.3e-47
WP_064441718.1|3600623_3601379_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	72.4	8.0e-85
WP_064441720.1|3601572_3601920_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	57.1	1.9e-25
WP_064441722.1|3601906_3602998_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	59.4	1.9e-119
WP_064441723.1|3603000_3603303_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	55.0	1.3e-25
WP_064441725.1|3603268_3603889_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	62.9	8.4e-56
WP_064441727.1|3603888_3605865_-	hypothetical protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	45.1	1.3e-134
WP_064441729.1|3605861_3606008_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	74.5	3.2e-14
WP_064441731.1|3606043_3606487_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	52.8	7.9e-32
WP_064441733.1|3606490_3606931_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	8.3e-58
WP_064441837.1|3606940_3608092_-	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	81.5	2.2e-174
WP_064441735.1|3608097_3608649_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	45.7	8.8e-41
WP_064441736.1|3608641_3609046_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	71.8	9.7e-45
WP_064441738.1|3609045_3609555_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	42.4	2.2e-22
WP_064441740.1|3609554_3609971_-	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	63.0	2.7e-42
WP_064441742.1|3609957_3610305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441744.1|3610345_3611287_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.7	9.2e-139
WP_064441746.1|3611298_3611793_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	9.3e-50
WP_064441748.1|3611796_3612999_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.5	1.4e-107
WP_064441838.1|3613050_3613599_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	54.6	1.1e-43
WP_064441750.1|3613654_3615106_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	69.0	1.4e-191
WP_064441752.1|3615110_3616724_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	84.4	3.0e-278
WP_064441754.1|3616726_3617200_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	69.5	9.6e-52
WP_064441756.1|3617230_3617863_-	hypothetical protein	NA	I6S676	Salmonella_phage	75.9	7.9e-94
WP_064441758.1|3617951_3618155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441840.1|3618230_3618665_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	59.7	6.1e-37
WP_064441760.1|3618697_3619138_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	84.6	1.0e-63
WP_064441762.1|3619121_3619445_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	73.3	1.6e-37
WP_064441763.1|3620088_3620778_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	4.9e-57
WP_064441765.1|3620887_3621481_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	58.1	2.1e-56
WP_077951536.1|3621473_3621644_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	61.8	2.9e-11
WP_064441767.1|3621636_3622086_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	51.4	1.8e-36
WP_063161920.1|3623012_3623435_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	85.2	6.1e-66
WP_064441771.1|3623436_3623970_-	ead/Ea22-like family protein	NA	A0A193GYX5	Enterobacter_phage	38.5	6.0e-10
WP_064441773.1|3623966_3624212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441777.1|3624696_3624996_-	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	48.4	3.1e-16
WP_064441779.1|3624995_3626429_-	AAA family ATPase	NA	Q716D2	Shigella_phage	86.5	2.0e-230
WP_064441781.1|3626418_3627318_-	hypothetical protein	NA	A0A0N7C1Z7	Escherichia_phage	55.0	2.4e-80
WP_015571544.1|3627310_3627457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441783.1|3627546_3628113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001514164.1|3628142_3628394_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	54.7	9.0e-17
WP_064441784.1|3628521_3629214_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.4	6.9e-59
WP_063407876.1|3629249_3629726_+	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	64.7	1.4e-50
WP_064441842.1|3630348_3630954_+	hypothetical protein	NA	A0A2C9D0J8	Yersinia_phage	36.6	2.5e-28
WP_167802264.1|3631344_3631503_+	hypothetical protein	NA	M9NZI5	Enterobacteria_phage	88.5	3.5e-19
WP_064441788.1|3631499_3631703_+	hypothetical protein	NA	K7PM31	Enterobacteria_phage	80.9	9.5e-25
WP_064441790.1|3631773_3632712_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	73.7	1.6e-37
WP_064441792.1|3632719_3633004_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	61.7	3.1e-29
WP_064441794.1|3633018_3633864_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.0	3.7e-70
WP_064441796.1|3633860_3634541_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	91.2	4.8e-121
WP_064441798.1|3634537_3634969_+	hypothetical protein	NA	G8C7S8	Escherichia_phage	65.0	3.5e-45
WP_064441800.1|3635126_3635609_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.4	5.5e-71
WP_064441802.1|3635605_3636271_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	83.3	1.6e-105
WP_064441804.1|3636270_3636495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064441806.1|3636491_3637097_+	hypothetical protein	NA	R9VWB9	Serratia_phage	46.8	1.8e-47
WP_064441808.1|3637096_3637318_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	48.4	2.7e-09
WP_064441812.1|3638002_3639166_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	68.3	2.5e-154
WP_000893225.1|3639371_3640622_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	4.7e-98
3639181:3639226	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|3640633_3641737_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043667.1|3642019_3643072_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
>prophage 1
NZ_CP015725	Salmonella enterica strain C629 plasmid pC629, complete sequence	210106	52	30230	210106	integrase,transposase	Escherichia_phage(45.45%)	37	12218:12232	29473:29487
WP_001067855.1|52_757_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|900_1455_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|1585_2416_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|2553_3186_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|3270_3723_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|3945_4293_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|4286_5126_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|5253_5457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|5612_6818_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|6828_7134_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|7360_8125_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|8617_9202_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|9201_10440_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|10436_11342_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|11463_12168_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
12218:12232	attL	TTTGCAACAGTGCCC	NA	NA	NA	NA
WP_001300294.1|13557_14226_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|14261_14498_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|14494_14857_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|14874_16569_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001447540.1|16620_17043_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|17078_17354_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|17367_17718_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|17789_18224_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|18466_19171_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_032495672.1|19465_20278_+	subclass B1 metallo-beta-lactamase NDM-9	NA	NA	NA	NA	NA
WP_004201167.1|20281_20647_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|20651_21290_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|21300_22332_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201171.1|22336_22666_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000050481.1|23106_24648_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|25052_25892_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|25885_26233_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|26396_27188_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|27193_27484_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|27595_28093_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|28237_29251_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|29525_30230_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
29473:29487	attR	GGGCACTGTTGCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP015725	Salmonella enterica strain C629 plasmid pC629, complete sequence	210106	149340	180425	210106	integrase,transposase	Escherichia_phage(33.33%)	25	174127:174186	187838:188659
WP_000948429.1|149340_150540_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_064441847.1|150687_151452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167416.1|151532_152294_+	methyltransferase	NA	A0A2I7RNS1	Vibrio_phage	32.9	1.2e-19
WP_000149861.1|152387_152651_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	46.5	3.2e-09
WP_000491822.1|152695_153283_+	hypothetical protein	NA	A0A248SKW5	Klebsiella_phage	71.1	1.1e-09
WP_000681217.1|153747_156168_+	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_000159529.1|158165_159254_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	50.6	2.4e-82
WP_001572417.1|160361_162818_-	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_000948429.1|163719_164919_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|164928_165117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064441864.1|165208_165745_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
WP_000027057.1|165927_166788_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_012372818.1|166957_167713_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_015059004.1|167793_168075_-	sodium/hydrogen exchanger	NA	NA	NA	NA	NA
WP_001067855.1|168162_168867_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002914189.1|169186_170362_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_000347934.1|170385_173538_+	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_000888203.1|173608_174088_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
174127:174186	attL	GGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_001067855.1|174179_174884_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000503573.1|175085_175874_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|176004_176478_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|176635_177649_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|177851_178202_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001161490.1|178377_178938_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001067855.1|179720_180425_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
187838:188659	attR	AATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCCTTTCGACTACCTCCCCTCAAAGCCATATCACGTACGTTAATCCTGACTTCATTAAAATCAGTGGTTTCACTGAGGAAGAACTATTAGGCCAGCCTCACAACATCGTAAGACACCCAGATATGCCGCCTGCTGCATTTGAGCATATGTGGAGTACATTAAAATCTGGCCGCTCATGGATGGGGCTAGTAAAAAATCGCTGTAAAAATGGCGACCACTATTGGGTAAGTGCTTATGTAACGCCAATAGCTAAGAATGGTTCGATTGTTGAATACCAGTCTGTAAGGACCAAGCCTGAACCTGAGCAGGTTTTGGCTGCGGAAAAATTATATGCTCAATTGAGAAGCGGGAAGGCCGCGAGGCCGAAATTGGCTGCTAGCTTTTCCGTGAAAATACTCTTGCTCATATGGGGTAGTATTATATCAAGCGCAATGGCTGCCGGCATGCTTACTGATACATCAATAAGCAGCTTATTGTTACCAGGAATCAACGCCTTTACCCGCTGCCGGAGCCTCACCTCAATAGCACTCTCCGGCAGCCGTATTGTTACAGCGAATCAAACTGATAGCTGACCGATAGCCCAACGCCATAGTTACGGCCCGGCGCCGGTTCATAATAGCGTCCGTTGCTCTCGTTGACGATAACAGAAGCGACGTAGCGCTTATCAAACAGGTTATCAACGCGCGTATAGAGGTCGACGGTCCAGTTATCTAGCACATATTTATAGCCGGTATTCAGTGCCGTCACCGTATAGGCTGGAGCCTG	NA	NA	NA	NA
>prophage 3
NZ_CP015725	Salmonella enterica strain C629 plasmid pC629, complete sequence	210106	184767	191475	210106	transposase	Escherichia_phage(33.33%)	6	NA	NA
WP_032193599.1|184767_185472_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_001067858.1|185501_186206_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_014839980.1|186336_186753_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001067855.1|187139_187844_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013362812.1|189596_190565_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_013188475.1|190599_191475_-	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
