The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	199900	273148	5645219	protease,transposase,plate,tRNA	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_001295561.1|199900_201253_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|201282_203715_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|203835_204321_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|204324_205350_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|205454_205910_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565963.1|205913_206702_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139661.1|206701_207850_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569419.1|207846_208443_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001294772.1|208479_211962_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000055741.1|211974_212934_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020954.1|213032_215174_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|215230_215620_+	VOC family protein	NA	NA	NA	NA	NA
WP_000062312.1|217031_217292_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217278_217479_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|217644_218190_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|218186_218597_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|218610_219321_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|219520_220345_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|220397_222116_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|222226_222934_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|222930_223335_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|223452_224268_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|224307_224961_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224953_225985_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226172_226748_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|232506_233310_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|233306_234221_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234461_235262_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|235339_236110_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|236157_237516_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|237587_238343_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|238376_239099_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239095_239563_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|239627_240359_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001302684.1|242173_242623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|242625_243222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002701.1|243300_243522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|243542_244022_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|243987_245397_-	membrane protein	NA	NA	NA	NA	NA
WP_001310198.1|245407_248842_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|248978_250391_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|250395_251139_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614378.1|251135_253925_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.3	1.1e-81
WP_000343292.1|253933_254695_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246433.1|254699_256031_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|256033_256558_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|256554_257835_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|257859_258942_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258905_260756_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|260759_261173_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|261263_262655_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|262705_262930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|262964_263465_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264161_264680_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103335.1|264889_267031_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_000509142.1|267106_271330_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
WP_000247943.1|271531_271795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|271709_271895_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|271975_273148_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	291934	371152	5645219	head,integrase,transposase,terminase,protease,holin,portal,plate,capsid,lysis,tail	Shigella_phage(44.83%)	93	294473:294489	377980:377996
WP_000749881.1|291934_292990_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|293277_294381_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|294392_295646_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
294473:294489	attL	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
WP_000051887.1|295850_297014_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000433939.1|296890_297241_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000206732.1|297240_297546_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|297545_297908_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008235.1|297898_298435_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_000917896.1|299111_299408_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_001020634.1|299685_300378_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|300475_300736_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|300728_301280_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|301455_301635_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104949.1|301624_302566_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_072141203.1|302562_303057_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_001303054.1|303056_303710_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_000210141.1|303706_304033_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_000767113.1|304029_304419_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|304438_305248_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001360050.1|305255_306245_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001008431.1|306258_307011_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_000484663.1|307224_307764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310393.1|307907_308141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449601.1|308419_308713_+	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001120501.1|308849_309185_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001197766.1|309188_309665_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001228695.1|309881_310064_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|310154_310448_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001135207.1|310973_311324_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	98.3	2.1e-64
WP_000929189.1|311449_311944_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	1.9e-87
WP_128484532.1|312177_313674_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000923141.1|313821_315048_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000999805.1|315040_315643_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000766100.1|315653_316883_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000924828.1|316961_317285_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000702395.1|317281_317692_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000224836.1|317666_318173_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000779288.1|318169_318730_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000497751.1|318738_318909_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155728.1|318892_320389_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000090993.1|320388_320745_+	hypothetical protein	NA	U5P076	Shigella_phage	99.2	1.2e-62
WP_000661054.1|320744_321014_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000807197.1|321155_322991_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000219910.1|323051_324380_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_001259066.1|325439_325988_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000424732.1|325987_326413_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785302.1|326399_327458_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000383550.1|327448_328033_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_001008234.1|329372_329816_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_001145350.1|329836_330247_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	97.6	6.5e-65
WP_000905124.1|330277_330832_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_000355484.1|330892_331666_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000246059.1|332490_333234_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001130487.1|334196_335378_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000082144.1|335381_335798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|335770_336388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251694.1|336387_336846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|336838_337471_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000647284.1|337501_338092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350115.1|338091_338658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185340.1|339067_339340_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000968317.1|339345_339897_-	Polarity suppression protein	NA	NA	NA	NA	NA
WP_000154958.1|339893_340646_-	septation initiation protein	NA	NA	NA	NA	NA
WP_001244581.1|341579_341840_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000973389.1|341836_342394_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001071227.1|342390_342612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000562750.1|342611_342935_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_000016225.1|342948_345282_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000205213.1|345414_346371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000687183.1|347046_347946_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000361969.1|348044_348767_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001301751.1|348933_349212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917758.1|349914_350817_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303808.1|351062_352121_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000171065.1|352262_353390_+	MFS transporter	NA	NA	NA	NA	NA
WP_000121344.1|353568_354525_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667043.1|354534_356733_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000643340.1|356729_357686_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070685.1|357682_358372_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|358789_359404_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|359651_359981_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001301550.1|360293_361004_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001265657.1|360972_362616_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131063.1|362605_365131_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716386.1|365156_365825_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|365882_366470_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000389022.1|366544_367087_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147284.1|367911_368103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|368172_368313_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|368312_368576_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001171554.1|368839_369220_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|369216_369564_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|369613_371152_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
377980:377996	attR	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
>prophage 3
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	914316	952411	5645219	integrase,protease,holin,portal,lysis,tail	Enterobacteria_phage(52.5%)	47	903758:903772	936047:936061
903758:903772	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_024219169.1|914316_915198_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
WP_001303849.1|915360_915579_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|915618_915786_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|916028_916631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|916841_917063_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|917161_917443_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|917453_917645_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|917617_917800_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|917796_918477_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|919174_919357_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|919353_919524_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|919516_920137_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028857.1|920133_920799_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_000750155.1|921010_921970_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|922307_922430_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|922444_923134_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|923317_924061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|924146_924305_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_012578864.1|924385_924784_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|924926_925142_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|925141_925639_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|925635_926103_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|926090_926243_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_001072975.1|929506_929719_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|929646_930771_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|930892_931228_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136598.1|931172_933200_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_001097050.1|933286_933610_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|933602_933878_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|933889_934468_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|934464_934866_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|934876_935620_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|935680_936067_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
936047:936061	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|936075_936405_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|936376_939442_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|939441_939771_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|939780_940479_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|940484_941228_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|941164_941773_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_001233141.1|945317_945917_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741874.1|945976_947293_+|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|947294_947564_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|947740_948721_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|948754_949774_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|950270_950432_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|950600_951482_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|951712_952411_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 4
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	1077178	1090915	5645219	terminase,capsid,integrase,protease	uncultured_Caudovirales_phage(22.22%)	17	1078500:1078514	1091504:1091518
WP_000085207.1|1077178_1078402_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.2	1.6e-127
WP_000775337.1|1078398_1079172_+	hypothetical protein	NA	NA	NA	NA	NA
1078500:1078514	attL	TAATATTTCTGTATA	NA	NA	NA	NA
WP_001075374.1|1079263_1079488_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	1.9e-18
WP_000190566.1|1079622_1079802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001368837.1|1079992_1080196_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920689.1|1080188_1080374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000659213.1|1080373_1080565_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	52.8	2.2e-07
WP_000770151.1|1080802_1081102_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761782.1|1081098_1082853_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.3	7.1e-92
WP_000557482.1|1083139_1083391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391150.1|1083521_1083716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018605.1|1083719_1083881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229493.1|1084012_1084501_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	3.5e-25
WP_000562896.1|1084663_1085587_+|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.1	3.4e-13
WP_000520781.1|1086565_1086886_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1086916_1089193_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000279872.1|1089712_1090915_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
1091504:1091518	attR	TATACAGAAATATTA	NA	NA	NA	NA
>prophage 5
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	1251365	1320930	5645219	head,integrase,transposase,protease,portal,holin,tail	Escherichia_phage(26.67%)	79	1259853:1259868	1281219:1281234
WP_000156526.1|1251365_1253126_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1253311_1253764_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1253839_1254880_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1255236_1255746_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1255964_1256594_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1256556_1258719_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1258728_1259175_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1259297_1261352_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1259853:1259868	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1261383_1261842_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1261937_1262600_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1262772_1263186_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1263230_1263548_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1263605_1264796_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1264890_1265169_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1265165_1265495_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1265585_1266245_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1266652_1267672_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1267649_1267892_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1267959_1270431_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1270524_1270716_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1270712_1270901_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1271474_1271660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1271846_1272236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1272377_1272533_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1272810_1273098_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1273097_1273289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1273316_1273718_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1273826_1274099_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1274082_1274508_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1274714_1275170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1275248_1276340_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|1276346_1277093_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1277114_1277885_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1277900_1278314_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1278665_1279439_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1279804_1279942_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|1279986_1280199_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_001341388.1|1280366_1280645_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1280646_1281696_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1281219:1281234	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|1281708_1282080_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1282069_1282441_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1282592_1283411_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|1283697_1283937_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|1284031_1284745_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1285511_1287362_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_085948178.1|1287537_1288750_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303878.1|1288955_1289270_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1289797_1289983_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1290204_1290318_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1290538_1291072_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1291231_1291504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1291759_1291966_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1292716_1292992_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1293067_1293448_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1293444_1293792_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1293841_1295380_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001301919.1|1295429_1295672_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000259002.1|1297556_1297763_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1297759_1299352_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1299341_1300847_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1300883_1301231_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1301288_1301555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|1301536_1302277_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1302290_1302722_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1302748_1303162_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082473.1|1303142_1305722_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847298.1|1305718_1306048_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001302968.1|1306047_1306746_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000194760.1|1306756_1307500_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|1307445_1308078_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649827.1|1308268_1308796_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_000515109.1|1308929_1312403_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_001230444.1|1312470_1313070_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268855.1|1313134_1314448_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001023407.1|1314449_1314719_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001301613.1|1316711_1317830_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1317826_1319620_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1319638_1320346_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1320342_1320930_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	1571917	1692450	5645219	head,integrase,transposase,tRNA,terminase,protease,lysis,portal,capsid,holin,tail	Enterobacteria_phage(37.38%)	152	1637811:1637826	1666065:1666080
WP_000952736.1|1571917_1572739_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|1572894_1573941_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1573937_1574732_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|1574898_1576017_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|1575985_1576255_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|1576316_1576706_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|1576838_1577354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1577468_1577621_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1577936_1578413_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1578537_1578861_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693962.1|1578844_1579270_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|1579338_1580376_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|1580287_1580830_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|1580863_1581580_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_000017339.1|1581576_1581894_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_001310212.1|1581890_1582193_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|1582182_1582500_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|1582453_1582771_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|1582757_1583195_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|1583196_1583388_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|1583390_1583978_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|1584093_1584198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1584386_1584599_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|1584766_1585045_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265159.1|1585046_1586096_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_158649132.1|1586108_1586246_+	hypothetical protein	NA	A0A088CBJ1	Shigella_phage	71.0	1.3e-06
WP_001299893.1|1586215_1586482_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.2	3.0e-18
WP_001213059.1|1590452_1590635_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000284518.1|1591016_1591232_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|1591236_1591581_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1591631_1592165_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1592435_1593005_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1593004_1593151_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|1593378_1593585_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1593649_1593874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1594230_1594371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|1594500_1594686_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279796.1|1594727_1595093_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|1595384_1595948_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|1595944_1597606_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|1597669_1599607_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1599651_1599873_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|1599818_1602320_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|1602399_1602726_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1602735_1603086_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1603082_1603529_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1603525_1603870_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1603928_1604645_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1604650_1605025_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1605120_1605330_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261921.1|1605382_1608625_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	98.1	0.0e+00
WP_000807954.1|1608617_1608959_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|1608958_1609657_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|1609673_1609928_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|1610037_1610148_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|1610450_1611329_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|1611382_1612120_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|1612065_1612302_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|1612314_1612404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1612423_1614772_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|1615362_1618764_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|1620867_1620993_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|1621072_1621348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1621408_1622770_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|1623133_1623997_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1623980_1625117_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1625366_1626593_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|1626641_1627763_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_085952403.1|1628124_1629338_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_032174463.1|1629336_1630554_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_000953272.1|1630918_1631107_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|1631156_1631483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106745.1|1631607_1631781_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
WP_000226782.1|1631911_1632109_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1632101_1632314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|1632303_1632768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|1632760_1632994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1632999_1633299_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833626.1|1633295_1634696_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.3	3.6e-115
WP_000192401.1|1634896_1635148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|1635144_1635555_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1635565_1635838_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1635964_1636189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|1636440_1636647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|1636646_1637702_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|1637714_1638050_+|head	head decoration protein	head	NA	NA	NA	NA
1637811:1637826	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|1638062_1638476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1638681_1639224_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1639479_1639761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|1640361_1641822_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|1641821_1642493_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1642661_1644032_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|1644035_1644677_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|1644712_1645819_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1645872_1646334_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|1646343_1646997_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|1647168_1648419_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|1648532_1649675_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088657.1|1649664_1649901_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|1650004_1650829_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|1650825_1651527_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|1651523_1651826_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|1651893_1652226_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|1652290_1652413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|1652470_1653997_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|1654498_1654954_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|1654953_1655124_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1655116_1655407_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|1655403_1655766_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|1655762_1655903_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|1655899_1656589_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|1656910_1657216_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|1657202_1657679_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|1657895_1658078_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|1658168_1658462_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|1658753_1659164_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1659449_1659656_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1659820_1660015_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1660403_1660949_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|1660923_1662849_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|1662845_1663052_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1663048_1664650_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1664630_1665950_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1665959_1666292_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
1666065:1666080	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063233.1|1666346_1667372_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_000158906.1|1667413_1667812_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|1667823_1668177_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|1668188_1668767_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|1668763_1669159_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|1669166_1669907_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1669922_1670345_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1670326_1670761_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|1670753_1673303_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|1673299_1673629_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|1673628_1674327_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|1674332_1675076_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|1675012_1675645_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|1675705_1679104_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|1679170_1679770_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|1679834_1682750_+	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|1682749_1683331_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|1683450_1684341_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1684359_1684866_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1684902_1685403_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1685481_1685664_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1686161_1686830_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|1686886_1687135_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|1687210_1687591_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1687587_1687935_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1687984_1689523_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|1689825_1691310_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|1691496_1692450_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 7
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	1777024	1884627	5645219	head,integrase,transposase,terminase,capsid,holin,tail	Stx2-converting_phage(38.38%)	123	1788658:1788680	1846436:1846458
WP_000113674.1|1777024_1778155_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1778132_1778381_-	excisionase	NA	NA	NA	NA	NA
WP_000048549.1|1778445_1780917_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_001090200.1|1781009_1781201_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1781197_1781386_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|1781783_1781951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1781944_1782178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1782155_1782563_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1782585_1782804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1782876_1783176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1783439_1783847_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1783923_1784151_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|1784134_1784686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1784657_1785698_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|1785609_1786152_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|1786338_1786920_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|1786916_1787081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1787779_1788538_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
1788658:1788680	attL	CCGATATGGGAATTCCCATATCG	NA	NA	NA	NA
WP_000961820.1|1788816_1789029_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|1789249_1789507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1789576_1789855_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|1789856_1790903_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|1790915_1791275_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|1791283_1791814_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1792055_1792253_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|1792403_1793462_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000143067.1|1794258_1796112_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1796261_1796477_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|1796481_1796826_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|1796876_1797410_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1797680_1798250_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1798249_1798396_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1798623_1798809_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1799233_1799461_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|1799502_1799868_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_001303051.1|1800157_1800721_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_001303049.1|1800717_1802379_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_000172999.1|1802442_1804380_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1804424_1804646_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|1807172_1807499_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1807508_1807859_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1807855_1808302_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1808298_1808643_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1808701_1809418_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1809423_1809798_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1809893_1810103_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|1810155_1813398_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|1813390_1813732_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179515.1|1813731_1814430_+|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_046671488.1|1814440_1815184_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_050439450.1|1815129_1815762_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|1816104_1817280_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_129137390.1|1817231_1819577_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001228304.1|1819644_1820244_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_024748516.1|1820395_1821709_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	7.2e-81
WP_001023474.1|1821710_1821980_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|1823006_1824332_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_000998048.1|1826996_1828535_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1828584_1828932_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1828928_1829309_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|1829648_1829927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1830354_1830501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1830637_1831285_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|1831468_1832059_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_000147167.1|1834809_1835028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001500821.1|1835515_1836646_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	50.9	4.9e-102
WP_000113189.1|1836623_1836872_-	excisionase	NA	NA	NA	NA	NA
WP_000102181.1|1836936_1839381_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000092782.1|1839473_1839662_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1839658_1839847_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000380314.1|1840334_1840487_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000367559.1|1840656_1841046_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|1841148_1841424_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000693888.1|1841407_1841833_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095667.1|1841855_1842809_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000790456.1|1842815_1843556_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000450888.1|1843585_1844356_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_001118161.1|1844371_1844767_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001302146.1|1844823_1845180_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_000063625.1|1845228_1845441_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|1845476_1845848_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000610379.1|1845844_1846207_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_001278450.1|1846322_1846427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|1846615_1846828_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
1846436:1846458	attR	CGATATGGGAATTCCCATATCGG	NA	NA	NA	NA
WP_001304183.1|1847357_1847636_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000904137.1|1848699_1849074_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762904.1|1849070_1849892_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000917735.1|1850118_1850316_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483497.1|1850466_1851525_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_024748518.1|1852016_1853867_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000411802.1|1854314_1854521_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075112.1|1854520_1855018_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_001208680.1|1855234_1855420_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|1855946_1856261_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|1856342_1856567_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|1856608_1856974_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958387.1|1857262_1857826_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|1857822_1859484_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|1859547_1861485_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1861529_1861751_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|1864277_1864604_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1864613_1864964_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1864960_1865407_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1865403_1865748_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1865806_1866523_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1866528_1866903_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1866998_1867208_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|1867260_1870503_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|1870495_1870837_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064261967.1|1870836_1871535_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.6	7.3e-133
WP_001303043.1|1871545_1872289_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_129137391.1|1872234_1872867_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_064261927.1|1873113_1876590_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_001230509.1|1876657_1877257_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_064261928.1|1877321_1878635_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.8	3.7e-85
WP_001023407.1|1878636_1878906_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|1879019_1879595_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|1879667_1880297_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|1880378_1881020_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_016241229.1|1881181_1881496_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|1881555_1882839_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|1882927_1884388_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|1884423_1884627_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	2154899	2245821	5645219	head,transposase,protease,terminase,portal,capsid,holin,tail	Enterobacteria_phage(31.76%)	105	NA	NA
WP_000422055.1|2154899_2155949_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2156168_2156927_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2156923_2157514_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2157553_2158426_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2158638_2160222_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2160249_2160870_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2160866_2161748_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2161885_2161930_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2162021_2163584_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763503.1|2163583_2165179_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001416116.1|2165182_2166541_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	7.3e-36
WP_000209521.1|2166552_2167746_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2167745_2168552_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2168932_2169112_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2169197_2169698_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2169743_2170250_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001023426.1|2176334_2176604_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
WP_064261932.1|2176605_2177919_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	6.3e-77
WP_001230509.1|2177983_2178583_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_064261933.1|2178650_2182130_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_129137391.1|2182376_2183009_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001303043.1|2182954_2183698_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_001303044.1|2183708_2184407_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|2184406_2184736_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000533440.1|2187325_2187739_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2187765_2188188_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2188201_2188954_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2188961_2189357_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2189353_2189887_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2189901_2190255_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2190266_2190665_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2190706_2191732_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2191787_2192120_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2192129_2193449_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2193429_2195031_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2195027_2195234_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2195230_2197156_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2197130_2197676_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2198062_2198287_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2198368_2198683_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2199208_2199394_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2199616_2199763_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2199762_2200332_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2200602_2201136_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2201186_2201531_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411805.1|2201535_2201742_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023184.1|2202190_2204041_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|2204518_2204950_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2205400_2206114_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2206249_2206447_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2206671_2207226_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2207288_2207594_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2207606_2208656_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2208657_2208930_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2209051_2209396_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2209515_2209728_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2209961_2210519_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2210520_2210739_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2210866_2211178_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2211170_2211398_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2211394_2211676_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2211708_2212425_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|2212458_2212920_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|2212912_2213956_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2214024_2214450_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2214433_2214676_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2215067_2215406_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2215698_2215851_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2215862_2216501_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2216501_2216711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2217275_2217464_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2217460_2217649_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2217741_2218986_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_016241229.1|2219624_2219939_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001500906.1|2220850_2221147_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	1.3e-43
WP_000267292.1|2221226_2223728_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2223673_2223895_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|2223939_2225877_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001303049.1|2225940_2227602_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_001303051.1|2227598_2228162_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_015994246.1|2228451_2228817_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|2228858_2229086_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2229510_2229696_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2229923_2230070_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2230069_2230639_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2230909_2231443_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000998048.1|2231606_2233145_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2233194_2233542_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2233538_2233919_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731257.1|2233994_2234288_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	8.3e-46
WP_000411805.1|2234292_2234499_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_024748470.1|2234947_2236798_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_001303509.1|2237276_2237705_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|2238341_2239031_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|2239027_2239387_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2239399_2240449_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2240450_2240729_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2240896_2241109_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2241297_2241402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2241517_2242102_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2242158_2242554_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788936.1|2243364_2244105_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_000095670.1|2244111_2245074_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000693943.1|2245096_2245522_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2245518_2245821_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 9
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	2389918	2434836	5645219	head,integrase,tRNA,terminase,portal,plate,capsid,holin,tail	Enterobacteria_phage(74.47%)	61	2392321:2392345	2427478:2427502
WP_000029463.1|2389918_2390668_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154193.1|2390667_2391219_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956513.1|2391281_2392262_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2392321:2392345	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_001689686.1|2392454_2392892_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_000403439.1|2392992_2393493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247210.1|2393495_2394434_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	5.1e-81
WP_000904674.1|2394522_2394831_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	52.1	8.7e-22
WP_001151410.1|2394927_2395206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917809.1|2395220_2395559_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	87.1	2.3e-52
WP_000158974.1|2395569_2395857_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	6.6e-32
WP_000514277.1|2395868_2396111_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021666.1|2396107_2396221_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	2.0e-08
WP_029238958.1|2396410_2396731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2396754_2396958_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2396954_2397221_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104308.1|2397217_2397517_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	1.4e-40
WP_001310326.1|2397528_2398146_+	hypothetical protein	NA	K7PLX4	Enterobacteria_phage	51.1	2.2e-11
WP_000564228.1|2398142_2398532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001609.1|2398528_2401369_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	90.1	0.0e+00
WP_000708312.1|2401445_2402405_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.5e-176
WP_000211267.1|2402409_2402721_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_001594304.1|2403085_2403355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087812.1|2403842_2404889_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613768.1|2404888_2406640_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	99.8	0.0e+00
WP_001262673.1|2406794_2407631_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055118.1|2407653_2408706_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	100.0	6.8e-199
WP_000632347.1|2408751_2409552_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.5	1.6e-131
WP_000063103.1|2409653_2410148_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864901.1|2410147_2410348_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2410350_2410674_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2410670_2411063_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780572.1|2411059_2411467_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000920579.1|2411604_2412072_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.1	9.3e-84
WP_000356344.1|2412064_2412700_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_001271948.1|2412696_2413278_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	95.9	2.3e-100
WP_000213447.1|2413274_2413625_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111970.1|2413628_2414525_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	7.4e-154
WP_000071724.1|2414517_2415126_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_000217007.1|2415122_2416757_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	57.0	3.7e-143
WP_000368062.1|2416756_2417359_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	6.2e-96
WP_001008232.1|2417330_2417774_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	6.3e-82
WP_001743818.1|2417794_2418205_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	98.4	7.7e-66
WP_000905082.1|2418235_2418835_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	82.2	8.9e-87
WP_000979945.1|2418861_2419350_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853421.1|2419362_2422170_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.6	0.0e+00
WP_000763327.1|2422156_2422285_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665308.1|2422320_2422686_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290466.1|2422740_2423253_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	96.5	3.3e-90
WP_000005394.1|2423252_2424437_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	3.6e-225
WP_000132850.1|2424594_2425704_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	93.0	1.1e-191
WP_000069998.1|2425856_2426462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302981.1|2426622_2426883_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|2427073_2427214_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|2427519_2427819_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2427478:2427502	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672328.1|2427823_2430211_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|2430225_2431209_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2431491_2431536_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2431658_2432015_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2432067_2432265_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2432361_2432904_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144201.1|2432907_2434836_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	9.4e-130
>prophage 10
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	2593230	2645665	5645219	integrase,transposase,tail,tRNA	Enterobacteria_phage(58.06%)	60	2586454:2586469	2645744:2645759
2586454:2586469	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|2593230_2594964_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|2595140_2595629_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|2595748_2596141_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|2596140_2598219_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|2598211_2599360_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|2599561_2600206_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2600216_2600606_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|2600620_2601670_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|2601672_2602533_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|2602551_2604153_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|2604198_2605860_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|2606002_2606506_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|2606526_2608491_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2608495_2609422_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|2609418_2610306_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2610432_2611011_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|2611013_2611364_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2612143_2612572_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|2612578_2614003_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2613977_2614778_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000987892.1|2614944_2615934_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2615945_2617460_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|2617529_2618519_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2619315_2619819_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|2619898_2620150_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2620264_2620351_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|2620612_2620936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|2621106_2621604_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2621640_2621880_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|2622071_2623283_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2623344_2624010_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001303019.1|2624366_2625368_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
WP_000865208.1|2625373_2625721_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|2625750_2626401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2626416_2626821_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|2626910_2627048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2627119_2627323_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2627344_2627695_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|2627705_2627984_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|2627995_2628238_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|2628234_2628348_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|2628440_2628857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2628880_2629084_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2629080_2629347_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|2629343_2629643_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001310314.1|2629654_2630272_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|2630268_2630634_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|2630640_2633463_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|2633539_2634499_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|2634503_2634818_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000257965.1|2636023_2636440_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000954203.1|2636483_2637056_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|2637212_2637701_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000763327.1|2640503_2640632_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665314.1|2640667_2641033_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|2641087_2641600_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_072141434.1|2641599_2641779_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	88.1	9.8e-26
WP_085948178.1|2641835_2643048_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000132765.1|2644254_2644578_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161583.1|2644528_2645665_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
2645744:2645759	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 11
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	2703248	2770331	5645219	head,integrase,transposase,terminase,portal,holin,tail	Enterobacteria_phage(34.09%)	67	2718911:2718926	2774676:2774691
WP_001023396.1|2703248_2703518_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000268854.1|2703519_2704689_-	hypothetical protein	NA	B6DZB7	Enterobacteria_phage	96.9	1.1e-83
WP_001230509.1|2704752_2705352_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_064261933.1|2705419_2708899_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_129137391.1|2709145_2709778_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001303043.1|2709723_2710467_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_001303044.1|2710477_2711176_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|2711175_2711505_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082473.1|2711501_2714081_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|2714061_2714475_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2714501_2714933_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2714946_2715687_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2715668_2715935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|2715992_2716340_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|2716376_2717882_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|2717871_2719464_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2718911:2718926	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|2719460_2719667_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|2719650_2721579_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000235436.1|2721550_2722060_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2722454_2722679_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2722760_2723075_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2723601_2723787_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303555.1|2724158_2724341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2724496_2725030_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2725080_2725425_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000411809.1|2725429_2725636_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_085948178.1|2725955_2727168_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000023257.1|2727250_2729101_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001059369.1|2730640_2731330_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|2731326_2731686_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2731698_2732748_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2732749_2733028_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|2733195_2733408_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|2733594_2733699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2733808_2734372_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2734498_2734810_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2734806_2734959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2734991_2735348_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2735344_2735569_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2735590_2736289_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_072143023.1|2736323_2736866_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_001262409.1|2736777_2737815_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|2737883_2738309_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2738305_2738533_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2738630_2739275_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2739549_2739702_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2740182_2740371_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2740367_2740556_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|2740651_2743123_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|2743181_2743385_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|2743384_2744407_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|2744642_2745440_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_014714124.1|2745929_2753912_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_000480501.1|2754173_2755226_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|2755539_2756856_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2756957_2758412_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|2758754_2759471_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|2760096_2761740_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|2761857_2762808_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|2762909_2763827_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986334.1|2764283_2765219_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|2765280_2766360_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2766371_2767115_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2767111_2767657_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|2768018_2768399_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2768395_2768743_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2768792_2770331_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
2774676:2774691	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 12
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	2784996	2847097	5645219	head,integrase,transposase,terminase,protease,holin,capsid,lysis,tail	Stx2-converting_phage(65.0%)	80	2830803:2830862	2847092:2848401
WP_001303036.1|2784996_2786163_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001121226.1|2787486_2788137_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000491542.1|2788361_2789237_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001023452.1|2789377_2789647_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000268993.1|2789648_2790962_-	hypothetical protein	NA	A0A0P0ZCC1	Stx2-converting_phage	100.0	2.8e-85
WP_064261938.1|2791026_2791626_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	99.5	5.2e-111
WP_000515107.1|2791692_2795172_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	0.0e+00
WP_050546863.1|2795431_2796064_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_001303040.1|2796009_2796747_-|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_001416667.1|2796800_2797724_-	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001154345.1|2797794_2797968_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|2798075_2798396_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001303038.1|2798412_2799111_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_000807954.1|2799110_2799452_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_015994262.1|2799444_2802687_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	100.0	0.0e+00
WP_001453698.1|2802738_2802948_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2803043_2803418_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2803423_2804140_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2804198_2804543_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2804539_2804986_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2804982_2805333_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|2805342_2805669_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001063023.1|2808195_2808417_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000173023.1|2808461_2810399_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	100.0	0.0e+00
WP_001301491.1|2810462_2812124_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958396.1|2812120_2812684_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_001303046.1|2812974_2813340_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|2813381_2813609_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001283921.1|2814071_2814329_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|2814325_2814823_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092318.1|2815025_2815463_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|2815459_2815957_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000284515.1|2815956_2816172_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|2816248_2816521_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2816561_2816741_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000143113.1|2816877_2818815_-	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	100.0	0.0e+00
WP_001303568.1|2819058_2819382_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|2819678_2819948_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649751.1|2819959_2820919_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000512807.1|2821568_2822057_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|2822047_2822719_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108004.1|2822715_2823321_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001004016.1|2823320_2824043_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_000208500.1|2824117_2824882_-	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001254256.1|2825156_2825339_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|2825335_2825863_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|2825859_2826306_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|2826262_2826499_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|2826509_2826725_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001303053.1|2826857_2827079_-	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	1.1e-37
WP_001220560.1|2827653_2828265_-	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_000998048.1|2828353_2829892_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2829941_2830289_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2830285_2830666_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
2830803:2830862	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_085948178.1|2830856_2832069_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_064261939.1|2832109_2833483_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	2.1e-253
WP_000539354.1|2833479_2834301_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_000442612.1|2834481_2834778_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|2834919_2835135_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2835209_2835905_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|2836406_2836928_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|2837496_2837679_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|2837656_2837929_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394301.1|2837987_2838248_+	hypothetical protein	NA	A0A0P0ZC97	Stx2-converting_phage	100.0	1.1e-44
WP_000065362.1|2838430_2838799_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|2838871_2839036_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|2839004_2839148_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|2839222_2839519_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001302855.1|2839524_2840310_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000186848.1|2840306_2840987_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000682306.1|2840983_2841166_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548528.1|2841138_2841330_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_001444000.1|2841340_2841622_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|2841720_2841942_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289930.1|2841938_2842886_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000610373.1|2843752_2844103_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|2844290_2844635_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|2844712_2844904_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_074469436.1|2844884_2845781_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	3.8e-174
WP_085948178.1|2845883_2847097_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
2847092:2848401	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCACTTTCGCAAGTCAGCAGTGATCTGTCTGGCATCCTTCAAAGACAGGGATGGGTATCGACCAAGCCCAAGTCGATTAGGCTTGCCATGCCAGCGATAGCGGTACTGGAACTGGATGACCCCCTTCGGTGAAATTCGTACGCTGAGGCCATCGGCATCAGCCACTTCTTGTGGGCCAGAATATGGTTTACCATAAATAGTACGCAGTTTTGTGTCGCTTATAGCCATAAATAATATTTGGTACGCTCAGAAATAATGGTTTGGTACACATCTGGTACACAATATCACATGGACAACAGCGCACAGTAAACAACTATATTTGACGTTCGTAGACATACTCAGGTGAAAAAAGGGTTGTTTTTCGAGTTATAACAGACAGTTAATTAACTACATTGGACAATGCTAGACAATGACAGACACAGATAAGCAACCTACCTTCCTCTTTCACGATTACGAAACCTTTGGCACGCACCCCGCGTTAGATCGCCCTGCACAGTTCGCAGCCATTCGCACCGATGACGAATTCAATGTCATCGGCGAACCCGAAGTCTTTTACTGCAAGCCCGCGGATGACTATTTACCCCAGCCTGGAGCAGTATTAATTACCGGTATTACCCCGCAGGAAGCTCGGGCGAAAGGAGAAAACGAAGCCGCATTTGCCGCCCGTATTCACTCGCTTTTTACCGTACCGAAGACCTGTATTCTGGGCTACAACAATGTGCGTTTCGACGACGAAGTCACACGCAACGTTTTTTATCGTAATTTCTACGATCCTTACGCCTGGAGCTGGCAGCATGATAACTCGCGCTGGGATTTACTGGATGTTATGCGTGCCTGCTATGCCCTGCGCCCGGAAGGAATAAACTGGCCTGAAAATGATGACGGTCTACCGAGCTTTCGCCTTGAGCATTTAACCAAAGCGAATGGTATTGAACATAGCAACGCCCACGATGCGATGGCTGATGTGTACGCCACTATTGCGATGGCGAAACTGGTAAAAACGCGTCAACCACGCCTGTTTGATTATCTCTTTACCCATCGTAATAAACACAAACTGATGGCGTTGATTGATGTTCCGCAGATGAAACCCCTGGTTCACGTTTCCGGAATGTTTGGGGCATGGCGCGGCAATACCAGCTGGGTGGCACCGCTGGCGTGGCATCCTGAAAATCGCAATGCCGTAATTATGGTGGATTTGGCAGGAGATATTTCGCCATTACTGGAACTGGATAGCGACACATTGCGCGAGCGTT	NA	NA	NA	NA
>prophage 13
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	2930600	2967841	5645219	head,integrase,tRNA,terminase,holin,portal,plate,capsid,lysis,tail	Escherichia_phage(35.56%)	47	2934900:2934927	2966034:2966061
WP_000675144.1|2930600_2932004_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137884.1|2932000_2932723_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_001301848.1|2932913_2933246_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2933393_2934755_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
2934900:2934927	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2935029_2935248_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882987.1|2935329_2936493_-	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	98.7	3.5e-204
WP_000978915.1|2936492_2936972_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.5e-84
WP_000069920.1|2936986_2939434_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	95.7	0.0e+00
WP_000785970.1|2939426_2939546_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|2939578_2939854_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|2939910_2940429_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286714.1|2940441_2941632_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	1.5e-223
WP_000905091.1|2941691_2942285_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	1.3e-103
WP_001285344.1|2945249_2945861_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	4.9e-117
WP_001121492.1|2945853_2946762_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	8.3e-161
WP_000127172.1|2946766_2947114_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_001093756.1|2947110_2947746_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	4.5e-113
WP_001001774.1|2947812_2948265_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.4e-76
WP_000917172.1|2948257_2948725_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	7.4e-81
WP_001300730.1|2948687_2948861_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040660.1|2948832_2949258_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	1.8e-65
WP_000736588.1|2949245_2949671_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	94.3	2.1e-58
WP_001144113.1|2949685_2950183_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	2.6e-92
WP_000123125.1|2950182_2950464_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	98.9	6.3e-43
WP_000846399.1|2950467_2950671_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|2950670_2951180_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203439.1|2951279_2952023_-|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	98.4	8.6e-124
WP_001248573.1|2952026_2953100_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	6.7e-202
WP_001085969.1|2953154_2954009_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	95.8	5.8e-132
WP_000156861.1|2954182_2955955_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_000038195.1|2955954_2956989_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	96.2	4.5e-195
WP_001177885.1|2957201_2957471_+	hypothetical protein	NA	Q2P9X2	Enterobacteria_phage	89.9	3.8e-29
WP_000551925.1|2957501_2957696_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	89.1	8.5e-23
WP_000042038.1|2957694_2958132_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	92.3	1.6e-69
WP_000746343.1|2958256_2959207_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.0	3.8e-39
WP_001310277.1|2959184_2959493_-	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	40.2	1.7e-12
WP_000268557.1|2960093_2962382_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.6	0.0e+00
WP_000027665.1|2962371_2962647_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	98.9	6.6e-45
WP_001113260.1|2962643_2962868_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	5.5e-34
WP_001277943.1|2962867_2963170_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	95.0	1.9e-45
WP_000557701.1|2963169_2963394_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_000217679.1|2963457_2963958_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_000043869.1|2964135_2964411_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|2964525_2964825_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000985261.1|2964940_2965954_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001303579.1|2966218_2966536_-	hypothetical protein	NA	NA	NA	NA	NA
2966034:2966061	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2966941_2967841_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 14
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	2993472	3065769	5645219	head,transposase,tRNA,terminase,portal,capsid,holin,tail	Enterobacteria_phage(55.74%)	70	NA	NA
WP_001301615.1|2993472_2995506_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_085948178.1|2998065_2999278_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001411921.1|3000781_3002062_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_000356841.1|3003775_3007405_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|3007466_3007784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|3009024_3010113_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|3010123_3011653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|3011671_3012403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|3012395_3013532_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|3013528_3015532_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001171554.1|3015915_3016296_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3016292_3016640_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3016689_3018228_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001295430.1|3018609_3019080_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3019126_3019846_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|3019842_3021528_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_001261939.1|3022042_3022291_+	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001143784.1|3022452_3023094_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_072142879.1|3023175_3023592_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001023396.1|3023752_3024022_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000268879.1|3024023_3025193_-	hypothetical protein	NA	B6DZB7	Enterobacteria_phage	100.0	4.3e-85
WP_001230508.1|3025257_3025857_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_015994252.1|3025924_3029404_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	100.0	0.0e+00
WP_149025382.1|3029663_3030296_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.0	4.9e-104
WP_000967271.1|3030241_3030979_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_001416667.1|3031032_3031956_-	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001154345.1|3032026_3032200_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|3032307_3032628_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001152183.1|3032644_3033343_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_000807954.1|3033342_3033684_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3033676_3036919_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3036966_3037176_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3037271_3037646_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275464.1|3037660_3038377_-|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	100.0	1.2e-127
WP_000133388.1|3038442_3038787_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3038783_3039230_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3039226_3039577_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|3039587_3039914_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_064261943.1|3039910_3042334_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	93.7	0.0e+00
WP_001063099.1|3042279_3042501_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3042545_3044483_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001303049.1|3044546_3046208_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_001303051.1|3046204_3046768_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_015994246.1|3047057_3047423_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|3047464_3047692_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3048116_3048302_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3048529_3048676_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3048675_3049245_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3049515_3050049_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3050099_3050444_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411802.1|3050448_3050655_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_064261944.1|3051102_3052953_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.8	0.0e+00
WP_000752026.1|3053451_3053721_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|3053730_3054678_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204852.1|3055184_3055619_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000144759.1|3055611_3055806_-	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001107998.1|3055802_3056408_-	recombination protein NinG	NA	B6DZ84	Enterobacteria_phage	100.0	6.6e-98
WP_001004018.1|3056407_3057130_-	DNA-binding protein	NA	B6DZ83	Enterobacteria_phage	100.0	3.5e-130
WP_000290551.1|3057204_3057882_-	phage antirepressor Ant	NA	Q4A1A4	Enterobacteria_phage	97.8	2.2e-126
WP_001254256.1|3058157_3058340_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|3058336_3058864_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001310475.1|3058860_3059307_-	recombination protein NinB	NA	A0A1U9AJ79	Stx1_converting_phage	100.0	2.4e-81
WP_001281772.1|3059263_3059500_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3059510_3059726_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000130.1|3059858_3060137_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_085948178.1|3060789_3062003_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_027868261.1|3063257_3063959_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_001216963.1|3064018_3064126_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3064106_3064838_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|3064842_3065769_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 15
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	3310050	3315437	5645219	integrase	Enterobacteria_phage(50.0%)	6	3300501:3300517	3312465:3312481
3300501:3300517	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|3310050_3310983_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|3311294_3312452_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3312626_3313763_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3312465:3312481	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3313772_3314453_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3314439_3314907_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_064261946.1|3314906_3315437_-	hypothetical protein	NA	Q716G6	Shigella_phage	98.6	3.7e-68
>prophage 16
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	3557156	3617863	5645219	integrase,transposase,tRNA,holin,tail	Enterobacteria_phage(30.0%)	59	3574604:3574618	3622822:3622836
WP_000997403.1|3557156_3558194_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3558400_3558820_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|3558888_3559587_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|3559618_3562279_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3562392_3563748_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000464871.1|3563772_3564117_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|3564113_3565412_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|3571187_3573761_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|3573890_3574622_-	polyphenol oxidase	NA	NA	NA	NA	NA
3574604:3574618	attL	GGACAATCAGCTTAC	NA	NA	NA	NA
WP_000079092.1|3574618_3575599_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3575733_3576471_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3576741_3577083_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3577186_3577234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|3577332_3578493_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|3578535_3579657_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|3579667_3580738_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|3580947_3581313_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3581462_3581981_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969012.1|3581970_3583197_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|3583212_3583695_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3583771_3584119_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3584160_3584928_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3584958_3585507_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3585525_3585774_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3585910_3587272_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189257.1|3587363_3588230_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626229.1|3588251_3589538_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3589592_3590186_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|3590308_3591187_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880924.1|3591272_3592934_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3593082_3593424_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|3593485_3593776_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3593765_3594242_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3594373_3594856_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3595701_3595950_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|3596451_3597042_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3597224_3597875_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3597953_3599012_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3599141_3599564_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3599724_3599994_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_001303014.1|3599995_3600562_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	7.9e-69
WP_000612591.1|3600611_3600959_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3600955_3601336_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|3601692_3602037_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3602041_3602257_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143068.1|3602406_3604260_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000499458.1|3604667_3604835_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3604920_3605664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3605916_3606540_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3606536_3607202_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3607198_3607810_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|3607784_3608351_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_085948178.1|3609005_3610219_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001417601.1|3610802_3611105_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000150581.1|3611180_3612395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|3612790_3613204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052051.1|3613301_3613700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000428092.1|3615342_3616656_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000540864.1|3616657_3617863_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3622822:3622836	attR	GGACAATCAGCTTAC	NA	NA	NA	NA
>prophage 17
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	4190818	4289420	5645219	head,integrase,transposase,protease,plate,tail	Shigella_phage(40.0%)	117	4258358:4258375	4278629:4278646
WP_001107466.1|4190818_4192753_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000145975.1|4192852_4193482_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_001054420.1|4193607_4193901_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_001148001.1|4194056_4194533_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_001212627.1|4194780_4196214_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_000673572.1|4196253_4197426_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_000813037.1|4197441_4198407_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000940595.1|4198533_4198791_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_000271401.1|4198811_4199123_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_001047341.1|4199381_4200353_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|4200581_4200860_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_000357265.1|4200907_4202167_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000429656.1|4202221_4202476_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_000004488.1|4202635_4202929_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_000476484.1|4202928_4203564_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_001296448.1|4203582_4204134_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_000925795.1|4204138_4204921_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_000438245.1|4204928_4205738_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922872.1|4205947_4206925_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001302021.1|4206938_4207925_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	2.5e-38
WP_000030005.1|4207945_4208512_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030527.1|4208508_4209084_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|4209052_4209610_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|4209616_4210342_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|4210389_4211823_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|4211845_4212133_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_001301839.1|4212250_4212742_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|4212787_4213642_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|4213638_4213911_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620409.1|4214124_4214757_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047079.1|4214753_4215482_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001302019.1|4215478_4216132_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809770.1|4216361_4218698_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|4218793_4219723_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_001310491.1|4220396_4224857_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_000081695.1|4224869_4226288_+	glutamate synthase subunit GltD	NA	NA	NA	NA	NA
WP_000445148.1|4226471_4227599_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	87.8	1.1e-72
WP_000979870.1|4227658_4228123_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209030.1|4228119_4228995_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_001301938.1|4228991_4229681_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108469.1|4229728_4231219_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	3.7e-09
WP_000224714.1|4231327_4232221_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000523844.1|4232342_4233134_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000528251.1|4234352_4235090_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001310452.1|4235043_4235244_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|4235358_4235823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|4235861_4236107_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|4236142_4236325_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|4236471_4238511_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|4238610_4239171_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|4239393_4239597_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|4239676_4240198_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|4240232_4241144_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|4241143_4241704_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|4241694_4242777_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|4242776_4243214_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|4243206_4243821_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|4243810_4244935_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|4244918_4246268_-	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000113525.1|4246254_4248330_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000213225.1|4248456_4248933_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|4248947_4249313_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|4249321_4250824_-|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|4250820_4251066_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|4251066_4251627_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|4251623_4252043_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002057.1|4252039_4252426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|4252469_4253417_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_064261950.1|4253416_4254541_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	4.9e-78
WP_000094804.1|4254717_4255191_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000046893.1|4255309_4256635_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000532593.1|4256618_4258208_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_001057672.1|4258207_4259872_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
4258358:4258375	attL	CGCCACGGCAAAATCACC	NA	NA	NA	NA
WP_000360581.1|4259871_4260453_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279084.1|4260455_4260746_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000270159.1|4260742_4261051_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342746.1|4261031_4261259_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|4261268_4261487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|4261470_4261899_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|4261933_4262434_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|4262505_4262931_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214362.1|4263000_4263510_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000370523.1|4263506_4263803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|4263792_4263990_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000021235.1|4263982_4264315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|4264353_4264539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977060.1|4264535_4265087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465559.1|4265090_4265606_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000564283.1|4265605_4266139_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000323222.1|4266142_4266685_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_001129553.1|4266782_4267313_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049304.1|4267324_4267618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|4267622_4267895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|4267891_4268173_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|4268174_4268429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268103.1|4268441_4268663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|4268665_4269598_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000289290.1|4269668_4271759_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_001310454.1|4271760_4272009_-	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000077537.1|4272199_4272730_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_000366129.1|4273672_4274170_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
WP_000257293.1|4274175_4274814_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|4275208_4275601_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000847559.1|4275616_4276045_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_001192332.1|4276263_4277391_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001295270.1|4277584_4277983_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_001301636.1|4278136_4279504_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	5.1e-21
4278629:4278646	attR	GGTGATTTTGCCGTGGCG	NA	NA	NA	NA
WP_000497723.1|4279593_4280661_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295272.1|4280724_4281663_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_001257846.1|4282097_4282568_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000695690.1|4282932_4283196_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001029013.1|4283251_4283524_-	barnase inhibitor	NA	NA	NA	NA	NA
WP_000350957.1|4283615_4285583_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_000854038.1|4285588_4286518_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_001310167.1|4286525_4286729_-	AaeX family protein	NA	NA	NA	NA	NA
WP_000440317.1|4286911_4287841_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000055927.1|4287974_4289420_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 18
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	4743170	4755454	5645219	integrase	Enterobacteria_phage(90.0%)	12	4731586:4731599	4756267:4756280
4731586:4731599	attL	TATGGTGCGGAGAT	NA	NA	NA	NA
WP_001218978.1|4743170_4744358_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.0	5.3e-208
WP_000704989.1|4744577_4746098_-	cytidine deaminase	NA	A0A0N9QQ67	Chrysochromulina_ericina_virus	46.2	2.7e-07
WP_000446145.1|4746738_4747311_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.4e-94
WP_000638631.1|4747384_4747885_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283041.1|4747881_4748616_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.5	2.2e-127
WP_001149160.1|4749166_4749433_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980233.1|4749429_4750029_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.1e-49
WP_001244665.1|4750021_4750309_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459294.1|4750301_4750757_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4750892_4751213_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783661.1|4751227_4753561_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_001219063.1|4754272_4755454_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	68.9	1.4e-160
4756267:4756280	attR	TATGGTGCGGAGAT	NA	NA	NA	NA
>prophage 19
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	5249571	5264236	5645219	tRNA,integrase,tail	Enterobacteria_phage(40.0%)	18	5250852:5250867	5268381:5268396
WP_000956557.1|5249571_5250105_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|5250522_5250804_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5250852:5250867	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|5251148_5251346_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|5251681_5251966_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|5251962_5252313_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|5252303_5252840_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|5254161_5254761_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268945.1|5254825_5256139_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|5256140_5256410_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|5256521_5257094_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|5257166_5257796_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|5257877_5258519_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|5258679_5258928_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|5258989_5260087_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|5260175_5261213_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|5261346_5261589_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|5261754_5262738_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_064261955.1|5262820_5264236_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
5268381:5268396	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 20
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	5401116	5460144	5645219	protease,transposase	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312488.1|5401116_5402376_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5402378_5403383_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|5403464_5403662_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|5403765_5405064_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|5405268_5405694_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|5405732_5408174_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|5408354_5409086_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|5409212_5409614_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|5409632_5410331_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|5410381_5411041_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|5411058_5411457_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|5411466_5412105_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|5412107_5413271_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|5413354_5414980_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|5415096_5415372_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|5415520_5415850_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|5416031_5416781_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5416777_5417533_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001301921.1|5419059_5420457_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|5420472_5420778_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|5420787_5421252_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|5421265_5421916_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|5421925_5422780_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|5422779_5423466_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|5423594_5423870_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5424196_5424592_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5424598_5424913_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5424917_5425145_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5425186_5425636_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|5425706_5426501_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|5427123_5427555_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|5427562_5428771_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|5428905_5429544_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5429761_5430382_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|5430690_5432103_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|5432147_5432810_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|5432917_5433883_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|5433990_5434851_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001302935.1|5434939_5435320_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589488.1|5435437_5437381_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|5437570_5438311_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937658.1|5438522_5439461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175296.1|5439523_5440078_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5440402_5440609_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|5440704_5442048_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|5442370_5443009_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|5443214_5444948_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|5444944_5448724_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5448726_5449068_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|5449279_5449531_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|5449524_5449875_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|5449954_5450485_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|5450794_5451751_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205805.1|5451890_5453393_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001301928.1|5453406_5454429_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|5454415_5455411_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|5455443_5456442_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|5456617_5457991_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|5458146_5458698_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5458791_5460144_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 21
NZ_CP015842	Escherichia coli O157:H7 strain FRIK2533 chromosome, complete genome	5645219	5492564	5505140	5645219	integrase	Enterobacteria_phage(81.82%)	15	5487597:5487612	5506092:5506107
5487597:5487612	attL	GTGCTGTTCATCGAAA	NA	NA	NA	NA
WP_000772662.1|5492564_5493839_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
WP_000936844.1|5494006_5494312_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001453880.1|5494388_5495123_+	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000095622.1|5495160_5496405_-	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_000446132.1|5496730_5497303_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638634.1|5497376_5497877_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283021.1|5497873_5498608_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149160.1|5499159_5499426_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980224.1|5499422_5500013_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001244670.1|5500005_5500293_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459294.1|5500285_5500741_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|5500876_5501197_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783684.1|5501211_5503545_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_044815386.1|5503900_5504095_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_001301682.1|5504312_5505140_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
5506092:5506107	attR	GTGCTGTTCATCGAAA	NA	NA	NA	NA
