The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	199900	273150	5645233	transposase,protease,plate,tRNA	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_001295561.1|199900_201253_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|201282_203715_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|203835_204321_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|204324_205350_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|205454_205910_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565963.1|205913_206702_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139661.1|206701_207850_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569419.1|207846_208443_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001294772.1|208479_211962_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000055741.1|211974_212934_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020954.1|213032_215174_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|215230_215620_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176537.1|215684_216980_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|217032_217293_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217279_217480_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|217645_218191_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|218187_218598_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|218611_219322_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|219521_220346_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|220398_222117_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|222227_222935_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|222931_223336_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|223453_224269_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|224308_224962_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|224954_225986_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|226173_226749_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|232508_233312_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|233308_234223_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234463_235264_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|235341_236112_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|236159_237518_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|237589_238345_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|238378_239101_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|239097_239565_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|239629_240361_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001302684.1|242175_242625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|242627_243224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002701.1|243302_243524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|243544_244024_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|243989_245399_-	membrane protein	NA	NA	NA	NA	NA
WP_001310198.1|245409_248844_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|248980_250393_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|250397_251141_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614378.1|251137_253927_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.3	1.1e-81
WP_000343292.1|253935_254697_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246433.1|254701_256033_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|256035_256560_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|256556_257837_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|257861_258944_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|258907_260758_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|260761_261175_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|261265_262657_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|262707_262932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|262966_263467_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|264163_264682_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103335.1|264891_267033_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_000509142.1|267108_271332_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
WP_000247943.1|271533_271797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|271711_271897_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|271977_273150_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	291936	371159	5645233	lysis,head,protease,tail,plate,transposase,terminase,portal,holin,capsid,integrase	Shigella_phage(44.83%)	93	294475:294491	377987:378003
WP_000749881.1|291936_292992_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|293279_294383_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|294394_295648_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
294475:294491	attL	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
WP_000051887.1|295852_297016_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_077769569.1|296892_297327_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	98.6	1.0e-76
WP_000206732.1|297242_297548_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|297547_297910_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008235.1|297900_298437_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_000917896.1|299113_299410_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_001020634.1|299687_300380_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|300477_300738_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|300730_301282_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|301457_301637_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104949.1|301626_302568_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_072141203.1|302564_303059_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_001303054.1|303058_303712_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_000210141.1|303708_304035_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_000767113.1|304031_304421_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|304440_305250_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001360050.1|305257_306247_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001008431.1|306260_307013_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_000484663.1|307226_307766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310393.1|307909_308143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449601.1|308421_308715_+	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001120501.1|308851_309187_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001197766.1|309190_309667_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001228695.1|309883_310066_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|310156_310450_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001135207.1|310975_311326_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	98.3	2.1e-64
WP_000929189.1|311451_311946_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	1.9e-87
WP_128484532.1|312179_313676_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000923141.1|313823_315050_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000999805.1|315042_315645_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000766100.1|315655_316885_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000924828.1|316963_317287_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000702395.1|317283_317694_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000224836.1|317668_318175_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000779288.1|318171_318732_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000497751.1|318740_318911_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155728.1|318894_320391_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000090993.1|320390_320747_+	hypothetical protein	NA	U5P076	Shigella_phage	99.2	1.2e-62
WP_000661054.1|320746_321016_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000807197.1|321157_322993_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000219910.1|323053_324382_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_001259066.1|325441_325990_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000424732.1|325989_326415_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785302.1|326401_327460_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000383550.1|327450_328035_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000368084.1|328807_329410_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_064261915.1|329381_329774_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.0e-71
WP_000905124.1|330284_330839_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_000355484.1|330899_331673_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000246059.1|332497_333241_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001130487.1|334203_335385_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000082144.1|335388_335805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|335777_336395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251694.1|336394_336853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|336845_337478_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000647284.1|337508_338099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350115.1|338098_338665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185340.1|339074_339347_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000968317.1|339352_339904_-	Polarity suppression protein	NA	NA	NA	NA	NA
WP_000154958.1|339900_340653_-	septation initiation protein	NA	NA	NA	NA	NA
WP_001244581.1|341586_341847_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000973389.1|341843_342401_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001071227.1|342397_342619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000562750.1|342618_342942_+	endopeptidase ClpB	NA	NA	NA	NA	NA
WP_000016225.1|342955_345289_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000205213.1|345421_346378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000687183.1|347053_347953_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000361969.1|348051_348774_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001301751.1|348940_349219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917758.1|349921_350824_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303808.1|351069_352128_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000171065.1|352269_353397_+	MFS transporter	NA	NA	NA	NA	NA
WP_000121344.1|353575_354532_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667043.1|354541_356740_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000643340.1|356736_357693_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000070685.1|357689_358379_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|358796_359411_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|359658_359988_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001301550.1|360300_361011_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001265657.1|360979_362623_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131063.1|362612_365138_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716386.1|365163_365832_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|365889_366477_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000389022.1|366551_367094_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147284.1|367918_368110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|368179_368320_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|368319_368583_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001171554.1|368846_369227_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|369223_369571_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|369620_371159_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
377987:378003	attR	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
>prophage 3
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	914324	952419	5645233	lysis,protease,portal,holin,tail,integrase	Enterobacteria_phage(52.5%)	47	903766:903780	936055:936069
903766:903780	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_024219169.1|914324_915206_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
WP_001303849.1|915368_915587_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|915626_915794_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|916036_916639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|916849_917071_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|917169_917451_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|917461_917653_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|917625_917808_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|917804_918485_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|919182_919365_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|919361_919532_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|919524_920145_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028857.1|920141_920807_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_000750155.1|921018_921978_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|922315_922438_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|922452_923142_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|923325_924069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|924154_924313_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_012578864.1|924393_924792_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|924934_925150_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|925149_925647_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|925643_926111_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|926098_926251_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_001072975.1|929514_929727_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|929654_930779_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|930900_931236_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136598.1|931180_933208_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_001097050.1|933294_933618_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|933610_933886_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|933897_934476_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|934472_934874_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|934884_935628_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|935688_936075_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
936055:936069	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|936083_936413_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|936384_939450_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|939449_939779_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|939788_940487_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|940492_941236_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|941172_941781_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_001233141.1|945325_945925_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741874.1|945984_947301_+|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|947302_947572_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|947748_948729_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|948762_949782_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|950278_950440_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|950608_951490_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|951720_952419_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 4
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	1077186	1090922	5645233	terminase,protease,capsid,integrase	uncultured_Caudovirales_phage(22.22%)	16	1078508:1078522	1091511:1091525
WP_000085207.1|1077186_1078410_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.2	1.6e-127
WP_000775337.1|1078406_1079180_+	hypothetical protein	NA	NA	NA	NA	NA
1078508:1078522	attL	TAATATTTCTGTATA	NA	NA	NA	NA
WP_001075374.1|1079271_1079496_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	1.9e-18
WP_072147362.1|1079505_1080204_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920689.1|1080196_1080382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000659213.1|1080381_1080573_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	52.8	2.2e-07
WP_000770151.1|1080810_1081110_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761782.1|1081106_1082861_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.3	7.1e-92
WP_000557482.1|1083147_1083399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391150.1|1083529_1083724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018605.1|1083727_1083889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229493.1|1084019_1084508_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	3.5e-25
WP_000562896.1|1084670_1085594_+|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.1	3.4e-13
WP_000520781.1|1086572_1086893_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1086923_1089200_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000279872.1|1089719_1090922_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
1091511:1091525	attR	TATACAGAAATATTA	NA	NA	NA	NA
>prophage 5
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	1251371	1320935	5645233	protease,head,transposase,terminase,portal,holin,tail,integrase	Escherichia_phage(26.09%)	80	1259859:1259874	1281225:1281240
WP_000156526.1|1251371_1253132_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1253317_1253770_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1253845_1254886_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1255242_1255752_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1255970_1256600_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1256562_1258725_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1258734_1259181_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1259303_1261358_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1259859:1259874	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1261389_1261848_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1261943_1262606_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1262778_1263192_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1263236_1263554_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1263611_1264802_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1264896_1265175_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1265171_1265501_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1265591_1266251_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1266658_1267678_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1267655_1267898_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1267965_1270437_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1270530_1270722_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1270718_1270907_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1271480_1271666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1271852_1272242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1272383_1272539_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1272816_1273104_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1273103_1273295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1273322_1273724_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1273832_1274105_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1274088_1274514_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1274720_1275176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1275254_1276346_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|1276352_1277099_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1277120_1277891_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1277906_1278320_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1278671_1279445_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1279810_1279948_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|1279992_1280205_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_001341388.1|1280372_1280651_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1280652_1281702_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1281225:1281240	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|1281714_1282086_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1282075_1282447_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1282598_1283417_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|1283703_1283943_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|1284037_1284751_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1285517_1287368_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_085948178.1|1287543_1288756_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303878.1|1288961_1289276_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1289803_1289989_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1290210_1290324_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1290544_1291078_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1291237_1291510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1291765_1291972_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1292722_1292998_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1293073_1293454_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1293450_1293798_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1293847_1295386_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001301919.1|1295435_1295678_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_001302857.1|1295649_1297578_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|1297561_1297768_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1297764_1299357_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1299346_1300852_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1300888_1301236_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1301293_1301560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|1301541_1302282_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1302295_1302727_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1302753_1303167_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082473.1|1303147_1305727_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847298.1|1305723_1306053_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001302968.1|1306052_1306751_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000194760.1|1306761_1307505_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|1307450_1308083_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649827.1|1308273_1308801_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_000515109.1|1308934_1312408_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_001230444.1|1312475_1313075_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268855.1|1313139_1314453_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001023407.1|1314454_1314724_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001301613.1|1316716_1317835_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1317831_1319625_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1319643_1320351_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1320347_1320935_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	1571924	1692468	5645233	lysis,head,protease,tail,transposase,terminase,tRNA,portal,holin,capsid,integrase	Enterobacteria_phage(37.61%)	154	1637829:1637844	1666083:1666098
WP_000952736.1|1571924_1572746_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|1572901_1573948_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1573944_1574739_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|1574905_1576024_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|1575992_1576262_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|1576323_1576713_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|1576845_1577361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|1577475_1577628_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|1577943_1578420_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1578544_1578868_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693962.1|1578851_1579277_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|1579345_1580383_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_001301518.1|1580414_1580837_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_000451012.1|1580870_1581587_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_000017339.1|1581583_1581901_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_001310212.1|1581897_1582200_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|1582189_1582507_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|1582460_1582778_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|1582764_1583202_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|1583203_1583395_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|1583397_1583985_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|1584100_1584205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1584393_1584606_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|1584773_1585052_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265159.1|1585053_1586103_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001217410.1|1586115_1586490_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|1586486_1587308_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|1587904_1588072_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023147.1|1588386_1590324_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	76.6	4.8e-291
WP_001213059.1|1590471_1590654_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|1590691_1590961_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|1591036_1591252_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|1591256_1591601_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|1591651_1592185_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|1592455_1593025_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1593024_1593171_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|1593398_1593605_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|1593669_1593894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|1594250_1594391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|1594520_1594706_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279796.1|1594747_1595113_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|1595403_1595967_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|1595963_1597625_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|1597688_1599626_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1599670_1599892_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|1602417_1602744_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1602753_1603104_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1603100_1603547_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1603543_1603888_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1603946_1604663_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1604668_1605043_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1605138_1605348_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261921.1|1605400_1608643_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	98.1	0.0e+00
WP_000807954.1|1608635_1608977_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|1608976_1609675_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|1609691_1609946_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|1610055_1610166_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|1610468_1611347_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|1611400_1612138_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|1612083_1612320_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|1612332_1612422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|1612441_1614790_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|1615380_1618782_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|1620885_1621011_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|1621090_1621366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|1621426_1622788_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|1623151_1624015_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1623998_1625135_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1625384_1626611_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|1626659_1627781_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_085952403.1|1628142_1629356_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_032174463.1|1629354_1630572_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_000953272.1|1630936_1631125_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|1631174_1631501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106745.1|1631625_1631799_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
WP_000226782.1|1631929_1632127_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|1632119_1632332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|1632321_1632786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|1632778_1633012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|1633017_1633317_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833626.1|1633313_1634714_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.3	3.6e-115
WP_000192401.1|1634914_1635166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|1635162_1635573_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|1635583_1635856_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|1635982_1636207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|1636458_1636665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|1636664_1637720_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|1637732_1638068_+|head	head decoration protein	head	NA	NA	NA	NA
1637829:1637844	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|1638080_1638494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|1638699_1639242_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|1639497_1639779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|1640379_1641840_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|1641839_1642511_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|1642679_1644050_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|1644053_1644695_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|1644730_1645837_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1645890_1646352_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|1646361_1647015_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|1647186_1648437_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|1648550_1649693_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088657.1|1649682_1649919_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|1650022_1650847_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|1650843_1651545_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|1651541_1651844_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|1651911_1652244_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|1652308_1652431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|1652488_1654015_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|1654516_1654972_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|1654971_1655142_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1655134_1655425_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|1655421_1655784_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|1655780_1655921_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|1655917_1656607_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|1656928_1657234_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|1657220_1657697_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|1657913_1658096_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|1658186_1658480_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|1658771_1659182_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|1659467_1659674_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|1659838_1660033_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|1660421_1660967_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|1660941_1662867_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|1662863_1663070_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|1663066_1664668_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|1664648_1665968_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|1665977_1666310_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
1666083:1666098	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063233.1|1666364_1667390_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_000158906.1|1667431_1667830_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|1667841_1668195_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|1668206_1668785_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|1668781_1669177_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|1669184_1669925_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|1669940_1670363_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|1670344_1670779_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|1670771_1673321_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|1673317_1673647_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|1673646_1674345_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|1674350_1675094_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|1675030_1675663_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|1675723_1679122_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|1679188_1679788_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|1679852_1682768_+	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|1682767_1683349_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|1683468_1684359_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|1684377_1684884_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|1684920_1685421_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|1685499_1685682_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|1686179_1686848_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|1686904_1687153_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|1687228_1687609_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1687605_1687953_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1688002_1689541_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|1689843_1691328_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|1691514_1692468_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 7
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	1777042	1884639	5645233	head,transposase,capsid,terminase,holin,tail,integrase	Stx2-converting_phage(38.14%)	121	1788676:1788698	1846449:1846471
WP_000113674.1|1777042_1778173_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1778150_1778399_-	excisionase	NA	NA	NA	NA	NA
WP_000048549.1|1778463_1780935_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_001090200.1|1781027_1781219_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1781215_1781404_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|1781801_1781969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|1781962_1782196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|1782173_1782581_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|1782603_1782822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|1782894_1783194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|1783457_1783865_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|1783941_1784169_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|1784152_1784704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|1784675_1785716_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_001302276.1|1785747_1786170_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000774808.1|1786356_1786938_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|1786934_1787099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|1787797_1788556_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
1788676:1788698	attL	CCGATATGGGAATTCCCATATCG	NA	NA	NA	NA
WP_000961820.1|1788834_1789047_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|1789267_1789525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|1789594_1789873_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|1789874_1790921_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|1790933_1791293_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|1791301_1791832_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|1792073_1792271_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|1792421_1793480_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000143067.1|1794276_1796130_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1796279_1796495_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|1796499_1796844_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|1796894_1797428_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1797698_1798268_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1798267_1798414_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1798641_1798827_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1799251_1799479_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|1799520_1799886_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_001303051.1|1800175_1800739_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_001303049.1|1800735_1802397_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_064261922.1|1804442_1804658_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	8.5e-32
WP_000126019.1|1807190_1807517_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1807526_1807877_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1807873_1808320_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1808316_1808661_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1808719_1809436_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1809441_1809816_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1809911_1810121_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000807954.1|1813403_1813745_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179515.1|1813744_1814443_+|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_046671488.1|1814453_1815197_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_050439450.1|1815142_1815775_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|1816117_1817293_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_129137390.1|1817244_1819590_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001228304.1|1819657_1820257_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_024748516.1|1820408_1821722_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	7.2e-81
WP_001023474.1|1821723_1821993_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|1823019_1824345_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_000998048.1|1827009_1828548_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1828597_1828945_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1828941_1829322_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|1829661_1829940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|1830367_1830514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|1830650_1831298_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|1831481_1832072_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_000147167.1|1834822_1835041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001500821.1|1835528_1836659_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	50.9	4.9e-102
WP_000113189.1|1836636_1836885_-	excisionase	NA	NA	NA	NA	NA
WP_000102181.1|1836949_1839394_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000092782.1|1839486_1839675_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|1839671_1839860_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000380314.1|1840347_1840500_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000367559.1|1840669_1841059_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|1841161_1841437_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000693888.1|1841420_1841846_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095667.1|1841868_1842822_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000790456.1|1842828_1843569_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000450888.1|1843598_1844369_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_001118161.1|1844384_1844780_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001302146.1|1844836_1845193_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_000063625.1|1845241_1845454_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|1845489_1845861_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000610379.1|1845857_1846220_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_001278450.1|1846335_1846440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|1846628_1846841_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
1846449:1846471	attR	CGATATGGGAATTCCCATATCGG	NA	NA	NA	NA
WP_001304183.1|1847370_1847649_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000904137.1|1848712_1849087_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762904.1|1849083_1849905_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000917735.1|1850131_1850329_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483497.1|1850479_1851538_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_024748518.1|1852029_1853880_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000411802.1|1854327_1854534_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075112.1|1854533_1855031_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_001208680.1|1855247_1855433_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|1855959_1856274_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|1856355_1856580_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|1856621_1856987_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958387.1|1857275_1857839_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|1857835_1859497_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|1859560_1861498_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1861542_1861764_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|1864290_1864617_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1864626_1864977_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1864973_1865420_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1865416_1865761_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1865819_1866536_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1866541_1866916_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1867011_1867221_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|1867273_1870516_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|1870508_1870850_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064261967.1|1870849_1871548_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.6	7.3e-133
WP_001303043.1|1871558_1872302_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_129137391.1|1872247_1872880_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_064261927.1|1873126_1876603_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_001230509.1|1876670_1877270_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_064261928.1|1877334_1878648_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.8	3.7e-85
WP_094276452.1|1878701_1878914_+|tail	phage tail protein	tail	A0A2R2Z347	Escherichia_phage	87.7	1.7e-24
WP_001131658.1|1879031_1879607_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|1879679_1880309_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|1880390_1881032_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_016241229.1|1881193_1881508_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|1881567_1882851_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|1882939_1884400_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|1884435_1884639_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	2154910	2245830	5645233	protease,tail,holin,transposase,terminase,portal,head,capsid	Enterobacteria_phage(30.95%)	104	NA	NA
WP_000422055.1|2154910_2155960_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2156179_2156938_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2156934_2157525_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2157564_2158437_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2158649_2160233_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2160260_2160881_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2160877_2161759_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2161896_2161941_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2162032_2163595_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763503.1|2163594_2165190_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001416116.1|2165193_2166552_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	7.3e-36
WP_000209521.1|2166563_2167757_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2167756_2168563_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2168943_2169123_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2169208_2169709_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2169754_2170261_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001023426.1|2176345_2176615_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
WP_064261932.1|2176616_2177930_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	6.3e-77
WP_001230509.1|2177994_2178594_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_064261933.1|2178661_2182141_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_129137391.1|2182387_2183020_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001303043.1|2182965_2183709_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_001303044.1|2183719_2184418_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|2184417_2184747_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000533440.1|2187336_2187750_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2187776_2188199_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2188212_2188965_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2188972_2189368_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2189364_2189898_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2189912_2190266_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2190277_2190676_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2190717_2191743_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2191798_2192131_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2192140_2193460_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2193440_2195042_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2195038_2195245_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2195241_2197167_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2197141_2197687_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2198073_2198298_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2198379_2198694_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2199219_2199405_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2199627_2199774_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2199773_2200343_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2200613_2201147_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2201197_2201542_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411805.1|2201546_2201753_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023184.1|2202201_2204052_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|2204529_2204961_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2205411_2206125_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2206260_2206458_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2206682_2207237_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2207299_2207605_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2207617_2208667_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2208668_2208941_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2209062_2209407_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2209526_2209739_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2209972_2210530_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2210531_2210750_-	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2210877_2211189_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2211181_2211409_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2211405_2211687_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2211719_2212436_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_001379651.1|2212469_2212892_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_001262402.1|2212923_2213967_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2214035_2214461_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2214444_2214687_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2215078_2215417_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2215709_2215862_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2215873_2216512_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2216512_2216722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2217286_2217475_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2217471_2217660_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2217752_2218997_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_016241229.1|2219635_2219950_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001500906.1|2220861_2221158_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	1.3e-43
WP_000267292.1|2221237_2223739_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2223684_2223906_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|2223950_2225888_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001303049.1|2225951_2227613_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_001303051.1|2227609_2228173_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_000095736.1|2228868_2229096_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2229520_2229706_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2229933_2230080_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2230079_2230649_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2230919_2231453_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000998048.1|2231616_2233155_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2233204_2233552_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2233548_2233929_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731257.1|2234004_2234298_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	8.3e-46
WP_000411805.1|2234302_2234509_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_024748470.1|2234957_2236808_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_001303509.1|2237286_2237715_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|2238350_2239040_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|2239036_2239396_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2239408_2240458_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2240459_2240738_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2240905_2241118_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2241306_2241411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2241526_2242111_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2242167_2242563_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788936.1|2243373_2244114_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_000095670.1|2244120_2245083_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000693943.1|2245105_2245531_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2245527_2245830_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 9
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	2389928	2434845	5645233	tail,holin,plate,terminase,tRNA,portal,head,capsid,integrase	Enterobacteria_phage(76.6%)	61	2392331:2392355	2427487:2427511
WP_000029463.1|2389928_2390678_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154193.1|2390677_2391229_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956513.1|2391291_2392272_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2392331:2392355	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_001689686.1|2392464_2392902_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_000403439.1|2393002_2393503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247210.1|2393505_2394444_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	5.1e-81
WP_000904674.1|2394532_2394841_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	52.1	8.7e-22
WP_001151410.1|2394937_2395216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917809.1|2395230_2395569_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	87.1	2.3e-52
WP_000158974.1|2395579_2395867_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	6.6e-32
WP_000514277.1|2395878_2396121_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021666.1|2396117_2396231_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	2.0e-08
WP_029238958.1|2396420_2396741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2396764_2396968_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2396964_2397231_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104308.1|2397227_2397527_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	1.4e-40
WP_000013477.1|2397849_2398080_+	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	82.9	4.8e-25
WP_000564228.1|2398152_2398542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001609.1|2398538_2401379_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	90.1	0.0e+00
WP_000708312.1|2401455_2402415_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.5e-176
WP_000211267.1|2402419_2402731_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_001594304.1|2403095_2403365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087812.1|2403852_2404899_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000613768.1|2404898_2406650_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	99.8	0.0e+00
WP_001262673.1|2406804_2407641_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055118.1|2407663_2408716_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	100.0	6.8e-199
WP_000632347.1|2408761_2409562_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.5	1.6e-131
WP_000063103.1|2409663_2410158_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864901.1|2410157_2410358_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2410360_2410684_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|2410680_2411073_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780572.1|2411069_2411477_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000920579.1|2411614_2412082_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.1	9.3e-84
WP_000356344.1|2412074_2412710_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_001271948.1|2412706_2413288_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	95.9	2.3e-100
WP_000213447.1|2413284_2413635_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111970.1|2413638_2414535_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	7.4e-154
WP_000071724.1|2414527_2415136_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_000217007.1|2415132_2416767_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	57.0	3.7e-143
WP_064261935.1|2416780_2417368_+|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	88.4	1.7e-90
WP_001008232.1|2417339_2417783_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	6.3e-82
WP_001743818.1|2417803_2418214_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	98.4	7.7e-66
WP_000905082.1|2418244_2418844_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	82.2	8.9e-87
WP_000979945.1|2418870_2419359_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853421.1|2419371_2422179_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.6	0.0e+00
WP_000763327.1|2422165_2422294_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665308.1|2422329_2422695_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290466.1|2422749_2423262_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	96.5	3.3e-90
WP_000005394.1|2423261_2424446_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	3.6e-225
WP_000132850.1|2424603_2425713_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	93.0	1.1e-191
WP_000069998.1|2425865_2426471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302981.1|2426631_2426892_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|2427082_2427223_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|2427528_2427828_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2427487:2427511	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672328.1|2427832_2430220_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|2430234_2431218_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2431500_2431545_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2431667_2432024_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2432076_2432274_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2432370_2432913_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144201.1|2432916_2434845_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	9.4e-130
>prophage 10
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	2593241	2645676	5645233	transposase,integrase,tail,tRNA	Enterobacteria_phage(61.29%)	60	2586465:2586480	2645755:2645770
2586465:2586480	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|2593241_2594975_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|2595151_2595640_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|2595759_2596152_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|2596151_2598230_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|2598222_2599371_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|2599572_2600217_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2600227_2600617_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|2600631_2601681_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|2601683_2602544_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|2602562_2604164_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|2604209_2605871_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|2606013_2606517_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|2606537_2608502_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|2608506_2609433_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|2609429_2610317_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2610443_2611022_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|2611024_2611375_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|2612154_2612583_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|2612589_2614014_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|2613988_2614789_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|2614955_2615942_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|2615956_2617471_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|2617540_2618530_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|2619326_2619830_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|2619909_2620161_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2620275_2620362_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|2620623_2620947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|2621117_2621615_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2621651_2621891_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|2622082_2623294_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2623355_2624021_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001303019.1|2624377_2625379_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
WP_000865208.1|2625384_2625732_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|2625761_2626412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2626427_2626832_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|2626921_2627059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|2627130_2627334_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|2627355_2627706_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|2627716_2627995_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|2628006_2628249_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|2628245_2628359_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|2628451_2628868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2628891_2629095_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|2629091_2629358_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|2629354_2629654_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000775057.1|2629976_2630207_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000599379.1|2630279_2630645_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|2630651_2633474_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|2633550_2634510_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|2634514_2634829_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000257965.1|2636034_2636451_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000954203.1|2636494_2637067_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|2637223_2637712_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000763327.1|2640514_2640643_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665314.1|2640678_2641044_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|2641098_2641611_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_072141434.1|2641610_2641790_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	88.1	9.8e-26
WP_085948178.1|2641846_2643059_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000132765.1|2644265_2644589_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161583.1|2644539_2645676_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
2645755:2645770	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 11
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	2703260	2770345	5645233	holin,transposase,terminase,portal,head,tail,integrase	Enterobacteria_phage(32.56%)	66	2718924:2718939	2774690:2774705
WP_001023396.1|2703260_2703530_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000268854.1|2703531_2704701_-	hypothetical protein	NA	B6DZB7	Enterobacteria_phage	96.9	1.1e-83
WP_001230509.1|2704765_2705365_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_064261933.1|2705432_2708912_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_129137391.1|2709158_2709791_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001303043.1|2709736_2710480_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_001303044.1|2710490_2711189_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|2711188_2711518_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082473.1|2711514_2714094_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|2714074_2714488_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2714514_2714946_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2714959_2715700_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2715681_2715948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|2716005_2716353_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|2716389_2717895_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|2717884_2719477_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2718924:2718939	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|2719473_2719680_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|2721564_2722074_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|2722468_2722693_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|2722774_2723089_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2723615_2723801_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303555.1|2724172_2724355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|2724510_2725044_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|2725094_2725439_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000411809.1|2725443_2725650_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_085948178.1|2725969_2727182_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000023257.1|2727264_2729115_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001059369.1|2730654_2731344_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|2731340_2731700_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|2731712_2732762_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|2732763_2733042_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|2733209_2733422_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|2733608_2733713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|2733822_2734386_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|2734512_2734824_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|2734820_2734973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|2735005_2735362_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|2735358_2735583_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|2735604_2736303_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000373320.1|2736337_2736760_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_001262409.1|2736791_2737829_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|2737897_2738323_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|2738319_2738547_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|2738644_2739289_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|2739563_2739716_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|2740196_2740385_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|2740381_2740570_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|2740665_2743137_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|2743195_2743399_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|2743398_2744421_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|2744656_2745454_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_014714124.1|2745943_2753926_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_000480501.1|2754187_2755240_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|2755553_2756870_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2756971_2758426_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|2758768_2759485_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|2760110_2761754_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|2761871_2762822_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|2762923_2763841_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986334.1|2764297_2765233_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|2765294_2766374_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2766385_2767129_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|2767125_2767671_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|2768032_2768413_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2768409_2768757_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2768806_2770345_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
2774690:2774705	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 12
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	2785010	2847111	5645233	lysis,protease,tail,holin,transposase,terminase,head,capsid,integrase	Stx2-converting_phage(65.0%)	80	2830817:2830876	2847106:2848415
WP_001303036.1|2785010_2786177_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001121226.1|2787500_2788151_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000491542.1|2788375_2789251_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001023452.1|2789391_2789661_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000268993.1|2789662_2790976_-	hypothetical protein	NA	A0A0P0ZCC1	Stx2-converting_phage	100.0	2.8e-85
WP_064261938.1|2791040_2791640_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	99.5	5.2e-111
WP_000515107.1|2791706_2795186_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	0.0e+00
WP_050546863.1|2795445_2796078_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_001303040.1|2796023_2796761_-|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_001416667.1|2796814_2797738_-	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001154345.1|2797808_2797982_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|2798089_2798410_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001303038.1|2798426_2799125_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_000807954.1|2799124_2799466_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_015994262.1|2799458_2802701_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	100.0	0.0e+00
WP_001453698.1|2802752_2802962_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2803057_2803432_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2803437_2804154_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2804212_2804557_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2804553_2805000_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|2804996_2805347_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|2805356_2805683_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001063023.1|2808209_2808431_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000173023.1|2808475_2810413_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	100.0	0.0e+00
WP_001301491.1|2810476_2812138_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958396.1|2812134_2812698_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_001303046.1|2812988_2813354_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|2813395_2813623_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001283921.1|2814085_2814343_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000839224.1|2814339_2814837_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_000092318.1|2815039_2815477_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000075132.1|2815473_2815971_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000284515.1|2815970_2816186_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001290231.1|2816262_2816535_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000143458.1|2816575_2816755_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000143113.1|2816891_2818829_-	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	100.0	0.0e+00
WP_001303568.1|2819072_2819396_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000738080.1|2819692_2819962_-	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_000649751.1|2819973_2820933_-	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000512807.1|2821582_2822071_-	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_001028858.1|2822061_2822733_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_001108004.1|2822729_2823335_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001004016.1|2823334_2824057_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_000208500.1|2824131_2824896_-	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001254256.1|2825170_2825353_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|2825349_2825877_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001303571.1|2825873_2826320_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_001449504.1|2826276_2826513_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_000103678.1|2826523_2826739_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001303053.1|2826871_2827093_-	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	1.1e-37
WP_001220560.1|2827667_2828279_-	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_000998048.1|2828367_2829906_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2829955_2830303_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2830299_2830680_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
2830817:2830876	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_085948178.1|2830870_2832083_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_064261939.1|2832123_2833497_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	2.1e-253
WP_000539354.1|2833493_2834315_-	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_000442612.1|2834495_2834792_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000067727.1|2834933_2835149_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_001302016.1|2835223_2835919_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_001130059.1|2836420_2836942_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_000438343.1|2837510_2837693_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_000088203.1|2837670_2837943_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000394301.1|2838001_2838262_+	hypothetical protein	NA	A0A0P0ZC97	Stx2-converting_phage	100.0	1.1e-44
WP_000065362.1|2838444_2838813_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_001198861.1|2838885_2839050_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|2839018_2839162_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995486.1|2839236_2839533_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_001302855.1|2839538_2840324_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000186848.1|2840320_2841001_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000682306.1|2840997_2841180_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000548528.1|2841152_2841344_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_001444000.1|2841354_2841636_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|2841734_2841956_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289930.1|2841952_2842900_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000610373.1|2843766_2844117_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001281188.1|2844304_2844649_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000132739.1|2844726_2844918_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_074469436.1|2844898_2845795_-|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	3.8e-174
WP_085948178.1|2845897_2847111_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
2847106:2848415	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCACTTTCGCAAGTCAGCAGTGATCTGTCTGGCATCCTTCAAAGACAGGGATGGGTATCGACCAAGCCCAAGTCGATTAGGCTTGCCATGCCAGCGATAGCGGTACTGGAACTGGATGACCCCCTTCGGTGAAATTCGTACGCTGAGGCCATCGGCATCAGCCACTTCTTGTGGGCCAGAATATGGTTTACCATAAATAGTACGCAGTTTTGTGTCGCTTATAGCCATAAATAATATTTGGTACGCTCAGAAATAATGGTTTGGTACACATCTGGTACACAATATCACATGGACAACAGCGCACAGTAAACAACTATATTTGACGTTCGTAGACATACTCAGGTGAAAAAAGGGTTGTTTTTCGAGTTATAACAGACAGTTAATTAACTACATTGGACAATGCTAGACAATGACAGACACAGATAAGCAACCTACCTTCCTCTTTCACGATTACGAAACCTTTGGCACGCACCCCGCGTTAGATCGCCCTGCACAGTTCGCAGCCATTCGCACCGATGACGAATTCAATGTCATCGGCGAACCCGAAGTCTTTTACTGCAAGCCCGCGGATGACTATTTACCCCAGCCTGGAGCAGTATTAATTACCGGTATTACCCCGCAGGAAGCTCGGGCGAAAGGAGAAAACGAAGCCGCATTTGCCGCCCGTATTCACTCGCTTTTTACCGTACCGAAGACCTGTATTCTGGGCTACAACAATGTGCGTTTCGACGACGAAGTCACACGCAACGTTTTTTATCGTAATTTCTACGATCCTTACGCCTGGAGCTGGCAGCATGATAACTCGCGCTGGGATTTACTGGATGTTATGCGTGCCTGCTATGCCCTGCGCCCGGAAGGAATAAACTGGCCTGAAAATGATGACGGTCTACCGAGCTTTCGCCTTGAGCATTTAACCAAAGCGAATGGTATTGAACATAGCAACGCCCACGATGCGATGGCTGATGTGTACGCCACTATTGCGATGGCGAAACTGGTAAAAACGCGTCAACCACGCCTGTTTGATTATCTCTTTACCCATCGTAATAAACACAAACTGATGGCGTTGATTGATGTTCCGCAGATGAAACCCCTGGTTCACGTTTCCGGAATGTTTGGGGCATGGCGCGGCAATACCAGCTGGGTGGCACCGCTGGCGTGGCATCCTGAAAATCGCAATGCCGTAATTATGGTGGATTTGGCAGGAGATATTTCGCCATTACTGGAACTGGATAGCGACACATTGCGCGAGCGTT	NA	NA	NA	NA
>prophage 13
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	2930614	2967859	5645233	lysis,head,plate,capsid,terminase,tRNA,portal,holin,tail,integrase	Escherichia_phage(36.96%)	48	2934914:2934941	2966052:2966079
WP_000675144.1|2930614_2932018_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137884.1|2932014_2932737_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_001301848.1|2932927_2933260_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2933407_2934769_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
2934914:2934941	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2935043_2935262_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882987.1|2935343_2936507_-	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	98.7	3.5e-204
WP_000978915.1|2936506_2936986_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.5e-84
WP_000069920.1|2937000_2939448_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	95.7	0.0e+00
WP_000785970.1|2939440_2939560_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|2939592_2939868_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|2939924_2940443_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286714.1|2940455_2941646_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	1.5e-223
WP_000905091.1|2941705_2942299_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	1.3e-103
WP_000368070.1|2942816_2943419_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	98.5	5.9e-107
WP_001285344.1|2945267_2945879_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	4.9e-117
WP_001121492.1|2945871_2946780_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	8.3e-161
WP_000127172.1|2946784_2947132_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_001093756.1|2947128_2947764_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	4.5e-113
WP_001001774.1|2947830_2948283_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.4e-76
WP_000917172.1|2948275_2948743_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	7.4e-81
WP_001300730.1|2948705_2948879_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000040660.1|2948850_2949276_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	1.8e-65
WP_000736588.1|2949263_2949689_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	94.3	2.1e-58
WP_001144113.1|2949703_2950201_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	2.6e-92
WP_000123125.1|2950200_2950482_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	98.9	6.3e-43
WP_000846399.1|2950485_2950689_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|2950688_2951198_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203439.1|2951297_2952041_-|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	98.4	8.6e-124
WP_001248573.1|2952044_2953118_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	6.7e-202
WP_001085969.1|2953172_2954027_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	95.8	5.8e-132
WP_000156861.1|2954200_2955973_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_000038195.1|2955972_2957007_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	96.2	4.5e-195
WP_001177885.1|2957219_2957489_+	hypothetical protein	NA	Q2P9X2	Enterobacteria_phage	89.9	3.8e-29
WP_000551925.1|2957519_2957714_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	89.1	8.5e-23
WP_000042038.1|2957712_2958150_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	92.3	1.6e-69
WP_000746343.1|2958274_2959225_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.0	3.8e-39
WP_001310277.1|2959202_2959511_-	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	40.2	1.7e-12
WP_000268557.1|2960111_2962400_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.6	0.0e+00
WP_000027665.1|2962389_2962665_-	hypothetical protein	NA	M1TAP2	Escherichia_phage	98.9	6.6e-45
WP_001113260.1|2962661_2962886_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	5.5e-34
WP_001277943.1|2962885_2963188_-	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	95.0	1.9e-45
WP_000557701.1|2963187_2963412_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_000217679.1|2963475_2963976_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_000043869.1|2964153_2964429_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|2964543_2964843_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000985261.1|2964958_2965972_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001303579.1|2966236_2966554_-	hypothetical protein	NA	NA	NA	NA	NA
2966052:2966079	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2966959_2967859_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 14
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	2993490	3065787	5645233	holin,transposase,capsid,terminase,tRNA,portal,head,tail	Enterobacteria_phage(55.74%)	70	NA	NA
WP_001301615.1|2993490_2995524_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_085948178.1|2998083_2999296_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001411921.1|3000799_3002080_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_000356841.1|3003793_3007423_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|3007484_3007802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|3009042_3010131_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|3010141_3011671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|3011689_3012421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|3012413_3013550_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|3013546_3015550_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001171554.1|3015933_3016314_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3016310_3016658_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3016707_3018246_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001295430.1|3018627_3019098_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3019144_3019864_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|3019860_3021546_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_001261939.1|3022060_3022309_+	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001143784.1|3022470_3023112_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_072142879.1|3023193_3023610_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001023396.1|3023770_3024040_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000268879.1|3024041_3025211_-	hypothetical protein	NA	B6DZB7	Enterobacteria_phage	100.0	4.3e-85
WP_001230508.1|3025275_3025875_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_015994252.1|3025942_3029422_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	100.0	0.0e+00
WP_149025382.1|3029681_3030314_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.0	4.9e-104
WP_000967271.1|3030259_3030997_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_001416667.1|3031050_3031974_-	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001154345.1|3032044_3032218_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|3032325_3032646_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001152183.1|3032662_3033361_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_000807954.1|3033360_3033702_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3033694_3036937_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3036984_3037194_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3037289_3037664_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275464.1|3037678_3038395_-|tail	tail protein	tail	B6DZA6	Enterobacteria_phage	100.0	1.2e-127
WP_000133388.1|3038460_3038805_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3038801_3039248_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|3039244_3039595_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|3039605_3039932_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_064261943.1|3039928_3042352_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	93.7	0.0e+00
WP_001063099.1|3042297_3042519_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3042563_3044501_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001303049.1|3044564_3046226_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_001303051.1|3046222_3046786_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_015994246.1|3047075_3047441_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|3047482_3047710_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3048134_3048320_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3048547_3048694_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3048693_3049263_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3049533_3050067_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3050117_3050462_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411802.1|3050466_3050673_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_064261944.1|3051120_3052971_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.8	0.0e+00
WP_000752026.1|3053469_3053739_-	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000691354.1|3053748_3054696_-	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_001204852.1|3055202_3055637_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000144759.1|3055629_3055824_-	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001107998.1|3055820_3056426_-	recombination protein NinG	NA	B6DZ84	Enterobacteria_phage	100.0	6.6e-98
WP_001004018.1|3056425_3057148_-	DNA-binding protein	NA	B6DZ83	Enterobacteria_phage	100.0	3.5e-130
WP_000290551.1|3057222_3057900_-	phage antirepressor Ant	NA	Q4A1A4	Enterobacteria_phage	97.8	2.2e-126
WP_001254256.1|3058175_3058358_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000153268.1|3058354_3058882_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001310475.1|3058878_3059325_-	recombination protein NinB	NA	A0A1U9AJ79	Stx1_converting_phage	100.0	2.4e-81
WP_001281772.1|3059281_3059518_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|3059528_3059744_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000130.1|3059876_3060155_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_085948178.1|3060807_3062021_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_027868261.1|3063275_3063977_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_001216963.1|3064036_3064144_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3064124_3064856_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|3064860_3065787_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 15
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	3310068	3315455	5645233	integrase	Enterobacteria_phage(50.0%)	6	3300519:3300535	3312483:3312499
3300519:3300535	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|3310068_3311001_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|3311312_3312470_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3312644_3313781_-	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3312483:3312499	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3313790_3314471_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3314457_3314925_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_064261946.1|3314924_3315455_-	hypothetical protein	NA	Q716G6	Shigella_phage	98.6	3.7e-68
>prophage 16
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	3557174	3617875	5645233	transposase,tRNA,holin,tail,integrase	Enterobacteria_phage(30.0%)	59	3574622:3574636	3622834:3622848
WP_000997403.1|3557174_3558212_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3558418_3558838_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|3558906_3559605_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|3559636_3562297_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3562410_3563766_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|3563811_3564135_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|3564131_3565430_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|3571205_3573779_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|3573908_3574640_-	polyphenol oxidase	NA	NA	NA	NA	NA
3574622:3574636	attL	GGACAATCAGCTTAC	NA	NA	NA	NA
WP_000079092.1|3574636_3575617_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3575751_3576489_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3576759_3577101_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3577204_3577252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|3577350_3578511_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|3578553_3579675_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|3579685_3580756_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|3580965_3581331_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3581480_3581999_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969012.1|3581988_3583215_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|3583230_3583713_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3583789_3584137_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3584178_3584946_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3584976_3585525_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3585543_3585792_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3585928_3587290_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3587456_3588248_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626229.1|3588269_3589556_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3589610_3590204_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|3590326_3591205_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880924.1|3591290_3592952_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3593100_3593442_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|3593503_3593794_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|3593783_3594260_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3594391_3594874_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|3595719_3595968_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|3596469_3597060_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|3597242_3597893_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|3597971_3599030_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|3599159_3599582_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|3599742_3600012_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_001303014.1|3600013_3600580_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	7.9e-69
WP_000612591.1|3600629_3600977_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3600973_3601354_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|3601710_3602055_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3602059_3602275_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143068.1|3602424_3604278_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000499458.1|3604685_3604853_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|3604938_3605682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3605934_3606558_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|3606554_3607220_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|3607216_3607828_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|3607802_3608369_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_085948178.1|3609023_3610237_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001417601.1|3610820_3611123_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000150582.1|3611198_3612407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|3612802_3613216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052051.1|3613313_3613712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000428092.1|3615354_3616668_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000540864.1|3616669_3617875_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3622834:3622848	attR	GGACAATCAGCTTAC	NA	NA	NA	NA
>prophage 17
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	4190830	4289432	5645233	protease,plate,transposase,head,tail,integrase	Shigella_phage(40.0%)	117	4258370:4258387	4278641:4278658
WP_001107466.1|4190830_4192765_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000145975.1|4192864_4193494_-	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_001054420.1|4193619_4193913_+	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_001148001.1|4194068_4194545_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_001212627.1|4194792_4196226_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_000673572.1|4196265_4197438_-	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_000813037.1|4197453_4198419_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000940595.1|4198545_4198803_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_000271401.1|4198823_4199135_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_001047341.1|4199393_4200365_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|4200593_4200872_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_000357265.1|4200919_4202179_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000429656.1|4202233_4202488_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_000004488.1|4202647_4202941_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_000476484.1|4202940_4203576_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_001296448.1|4203594_4204146_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_000925795.1|4204150_4204933_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_000438245.1|4204940_4205750_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922872.1|4205959_4206937_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001302021.1|4206950_4207937_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	2.5e-38
WP_000030005.1|4207957_4208524_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030527.1|4208520_4209096_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|4209064_4209622_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|4209628_4210354_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|4210401_4211835_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|4211857_4212145_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_001301839.1|4212262_4212754_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|4212799_4213654_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|4213650_4213923_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620409.1|4214136_4214769_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047079.1|4214765_4215494_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001302019.1|4215490_4216144_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809770.1|4216373_4218710_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|4218805_4219735_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_001310491.1|4220408_4224869_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_000081695.1|4224881_4226300_+	glutamate synthase subunit GltD	NA	NA	NA	NA	NA
WP_000445148.1|4226483_4227611_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	87.8	1.1e-72
WP_000979870.1|4227670_4228135_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209030.1|4228131_4229007_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_001301938.1|4229003_4229693_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108469.1|4229740_4231231_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	3.7e-09
WP_000224714.1|4231339_4232233_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000523844.1|4232354_4233146_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000528251.1|4234364_4235102_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001310452.1|4235055_4235256_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|4235370_4235835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|4235873_4236119_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|4236154_4236337_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|4236483_4238523_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|4238622_4239183_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|4239405_4239609_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|4239688_4240210_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|4240244_4241156_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|4241155_4241716_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|4241706_4242789_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|4242788_4243226_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|4243218_4243833_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|4243822_4244947_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|4244930_4246280_-	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000113525.1|4246266_4248342_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000213225.1|4248468_4248945_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|4248959_4249325_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|4249333_4250836_-|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|4250832_4251078_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|4251078_4251639_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|4251635_4252055_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002057.1|4252051_4252438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|4252481_4253429_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_064261950.1|4253428_4254553_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	4.9e-78
WP_000094804.1|4254729_4255203_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000046893.1|4255321_4256647_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000532593.1|4256630_4258220_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_001057672.1|4258219_4259884_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
4258370:4258387	attL	CGCCACGGCAAAATCACC	NA	NA	NA	NA
WP_000360581.1|4259883_4260465_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279084.1|4260467_4260758_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000270159.1|4260754_4261063_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342746.1|4261043_4261271_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|4261280_4261499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|4261482_4261911_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|4261945_4262446_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|4262517_4262943_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214362.1|4263012_4263522_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000370523.1|4263518_4263815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|4263804_4264002_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000021235.1|4263994_4264327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|4264365_4264551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977060.1|4264547_4265099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465559.1|4265102_4265618_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000564283.1|4265617_4266151_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000323222.1|4266154_4266697_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_001129553.1|4266794_4267325_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049304.1|4267336_4267630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|4267634_4267907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|4267903_4268185_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|4268186_4268441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268103.1|4268453_4268675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|4268677_4269610_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000289290.1|4269680_4271771_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_001310454.1|4271772_4272021_-	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000077537.1|4272211_4272742_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_000366129.1|4273684_4274182_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
WP_000257293.1|4274187_4274826_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000829818.1|4275220_4275613_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000847559.1|4275628_4276057_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_001192332.1|4276275_4277403_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001295270.1|4277596_4277995_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_001301636.1|4278148_4279516_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	5.1e-21
4278641:4278658	attR	GGTGATTTTGCCGTGGCG	NA	NA	NA	NA
WP_000497723.1|4279605_4280673_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295272.1|4280736_4281675_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_001257846.1|4282109_4282580_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000695690.1|4282944_4283208_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001029013.1|4283263_4283536_-	barnase inhibitor	NA	NA	NA	NA	NA
WP_000350957.1|4283627_4285595_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_000854038.1|4285600_4286530_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_001310167.1|4286537_4286741_-	AaeX family protein	NA	NA	NA	NA	NA
WP_000440317.1|4286923_4287853_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_000055927.1|4287986_4289432_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 18
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	4743181	4755465	5645233	integrase	Enterobacteria_phage(90.0%)	12	4731597:4731610	4756278:4756291
4731597:4731610	attL	TATGGTGCGGAGAT	NA	NA	NA	NA
WP_001218978.1|4743181_4744369_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.0	5.3e-208
WP_000704989.1|4744588_4746109_-	cytidine deaminase	NA	A0A0N9QQ67	Chrysochromulina_ericina_virus	46.2	2.7e-07
WP_000446145.1|4746749_4747322_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.4e-94
WP_000638631.1|4747395_4747896_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283041.1|4747892_4748627_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.5	2.2e-127
WP_001149160.1|4749177_4749444_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980233.1|4749440_4750040_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.1e-49
WP_001244665.1|4750032_4750320_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459294.1|4750312_4750768_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4750903_4751224_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783661.1|4751238_4753572_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_001219063.1|4754283_4755465_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	68.9	1.4e-160
4756278:4756291	attR	TATGGTGCGGAGAT	NA	NA	NA	NA
>prophage 19
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	5249583	5264248	5645233	tRNA,tail,integrase	Enterobacteria_phage(40.0%)	18	5250864:5250879	5268393:5268408
WP_000956557.1|5249583_5250117_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|5250534_5250816_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5250864:5250879	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|5251160_5251358_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|5251693_5251978_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|5251974_5252325_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|5252315_5252852_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|5254173_5254773_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268945.1|5254837_5256151_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|5256152_5256422_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|5256533_5257106_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|5257178_5257808_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|5257889_5258531_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|5258691_5258940_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|5259001_5260099_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|5260187_5261225_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|5261358_5261601_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|5261766_5262750_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_064261955.1|5262832_5264248_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
5268393:5268408	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 20
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	5401128	5460156	5645233	transposase,protease	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312488.1|5401128_5402388_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|5402390_5403395_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|5403476_5403674_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|5403777_5405076_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|5405280_5405706_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|5405744_5408186_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|5408366_5409098_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|5409224_5409626_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|5409644_5410343_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|5410393_5411053_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|5411070_5411469_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|5411478_5412117_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|5412119_5413283_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|5413366_5414992_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|5415108_5415384_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|5415532_5415862_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|5416043_5416793_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|5416789_5417545_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001301921.1|5419071_5420469_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|5420484_5420790_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|5420799_5421264_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|5421277_5421928_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|5421937_5422792_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_001170812.1|5422791_5423478_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_000492914.1|5423606_5423882_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|5424208_5424604_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|5424610_5424925_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|5424929_5425157_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|5425198_5425648_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|5425718_5426513_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|5427135_5427567_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|5427574_5428783_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|5428917_5429556_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|5429773_5430394_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|5430702_5432115_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|5432159_5432822_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|5432929_5433895_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|5434002_5434863_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001302935.1|5434951_5435332_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589488.1|5435449_5437393_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|5437582_5438323_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937658.1|5438534_5439473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175296.1|5439535_5440090_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|5440414_5440621_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|5440716_5442060_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|5442382_5443021_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|5443226_5444960_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|5444956_5448736_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|5448738_5449080_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|5449291_5449543_+	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_000239579.1|5449536_5449887_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|5449966_5450497_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|5450806_5451763_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205805.1|5451902_5453405_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001301928.1|5453418_5454441_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|5454427_5455423_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|5455455_5456454_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|5456629_5458003_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|5458158_5458710_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|5458803_5460156_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 21
NZ_CP015843	Escherichia coli O157:H7 strain FRIK2455, complete genome	5645233	5492576	5505152	5645233	integrase	Enterobacteria_phage(81.82%)	15	5487609:5487624	5506104:5506119
5487609:5487624	attL	GTGCTGTTCATCGAAA	NA	NA	NA	NA
WP_000772662.1|5492576_5493851_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
WP_000936844.1|5494018_5494324_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001453880.1|5494400_5495135_+	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000095622.1|5495172_5496417_-	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_000446132.1|5496742_5497315_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638634.1|5497388_5497889_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283021.1|5497885_5498620_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149160.1|5499171_5499438_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980224.1|5499434_5500025_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001244670.1|5500017_5500305_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459294.1|5500297_5500753_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|5500888_5501209_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783684.1|5501223_5503557_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_044815386.1|5503912_5504107_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_001301682.1|5504324_5505152_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
5506104:5506119	attR	GTGCTGTTCATCGAAA	NA	NA	NA	NA
>prophage 1
NZ_CP015844	Escherichia coli O157:H7 strain FRIK2455 plasmid pO157, complete sequence	95598	831	63134	95598	integrase,transposase,protease	Stx2-converting_phage(26.67%)	58	NA	NA
WP_085948178.1|831_2044_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_077631973.1|2010_2091_+	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_000016989.1|2767_3574_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_001159868.1|3574_3880_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|3881_4100_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_010891291.1|4558_5242_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001248529.1|5238_5859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708307.1|5855_6056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361615.1|6463_7441_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_064261959.1|7725_8466_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.6	1.0e-23
WP_010891288.1|8586_8817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303402.1|9298_9493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001213545.1|9559_10999_-	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_000987091.1|11002_13123_-	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_000217739.1|13172_16169_-	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000839950.1|16170_16686_-	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000971918.1|18576_18978_-	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000096786.1|19069_19903_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_001004187.1|19960_20473_-	type II secretion system protein M	NA	NA	NA	NA	NA
WP_071525076.1|20459_21632_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000776550.1|21670_22648_-	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000082782.1|22644_23244_-	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000173396.1|23240_23588_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082929.1|23602_24157_-	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_001231211.1|24153_24588_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001173152.1|24618_25842_-	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_000092338.1|25843_27349_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001302177.1|27348_29316_-	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_001302175.1|29316_30192_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_072141201.1|30278_32975_-|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302181.1|33846_34845_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000550559.1|34918_36640_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000975743.1|36729_37836_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001302199.1|37835_38657_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_071525077.1|39258_39438_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001171554.1|40542_40923_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|40919_41267_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|41316_42855_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_071527313.1|42948_43122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001034097.1|43284_47187_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
WP_085950648.1|47306_47402_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.8e-07
WP_001172748.1|48412_48802_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000592771.1|48845_51056_-	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001302179.1|51232_51418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105064.1|52758_52965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421248.1|53059_53335_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001178089.1|53334_53619_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000130945.1|54529_55387_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001370046.1|55379_55454_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083831.1|55689_55944_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000766796.1|56183_56522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302200.1|56559_56769_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001233853.1|56814_57276_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
WP_001302189.1|57520_57733_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000840472.1|57865_58426_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704522.1|58528_59389_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000205762.1|59447_60194_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000998048.1|61595_63134_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
