The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014007	Kosakonia oryzae strain Ola 51 chromosome, complete genome	5303342	1304140	1370881	5303342	integrase,holin,tail,plate,tRNA	Escherichia_phage(24.39%)	70	1302072:1302088	1383446:1383462
1302072:1302088	attL	GGCGCTGAAAGAAGCGA	NA	NA	NA	NA
WP_007370710.1|1304140_1304908_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_012134695.1|1304952_1305300_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_071892616.1|1305456_1305648_-	late control protein B	NA	Q37973	Salmonella_virus	72.9	1.3e-20
WP_064564398.1|1305722_1306865_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	52.6	6.6e-107
WP_064564400.1|1306861_1307323_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	63.4	1.6e-48
WP_064564402.1|1307319_1309032_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	38.8	7.5e-30
WP_071777697.1|1309024_1309144_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	89.7	2.6e-14
WP_007370715.1|1309176_1309458_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	79.5	2.7e-30
WP_007370716.1|1309520_1310039_-|tail	phage major tail tube protein	tail	Q858V0	Yersinia_virus	90.1	4.5e-87
WP_064564404.1|1310051_1311233_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	88.0	2.1e-201
WP_064564406.1|1311361_1311955_-|tail	phage tail protein	tail	M1SV83	Escherichia_phage	49.2	7.8e-43
WP_064564408.1|1311954_1313031_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	49.3	9.6e-116
WP_064564410.1|1313228_1313825_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	58.4	5.2e-63
WP_064564412.1|1313824_1314880_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	47.7	5.3e-111
WP_064564414.1|1315034_1315985_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	76.7	5.4e-78
WP_064564416.1|1316139_1316748_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	76.5	3.1e-87
WP_064564418.1|1316740_1317649_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	78.8	2.2e-129
WP_007370726.1|1317653_1318001_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	73.0	2.8e-40
WP_035888404.1|1317997_1318633_-|plate	phage baseplate assembly protein V	plate	A0A0F7LDY9	Escherichia_phage	80.1	4.4e-92
WP_064564420.1|1318720_1319188_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	60.8	9.8e-49
WP_064564422.1|1319283_1319709_-	protein lysB	NA	A0A218M4K2	Erwinia_phage	54.6	3.9e-28
WP_064564424.1|1319705_1320215_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	76.8	7.8e-68
WP_064564426.1|1320198_1320420_-|holin	holin	holin	A0A218M4L5	Erwinia_phage	43.8	5.0e-11
WP_064564428.1|1320410_1320614_-|tail	tail protein X	tail	Q858W3	Yersinia_virus	68.2	1.6e-19
WP_035888419.1|1320812_1320998_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	55.7	6.0e-10
WP_082934081.1|1321085_1323044_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	71.9	2.7e-265
WP_064564430.1|1323044_1323266_-	hypothetical protein	NA	Q6K1F5	Salmonella_virus	69.0	1.2e-20
WP_064564432.1|1323265_1323493_-	DUF2732 family protein	NA	A0A218M4I9	Erwinia_phage	46.8	3.8e-06
WP_043952638.1|1323559_1323898_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	69.4	1.1e-38
WP_007370740.1|1323936_1324314_-	hypothetical protein	NA	A0A0M4R4X7	Salmonella_phage	69.2	6.0e-41
WP_064568968.1|1324429_1325278_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	61.9	9.6e-95
WP_064564434.1|1325284_1326334_+|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	73.6	1.5e-153
WP_064564436.1|1326495_1326933_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_064564438.1|1326995_1328360_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_064564440.1|1328540_1329611_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	4.8e-91
WP_064564442.1|1329620_1330742_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_064564444.1|1330809_1331682_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_064564446.1|1331678_1332839_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_007370750.1|1333086_1333425_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_043952646.1|1333689_1334427_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_064564448.1|1334558_1335539_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_064564452.1|1335535_1336267_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_064564454.1|1336396_1338970_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.9	8.4e-126
WP_064564456.1|1344701_1346000_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.7	1.8e-44
WP_064564458.1|1345996_1346320_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_064564460.1|1346365_1347721_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_064564463.1|1347834_1350495_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_064564465.1|1350527_1351226_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_007370763.1|1351295_1351715_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	41.5	2.0e-13
WP_064564467.1|1351921_1353019_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_064564469.1|1353063_1353753_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.4	6.0e-55
WP_007370766.1|1354065_1354449_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	3.1e-32
WP_064564471.1|1354491_1355820_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.4	1.3e-42
WP_064564473.1|1355949_1356687_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_064564475.1|1356671_1358294_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_007370770.1|1358714_1359290_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_064564477.1|1359321_1359975_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_064564479.1|1359974_1360928_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_007370773.1|1360924_1361404_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_043952662.1|1361549_1363349_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.2	7.2e-23
WP_064564481.1|1363364_1364339_+	signal peptidase I	NA	NA	NA	NA	NA
WP_007370776.1|1364551_1365232_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.5	1.3e-20
WP_064564483.1|1365228_1366140_+	GTPase Era	NA	NA	NA	NA	NA
WP_035888212.1|1366262_1366970_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_064564485.1|1367035_1367767_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_064564487.1|1367766_1368147_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_007370781.1|1368143_1368404_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
WP_007370782.1|1368460_1369309_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043952667.1|1369668_1370304_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_064564489.1|1370362_1370881_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.6	2.5e-05
1383446:1383462	attR	GGCGCTGAAAGAAGCGA	NA	NA	NA	NA
>prophage 2
NZ_CP014007	Kosakonia oryzae strain Ola 51 chromosome, complete genome	5303342	1551069	1622771	5303342	plate,holin	Tetraselmis_virus(16.67%)	55	NA	NA
WP_064564692.1|1551069_1552611_+|holin	choline-sulfatase	holin	A0A2P0VMN7	Tetraselmis_virus	22.4	2.7e-10
WP_064564694.1|1552613_1553558_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_064564696.1|1553854_1554943_+	YncE family protein	NA	NA	NA	NA	NA
WP_064564698.1|1554994_1557208_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_064564700.1|1557204_1558104_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064564702.1|1558200_1558725_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_007370964.1|1560410_1560671_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_064564703.1|1560958_1562899_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_064564705.1|1562913_1563300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064564707.1|1563446_1564844_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_064564709.1|1565050_1565920_+	EamA family transporter	NA	NA	NA	NA	NA
WP_064564711.1|1565908_1566706_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_064564713.1|1566771_1568190_-	MFS transporter	NA	NA	NA	NA	NA
WP_064564715.1|1568298_1569171_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064564717.1|1569145_1569532_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_043952805.1|1569521_1570112_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064564719.1|1570304_1571405_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_043952807.1|1571443_1571785_+	RamA family antibiotic efflux transcriptional regulator	NA	NA	NA	NA	NA
WP_064564721.1|1571824_1572217_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_064564722.1|1572218_1572578_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_064564724.1|1573199_1575389_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_007370980.1|1575432_1576620_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_064564726.1|1576974_1578213_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_043952812.1|1578290_1578611_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_064564728.1|1578733_1579732_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_064564730.1|1579913_1581557_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_064564732.1|1581560_1582796_-	ion channel protein	NA	NA	NA	NA	NA
WP_064564734.1|1582974_1583940_+	glucokinase	NA	NA	NA	NA	NA
WP_064564736.1|1583936_1584665_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.9	1.9e-14
WP_071892631.1|1584677_1586360_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_064564740.1|1586748_1587990_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099458783.1|1588039_1588111_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_064564742.1|1588680_1590204_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.1	1.7e-81
WP_139227903.1|1590299_1590941_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_064564746.1|1591527_1592025_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_064564748.1|1592058_1593606_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_064564750.1|1593624_1594974_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_064564752.1|1594970_1595696_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_064564754.1|1595695_1597372_+	OmpA family protein	NA	NA	NA	NA	NA
WP_043952827.1|1597386_1597878_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_064564756.1|1598047_1600687_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.9	6.0e-95
WP_064564758.1|1600738_1601554_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_064564760.1|1601625_1603983_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_064564762.1|1603994_1606406_+	hypothetical protein	NA	A0A059VA40	Pseudomonas_phage	33.3	3.7e-14
WP_064564764.1|1606402_1606810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071892638.1|1608599_1608863_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	50.0	2.8e-05
WP_064564768.1|1608866_1610027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064564770.1|1610052_1613433_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_064564772.1|1613434_1615045_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_064564774.1|1615099_1616869_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_064564776.1|1616832_1617912_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_064564778.1|1617933_1618458_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_082934140.1|1618469_1620941_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_064564780.1|1620940_1621810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064564784.1|1622321_1622771_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP014007	Kosakonia oryzae strain Ola 51 chromosome, complete genome	5303342	1815656	1824041	5303342	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_064565011.1|1815656_1816604_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	8.1e-10
WP_064565013.1|1816587_1817325_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_007371202.1|1817299_1817413_-	protein YohO	NA	NA	NA	NA	NA
WP_064565015.1|1817471_1818203_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	73.9	2.1e-82
WP_043956827.1|1818423_1820112_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.7	4.2e-259
WP_064565017.1|1820105_1820825_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_064565019.1|1820877_1821354_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	78.8	1.4e-63
WP_052502010.1|1821482_1821938_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	44.9	1.7e-29
WP_064565021.1|1822007_1824041_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.8	2.6e-53
>prophage 4
NZ_CP014007	Kosakonia oryzae strain Ola 51 chromosome, complete genome	5303342	1897771	1904126	5303342		Enterobacteria_phage(66.67%)	6	NA	NA
WP_064565115.1|1897771_1899187_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.2	2.4e-18
WP_007371272.1|1899373_1900267_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.2	1.3e-44
WP_064565118.1|1900667_1901750_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.6e-102
WP_064565120.1|1901752_1902652_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	33.4	2.8e-28
WP_064565122.1|1902696_1903575_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	9.6e-106
WP_064565124.1|1903577_1904126_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.4	1.6e-50
>prophage 5
NZ_CP014007	Kosakonia oryzae strain Ola 51 chromosome, complete genome	5303342	2030861	2071938	5303342	portal,holin,integrase,protease,tail,terminase,lysis	Enterobacteria_phage(32.43%)	46	2029140:2029199	2074531:2074592
2029140:2029199	attL	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC	NA	NA	NA	NA
WP_064568987.1|2030861_2031887_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.3	3.5e-91
WP_071892656.1|2031819_2032104_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_064565377.1|2032174_2034319_-	exonuclease	NA	S4TNL0	Salmonella_phage	41.2	6.2e-90
WP_064565380.1|2034459_2034816_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_007371408.1|2034850_2035036_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_064568988.1|2035302_2035800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_035886338.1|2036140_2036524_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	58.3	4.7e-17
WP_071892659.1|2036629_2036842_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	60.6	2.9e-16
WP_064565383.1|2036844_2037399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064565388.1|2037454_2038447_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	53.8	4.0e-92
WP_167351132.1|2038415_2038904_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.5	1.1e-66
WP_064565391.1|2039299_2042944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064565394.1|2043719_2043914_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	60.3	1.7e-15
WP_064565397.1|2043910_2044279_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.0	5.9e-41
WP_064565401.1|2044263_2045316_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.7	3.7e-104
WP_064565404.1|2045330_2045747_+	antitermination protein Q	NA	U5P0A5	Shigella_phage	73.3	4.0e-46
WP_139227910.1|2045983_2046424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007371424.1|2046709_2047033_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	78.3	1.5e-40
WP_064565410.1|2047016_2047457_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	74.5	1.5e-54
WP_064565413.1|2047453_2047921_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	62.6	1.4e-39
WP_064565416.1|2048006_2048375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064565418.1|2048473_2048692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007371428.1|2049160_2049649_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	87.0	4.3e-71
WP_064565421.1|2049648_2051757_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.8	0.0e+00
WP_064565424.1|2051753_2051969_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	78.6	3.4e-25
WP_064565427.1|2051965_2053468_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.4	1.5e-247
WP_071892668.1|2053412_2055425_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	77.6	6.5e-307
WP_064565432.1|2055505_2055829_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	54.3	3.2e-22
WP_007371434.1|2055821_2056097_+	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	53.8	2.0e-17
WP_064565435.1|2056106_2056658_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	75.5	9.4e-59
WP_064565438.1|2056654_2057053_+	hypothetical protein	NA	A0A0K2FIF4	Enterobacteria_phage	57.6	5.1e-38
WP_064565441.1|2057063_2057798_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	74.1	1.9e-75
WP_064565444.1|2057833_2058241_+|tail	phage minor tail protein G	tail	K7PJY4	Enterobacterial_phage	38.4	2.3e-14
WP_064565449.1|2058249_2058558_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	56.4	4.2e-24
WP_064565451.1|2058538_2061040_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	39.5	5.4e-146
WP_064565454.1|2061042_2061390_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	67.0	6.4e-37
WP_064565457.1|2061386_2062142_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	83.7	1.0e-124
WP_064565460.1|2062143_2062854_+	peptidase P60	NA	K7PJX1	Enterobacterial_phage	82.2	1.3e-121
WP_064565463.1|2062987_2063302_+	hypothetical protein	NA	M1PRT9	Cellulophaga_phage	68.9	6.2e-31
WP_064565465.1|2063364_2063964_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	77.9	1.5e-78
WP_064565468.1|2064015_2067204_+	host specificity protein J	NA	O64335	Escherichia_phage	83.0	0.0e+00
WP_064565471.1|2067551_2068223_+	hypothetical protein	NA	A0A1B2AP04	Escherichia_phage	71.4	5.1e-83
WP_064565474.1|2068331_2068568_+	hypothetical protein	NA	Q5G8V7	Enterobacteria_phage	55.7	1.4e-16
WP_082934142.1|2069708_2070113_+	hypothetical protein	NA	I7LEG3	Yersinia_phage	48.8	4.4e-29
WP_064565479.1|2070247_2070670_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.1	1.5e-35
WP_064565482.1|2070672_2071938_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	85.8	5.8e-213
2074531:2074592	attR	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGCCA	NA	NA	NA	NA
>prophage 6
NZ_CP014007	Kosakonia oryzae strain Ola 51 chromosome, complete genome	5303342	2283167	2350782	5303342	protease,plate	Tupanvirus(22.22%)	55	NA	NA
WP_043953290.1|2283167_2283737_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_043953291.1|2283739_2285611_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_064565773.1|2285607_2286651_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_064565775.1|2286695_2289308_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	31.0	1.1e-80
WP_064565777.1|2289334_2290774_+	protein kinase	NA	M1HXR9	Acanthocystis_turfacea_Chlorella_virus	27.3	3.6e-09
WP_167351167.1|2290863_2291304_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_064565781.1|2291362_2293288_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.7	6.4e-46
WP_064565783.1|2293300_2294107_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_064565785.1|2294099_2295431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064565787.1|2295430_2296501_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	41.6	2.1e-54
WP_139227916.1|2296582_2296804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064565791.1|2296923_2297310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064565795.1|2298022_2298286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064565796.1|2298371_2298629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043953302.1|2298924_2300574_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_064565798.1|2300625_2302137_-	anion permease	NA	NA	NA	NA	NA
WP_064565800.1|2302774_2305552_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.9	7.1e-70
WP_064565802.1|2305715_2306678_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_043953306.1|2306658_2307378_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_064565804.1|2307374_2308991_-	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_064565805.1|2309167_2310082_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_064565807.1|2310341_2312012_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_064565809.1|2312051_2313401_-	MFS transporter	NA	NA	NA	NA	NA
WP_064565811.1|2313810_2314509_+	glutamine amidotransferase	NA	A0A2K9L2L9	Tupanvirus	27.3	4.3e-08
WP_139227896.1|2314488_2314722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035888626.1|2314736_2315564_+	nitrogenase iron protein	NA	NA	NA	NA	NA
WP_064565813.1|2315608_2317180_+	nitrogenase iron-iron protein, alpha chain	NA	NA	NA	NA	NA
WP_064565815.1|2317176_2317521_+	Fe-only nitrogenase subunit delta	NA	NA	NA	NA	NA
WP_064565817.1|2317532_2318921_+	Fe-only nitrogenase subunit beta	NA	NA	NA	NA	NA
WP_064565819.1|2318964_2319387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064565821.1|2319383_2319878_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_064565823.1|2319890_2320502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082934145.1|2320672_2322277_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_064565826.1|2322772_2323576_+|protease	serine protease	protease	G9E4M4	Emiliania_huxleyi_virus	28.9	3.3e-12
WP_064565828.1|2323607_2325344_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_064565831.1|2325617_2327138_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_035888619.1|2327165_2328197_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	28.1	1.8e-34
WP_064565834.1|2328237_2329119_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_007371738.1|2329202_2329556_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043953322.1|2329594_2330605_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_064565836.1|2330683_2331664_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064565838.1|2331841_2332051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064565840.1|2332391_2334575_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_156525210.1|2334742_2335684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064565844.1|2336226_2336781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064565846.1|2337301_2339812_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	34.5	3.9e-83
WP_064565847.1|2339831_2343260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064565849.1|2343265_2343886_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_064565851.1|2343882_2345244_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_064565853.1|2345245_2345875_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_064565855.1|2345874_2346927_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_043953333.1|2346933_2347233_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_064565857.1|2347232_2347679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064565859.1|2347689_2349828_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_064565861.1|2349840_2350782_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 7
NZ_CP014007	Kosakonia oryzae strain Ola 51 chromosome, complete genome	5303342	3055245	3089846	5303342	integrase,holin,tail,plate,terminase,head,lysis	Pectobacterium_phage(66.67%)	41	3049493:3049507	3085766:3085780
3049493:3049507	attL	TCTGGCGGCAAAGCG	NA	NA	NA	NA
WP_064566881.1|3055245_3056331_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	54.6	2.2e-112
WP_064566883.1|3056803_3058360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064566886.1|3058714_3059056_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_064566888.1|3059040_3059508_-	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	33.1	4.0e-10
WP_064566890.1|3059651_3060326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064566892.1|3060329_3062390_-|tail	phage tail protein	tail	H9C1B7	Pectobacterium_phage	50.1	2.2e-169
WP_064566894.1|3062462_3064925_-	discoidin domain-containing protein	NA	H9C1B5	Pectobacterium_phage	51.9	2.1e-206
WP_064566896.1|3064926_3065829_-	DUF2612 domain-containing protein	NA	H9C1B4	Pectobacterium_phage	66.3	1.3e-105
WP_064566897.1|3065815_3067030_-|plate	phage baseplate protein	plate	H9C1B3	Pectobacterium_phage	72.6	1.2e-162
WP_064566899.1|3067029_3067380_-	hypothetical protein	NA	H9C1B2	Pectobacterium_phage	80.2	5.1e-50
WP_082934104.1|3067441_3068044_-	hypothetical protein	NA	H9C1B1	Pectobacterium_phage	66.1	3.6e-80
WP_064566903.1|3068040_3068931_-	hypothetical protein	NA	H9C1B0	Pectobacterium_phage	79.7	4.3e-146
WP_007374712.1|3068923_3069214_-	hypothetical protein	NA	H9C1A9	Pectobacterium_phage	78.1	9.7e-39
WP_064566905.1|3069210_3069855_-	hypothetical protein	NA	H9C1A8	Pectobacterium_phage	73.4	6.6e-72
WP_064566908.1|3069857_3071555_-	glycoside hydrolase family 104 protein	NA	H9C1A7	Pectobacterium_phage	60.4	4.3e-179
WP_064566910.1|3071817_3072204_-	hypothetical protein	NA	H9C1A4	Pectobacterium_phage	65.0	3.4e-39
WP_007374705.1|3072203_3072608_-	hypothetical protein	NA	H9C1A3	Pectobacterium_phage	95.5	5.8e-66
WP_064566911.1|3072614_3073769_-	DUF3383 family protein	NA	H9C1A2	Pectobacterium_phage	87.2	1.5e-194
WP_064566913.1|3073777_3074302_-	hypothetical protein	NA	H9C1A1	Pectobacterium_phage	83.3	9.8e-82
WP_064566915.1|3074301_3074721_-	hypothetical protein	NA	H9C1A0	Pectobacterium_phage	85.0	1.5e-69
WP_064566917.1|3074723_3075191_-	hypothetical protein	NA	H9C199	Pectobacterium_phage	80.6	2.8e-64
WP_082934105.1|3075187_3075610_-	DUF4054 domain-containing protein	NA	H9C198	Pectobacterium_phage	88.6	5.1e-65
WP_064566921.1|3075639_3075993_-	hypothetical protein	NA	H9C197	Pectobacterium_phage	45.1	3.2e-20
WP_007374698.1|3075995_3076946_-	DUF2184 domain-containing protein	NA	H9C196	Pectobacterium_phage	84.4	6.2e-151
WP_064566922.1|3076960_3077479_-	hypothetical protein	NA	H9C195	Pectobacterium_phage	66.7	1.6e-52
WP_064566924.1|3077478_3078678_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	82.5	3.6e-148
WP_064566926.1|3078696_3079446_-|head	phage head morphogenesis protein	head	H9C193	Pectobacterium_phage	73.9	1.3e-98
WP_064566927.1|3079495_3080887_-	DUF1073 domain-containing protein	NA	H9C192	Pectobacterium_phage	78.2	1.7e-213
WP_064566929.1|3080889_3082530_-|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	89.7	3.2e-304
WP_064566931.1|3082762_3083794_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	41.6	4.0e-34
WP_064566933.1|3083913_3084351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139227883.1|3084485_3084809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167351168.1|3084835_3085300_-|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	73.6	7.2e-52
WP_139227882.1|3085308_3085752_-	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	76.5	3.0e-55
WP_007371424.1|3085732_3086056_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	78.3	1.5e-40
3085766:3085780	attR	TCTGGCGGCAAAGCG	NA	NA	NA	NA
WP_064566937.1|3086401_3087463_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	81.2	1.2e-171
WP_071892703.1|3087612_3087804_-	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	69.8	6.2e-18
WP_064566940.1|3087973_3088660_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.0	5.1e-62
WP_064566942.1|3088763_3089057_-	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	74.0	1.8e-37
WP_139227900.1|3089049_3089250_-	hypothetical protein	NA	K7PJT9	Enterobacteria_phage	70.2	2.5e-14
WP_139227881.1|3089249_3089846_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	83.4	5.3e-92
>prophage 8
NZ_CP014007	Kosakonia oryzae strain Ola 51 chromosome, complete genome	5303342	3100270	3108650	5303342	transposase	Salmonella_phage(28.57%)	10	NA	NA
WP_064566968.1|3100270_3100558_+	hypothetical protein	NA	H6WRX2	Salmonella_phage	57.9	9.9e-28
WP_064566970.1|3100690_3103624_+	exodeoxyribonuclease	NA	K7PJT5	Enterobacteria_phage	54.7	2.9e-263
WP_064566972.1|3103633_3104713_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	52.8	9.7e-100
WP_064566974.1|3104753_3104933_+	hypothetical protein	NA	G8C7S7	Escherichia_phage	65.3	5.8e-10
WP_064566976.1|3104919_3105183_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	70.7	1.7e-21
WP_007374662.1|3105281_3105536_+	pyocin activator PrtN family protein	NA	A0A1W6JP35	Morganella_phage	54.8	1.3e-18
WP_064566978.1|3106068_3107004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064566979.1|3107003_3107447_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_064566981.1|3107669_3107957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064566984.1|3108191_3108650_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	1.0e-13
>prophage 9
NZ_CP014007	Kosakonia oryzae strain Ola 51 chromosome, complete genome	5303342	3945323	3953455	5303342		uncultured_Caudovirales_phage(33.33%)	11	NA	NA
WP_064568049.1|3945323_3945578_+	DUF1471 domain-containing protein	NA	A0A1B2IB27	Erwinia_phage	50.9	2.7e-05
WP_043954418.1|3945684_3946041_+	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	36.9	2.4e-07
WP_156525217.1|3946336_3946507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064568051.1|3946908_3948036_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	51.1	1.9e-98
WP_064568053.1|3948245_3948500_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	47.3	2.1e-05
WP_064568054.1|3948585_3949011_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.5e-51
WP_064568055.1|3949023_3950313_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.8	4.2e-166
WP_064568057.1|3950356_3950677_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	54.9	5.9e-21
WP_064569061.1|3950855_3952262_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_007373715.1|3952273_3952966_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	5.5e-32
WP_043954427.1|3953122_3953455_-	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	29.5	4.7e-05
