The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015966	Lactiplantibacillus plantarum strain LZ206 chromosome, complete genome	3212951	294015	350538	3212951	terminase,portal,transposase,integrase,capsid	Lactobacillus_phage(40.0%)	60	326823:326840	336596:336613
WP_086989537.1|294015_294791_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_027822673.1|295004_296195_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_064522715.1|296418_296649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642742.1|296674_296896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380658.1|297042_297507_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015380657.1|297728_298622_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_015380656.1|298688_299552_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003642746.1|300113_300278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642747.1|300336_301080_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_064522716.1|301185_302373_+	MFS transporter	NA	NA	NA	NA	NA
WP_003644671.1|302586_302904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642750.1|302979_303540_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_064522717.1|304295_305234_-	EamA family transporter	NA	NA	NA	NA	NA
WP_015380652.1|305430_305700_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003642754.1|305709_307053_+	PFL family protein	NA	NA	NA	NA	NA
WP_003646617.1|307425_308154_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.1	2.1e-34
WP_003642756.1|308150_309674_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011101808.1|309969_311151_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	29.9	3.9e-46
WP_003642758.1|311385_312243_+	GRP family sugar transporter	NA	NA	NA	NA	NA
WP_064522719.1|312463_313816_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_064522721.1|314241_314448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064522722.1|314835_316830_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.3	7.2e-32
WP_003642762.1|316847_318425_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_015380648.1|318396_320160_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	40.9	4.8e-96
WP_003639252.1|321100_321244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101805.1|321602_321746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064522725.1|322433_325367_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003642770.1|325466_327443_+	hypothetical protein	NA	NA	NA	NA	NA
326823:326840	attL	AATGCTGATAAGCAGATT	NA	NA	NA	NA
WP_003642771.1|327497_327983_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015380646.1|328030_328303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642773.1|328327_328561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380645.1|328973_329180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064522727.1|329530_330652_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.4	9.9e-47
WP_064522729.1|330900_332094_-	hypothetical protein	NA	A0A141E0C6	Streptococcus_phage	25.9	5.4e-19
WP_080444026.1|332255_332432_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	51.7	3.3e-10
WP_063489221.1|332713_333415_-	DUF3862 domain-containing protein	NA	A0A0P0IXE0	Lactobacillus_phage	80.8	2.0e-05
WP_003642782.1|333522_333777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053566834.1|333786_334578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120787351.1|335049_335748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162936253.1|335932_336856_-	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
336596:336613	attR	AATCTGCTTATCAGCATT	NA	NA	NA	NA
WP_063204181.1|336956_337379_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_064522735.1|337393_337912_-	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	34.1	1.6e-15
WP_064522737.1|338053_338242_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_187337861.1|338383_339136_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	50.2	3.8e-71
WP_064522741.1|339216_340125_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_003642800.1|340121_340409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380627.1|340405_340924_+	hypothetical protein	NA	O03915	Lactobacillus_phage	68.4	3.5e-55
WP_013355743.1|340920_341301_+	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_003642805.1|341511_341973_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
WP_015380625.1|342237_342855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380624.1|343750_343948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072533559.1|343925_344102_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	57.4	9.1e-08
WP_064522742.1|344070_344328_+	hypothetical protein	NA	A0A0N9SKC5	Staphylococcus_phage	47.6	1.3e-15
WP_064522744.1|344381_344921_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	75.3	1.0e-49
WP_064522746.1|344901_346227_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1S5SA45	Streptococcus_phage	55.7	4.5e-139
WP_129075458.1|346229_347825_+|portal	phage portal protein	portal	B5LPR1	Bacillus_virus	37.8	9.0e-86
WP_129075459.1|347805_348012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064522752.1|348044_348902_+	hypothetical protein	NA	A0A1B1P858	Bacillus_phage	35.3	2.1e-36
WP_064522753.1|348965_349577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064522755.1|349590_350538_+|capsid	N4-gp56 family major capsid protein	capsid	A8ASJ6	Listeria_phage	59.1	4.4e-88
>prophage 2
NZ_CP015966	Lactiplantibacillus plantarum strain LZ206 chromosome, complete genome	3212951	360910	368542	3212951	tail,holin,plate	Lactobacillus_phage(66.67%)	10	NA	NA
WP_064522772.1|360910_362038_+|tail	phage tail protein	tail	O03938	Lactobacillus_phage	42.0	3.1e-72
WP_064522774.1|362030_362279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064522776.1|362253_362607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064523719.1|363103_363907_+	SGNH/GDSL hydrolase family protein	NA	Q597U1	Lactobacillus_virus	84.3	1.4e-127
WP_064522778.1|363920_364475_+|plate	phage baseplate upper protein	plate	O03968	Lactobacillus_phage	61.8	4.9e-55
WP_129075460.1|364501_366307_+	hypothetical protein	NA	Q597U3	Lactobacillus_virus	54.0	1.3e-184
WP_064522782.1|366318_366588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080475200.1|366580_366712_+	XkdX family protein	NA	NA	NA	NA	NA
WP_015380597.1|367881_368178_+	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	77.6	1.2e-39
WP_064522784.1|368164_368542_+|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	77.5	4.1e-21
>prophage 3
NZ_CP015966	Lactiplantibacillus plantarum strain LZ206 chromosome, complete genome	3212951	658839	695539	3212951	terminase,portal,tail,protease,head,capsid	Lactobacillus_phage(92.68%)	47	NA	NA
WP_043992828.1|658839_659040_-	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	97.0	5.5e-25
WP_015380507.1|659221_659920_-	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	36.8	2.1e-18
WP_027822123.1|659928_660315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015380505.1|660372_660651_-	hypothetical protein	NA	D2KRD5	Lactobacillus_phage	59.3	1.3e-21
WP_043992826.1|660660_660999_-	helix-turn-helix transcriptional regulator	NA	Q8W5Y0	Listeria_phage	42.2	1.0e-15
WP_015380504.1|661244_661466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043992824.1|661480_662179_+	Rha family transcriptional regulator	NA	D2IYT0	Enterococcus_phage	62.2	6.7e-70
WP_064522839.1|662190_662400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380501.1|662515_662842_-	hypothetical protein	NA	E9LUT2	Lactobacillus_phage	98.1	2.7e-53
WP_015380500.1|662899_663160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380499.1|663302_663551_+	hypothetical protein	NA	E9LUT6	Lactobacillus_phage	84.1	1.9e-35
WP_015380498.1|663553_663754_+	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	89.4	1.7e-26
WP_043992823.1|663765_663990_+	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	86.3	1.2e-28
WP_162936256.1|664038_664209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043992822.1|664208_664466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380497.1|664570_665374_+	hypothetical protein	NA	E9LUM6	Lactobacillus_phage	56.9	6.4e-40
WP_043992819.1|665367_666243_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	41.6	2.2e-49
WP_064522840.1|666705_667017_+	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	87.4	3.0e-46
WP_162936257.1|667127_667718_+	hypothetical protein	NA	E9LUN9	Lactobacillus_phage	94.2	5.2e-63
WP_043992815.1|667978_668380_+	hypothetical protein	NA	K4I239	Lactobacillus_phage	54.5	5.5e-32
WP_015380491.1|668452_668878_+	DUF1642 domain-containing protein	NA	E9LUP3	Lactobacillus_phage	61.7	2.2e-39
WP_064522842.1|668880_669330_+	hypothetical protein	NA	A0A2K9VC44	Lactobacillus_phage	65.3	1.1e-41
WP_015380489.1|669380_669809_+	phage transcriptional activator RinA	NA	E9LUP5	Lactobacillus_phage	86.5	1.1e-65
WP_015380487.1|670142_670322_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	86.4	3.1e-19
WP_015380486.1|670332_670800_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	91.5	2.0e-78
WP_064522844.1|670996_671452_+|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	97.4	9.4e-81
WP_015380483.1|673348_673543_+	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	93.8	3.7e-26
WP_015380482.1|673545_674739_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	98.7	3.1e-224
WP_015380481.1|674716_675472_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	93.2	3.9e-124
WP_015380480.1|675471_676704_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	94.1	4.3e-213
WP_015380479.1|676776_677115_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	91.1	5.8e-51
WP_015380478.1|677098_677461_+|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	97.5	6.4e-64
WP_015380477.1|677450_677891_+	hypothetical protein	NA	E9LUQ6	Lactobacillus_phage	97.9	4.2e-78
WP_015380476.1|677887_678271_+	DUF806 family protein	NA	E9LUQ7	Lactobacillus_phage	96.9	1.0e-64
WP_015380475.1|678271_678910_+|tail	phage tail protein	tail	E9LUQ8	Lactobacillus_phage	93.9	1.4e-109
WP_015380474.1|679111_679495_+	hypothetical protein	NA	E9LUQ9	Lactobacillus_phage	99.2	2.0e-63
WP_015380473.1|679491_679683_+	hypothetical protein	NA	E9LUR0	Lactobacillus_phage	98.4	1.5e-27
WP_064522846.1|679695_684918_+	hypothetical protein	NA	E9LUR1	Lactobacillus_phage	76.9	0.0e+00
WP_015380471.1|684989_686762_+|tail	phage tail family protein	tail	E9LUR2	Lactobacillus_phage	96.6	0.0e+00
WP_064522848.1|686828_689198_+|tail	phage tail protein	tail	E9LUR3	Lactobacillus_phage	92.9	0.0e+00
WP_064522850.1|689214_692013_+	hypothetical protein	NA	E9LUR4	Lactobacillus_phage	73.2	3.1e-222
WP_015380468.1|692005_692248_+	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	92.5	6.2e-31
WP_015380467.1|692251_692413_+	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	94.3	8.9e-18
WP_015380465.1|693489_693702_+	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	80.3	2.0e-17
WP_015380464.1|693713_694892_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	89.0	6.9e-200
WP_003644510.1|694891_695155_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_015380463.1|695164_695539_+	nitrate/sulfonate/bicarbonate ABC transporter permease	NA	A0A2K9VCG4	Lactobacillus_phage	76.2	2.6e-20
>prophage 4
NZ_CP015966	Lactiplantibacillus plantarum strain LZ206 chromosome, complete genome	3212951	1651924	1720633	3212951	protease,transposase,integrase,bacteriocin,tRNA	Lactobacillus_phage(26.67%)	57	1689985:1690006	1692819:1692840
WP_021357097.1|1651924_1652254_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_015379975.1|1652389_1653718_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_015379974.1|1653866_1654760_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043992670.1|1654908_1655886_+	hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	32.3	2.1e-32
WP_015379972.1|1655900_1657298_+	anion permease	NA	NA	NA	NA	NA
WP_086989537.1|1657600_1658376_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_064523109.1|1658709_1660044_-	gluconate permease	NA	NA	NA	NA	NA
WP_015379970.1|1660293_1661508_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	33.8	2.5e-48
WP_015379969.1|1661523_1662666_+	lactonase family protein	NA	NA	NA	NA	NA
WP_015379968.1|1662758_1663427_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_016526995.1|1663558_1664128_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003641207.1|1664178_1664943_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_080125228.1|1664939_1666190_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_064523112.1|1666153_1667155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379964.1|1667574_1668357_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003641203.1|1668691_1669018_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015379963.1|1669209_1670091_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_015379962.1|1670133_1671942_-	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.1	1.0e-77
WP_003641200.1|1672199_1672397_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003644064.1|1672616_1672883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064523115.1|1672933_1674166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015379960.1|1674201_1675608_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_015379959.1|1676059_1677067_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.0	1.4e-63
WP_064523118.1|1677105_1678401_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.2	7.1e-57
WP_043992667.1|1678461_1679079_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_064523121.1|1679187_1679661_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064523124.1|1679936_1681826_-	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	26.2	5.2e-16
WP_003645746.1|1682012_1682939_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.8	3.2e-19
WP_015379952.1|1683009_1683561_-	helix-turn-helix domain-containing protein	NA	X2CXD8	Lactobacillus_phage	48.4	8.4e-07
WP_015379951.1|1683660_1684413_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003645748.1|1685062_1685182_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_053267329.1|1689074_1689605_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_080125226.1|1689918_1690152_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
1689985:1690006	attL	CTCATTGGCAGCGATAAGGTTA	NA	NA	NA	NA
WP_120787327.1|1690118_1690523_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_080125224.1|1690527_1691109_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_015379944.1|1691119_1692037_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	44.7	2.7e-74
WP_003645758.1|1698076_1700611_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.4	3.5e-68
1692819:1692840	attR	CTCATTGGCAGCGATAAGGTTA	NA	NA	NA	NA
WP_003644050.1|1700792_1701365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064523127.1|1701470_1701803_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_064523130.1|1702164_1703175_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_064523133.1|1703306_1704107_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_003641176.1|1704310_1704751_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003644046.1|1704811_1705234_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003641174.1|1705248_1705431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644045.1|1705443_1705989_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003641172.1|1706000_1706255_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003645763.1|1706495_1708343_-	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.7	5.8e-20
WP_003645764.1|1708332_1708716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379937.1|1709200_1711708_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_064523137.1|1711981_1713280_+	MFS transporter	NA	NA	NA	NA	NA
WP_015640093.1|1713356_1714232_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	28.9	2.8e-20
WP_003645768.1|1714240_1714948_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003645769.1|1715103_1715448_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064523140.1|1715667_1716351_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641165.1|1716916_1717285_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	42.7	5.9e-17
WP_015379932.1|1717518_1717887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004271307.1|1719709_1720633_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.7e-33
>prophage 5
NZ_CP015966	Lactiplantibacillus plantarum strain LZ206 chromosome, complete genome	3212951	1943863	2050980	3212951	terminase,tail,portal,tRNA,protease,transposase,integrase,capsid,lysis	Lactobacillus_phage(75.93%)	99	2010933:2010948	2019032:2019047
WP_015379855.1|1943863_1945276_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.0	3.1e-45
WP_003640932.1|1945553_1947044_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003640931.1|1947369_1948545_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_003643928.1|1948560_1949940_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_003640928.1|1951066_1951603_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	45.8	2.4e-35
WP_003640927.1|1951741_1952038_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_015379853.1|1952046_1952730_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_003643927.1|1952805_1954137_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.3	5.4e-68
WP_080475214.1|1954042_1955812_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.0	1.2e-91
WP_031263579.1|1956098_1956791_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003644979.1|1957209_1957887_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_015379850.1|1958036_1959062_-	EamA family transporter	NA	NA	NA	NA	NA
WP_003643925.1|1959494_1960457_-	AEC family transporter	NA	NA	NA	NA	NA
WP_003640920.1|1960766_1961960_+	LCP family protein	NA	NA	NA	NA	NA
WP_003640919.1|1962027_1962801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064523239.1|1962793_1963597_-	acetyl-CoA carboxyl transferase	NA	NA	NA	NA	NA
WP_015379847.1|1963593_1964916_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_003640916.1|1964918_1965320_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003640915.1|1965330_1966302_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003640914.1|1966465_1966984_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_064523241.1|1966980_1967400_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_064523245.1|1967470_1970320_-	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_003640911.1|1970626_1971013_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_015379845.1|1971141_1972074_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_015379844.1|1972092_1972902_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_015379843.1|1972937_1973912_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_021357534.1|1974202_1975057_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_064523247.1|1975484_1976417_-	lysin	NA	A0A2P0ZLG2	Lactobacillus_phage	92.3	6.9e-171
WP_064523250.1|1976416_1976701_-|lysis	lysis protein	lysis	A0A2P0ZLE8	Lactobacillus_phage	97.9	4.1e-42
WP_064523253.1|1976700_1976910_-	hypothetical protein	NA	A0A2P0ZLG4	Lactobacillus_phage	58.0	9.8e-09
WP_064523256.1|1976915_1977296_-	hypothetical protein	NA	A0A2P0ZLF7	Lactobacillus_phage	76.0	3.2e-50
WP_064523259.1|1977312_1977747_-	hypothetical protein	NA	A0A2P0ZLE9	Lactobacillus_phage	79.9	9.7e-59
WP_064523262.1|1977748_1978240_-	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	62.5	2.8e-46
WP_080475215.1|1978263_1983129_-	hypothetical protein	NA	A0A2P0ZLE1	Lactobacillus_phage	52.0	0.0e+00
WP_063486813.1|1983148_1983970_-|tail	phage tail family protein	tail	A0A2P0ZLE2	Lactobacillus_phage	95.6	1.3e-149
WP_064523264.1|1983973_1988566_-|tail	phage tail tape measure protein	tail	A0A2P0ZLF1	Lactobacillus_phage	78.6	0.0e+00
WP_021731063.1|1988829_1989144_-	hypothetical protein	NA	A0A2P0ZLF3	Lactobacillus_phage	96.2	2.4e-51
WP_021731062.1|1989237_1989849_-|tail	major tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	96.1	9.6e-105
WP_064523268.1|1989863_1990286_-	hypothetical protein	NA	A0A2P0ZLE4	Lactobacillus_phage	97.9	2.8e-71
WP_021357103.1|1990282_1990690_-	HK97 gp10 family phage protein	NA	A0A2P0ZLD7	Lactobacillus_phage	93.3	1.0e-65
WP_050339980.1|1990686_1991076_-	hypothetical protein	NA	A0A2P0ZLD1	Lactobacillus_phage	90.7	1.5e-63
WP_050339979.1|1991056_1991362_-	hypothetical protein	NA	A0A2P0ZLD5	Lactobacillus_phage	95.0	1.2e-47
WP_050339978.1|1991500_1992673_-|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	54.5	6.6e-110
WP_021730266.1|1992695_1993418_-|protease	Clp protease ClpP	protease	A0A2P0ZLE3	Lactobacillus_phage	75.4	9.7e-96
WP_050339977.1|1993404_1994547_-|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	97.6	4.0e-213
WP_064523270.1|1994565_1996245_-|terminase	terminase large subunit	terminase	A0A2P0ZLE5	Lactobacillus_phage	98.0	0.0e+00
WP_062688238.1|1996637_1996880_-	hypothetical protein	NA	A0A2P0ZLD2	Lactobacillus_phage	100.0	5.6e-40
WP_064523273.1|1996897_1997140_-	hypothetical protein	NA	A0A2P0ZLD3	Lactobacillus_phage	83.8	8.6e-33
WP_064523278.1|1997139_1997478_-	HNH endonuclease	NA	A0A2P0ZLC6	Lactobacillus_phage	96.4	2.8e-61
WP_064523281.1|1997461_1997698_-	hypothetical protein	NA	A0A2P0ZLC2	Lactobacillus_phage	72.9	1.8e-19
WP_064523284.1|1998081_1999353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024971547.1|1999368_2000238_-	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	51.4	8.9e-80
WP_064523287.1|2000573_2001005_-	hypothetical protein	NA	A0A2P0ZLC0	Lactobacillus_phage	93.4	2.5e-67
WP_064523290.1|2001016_2001325_-	hypothetical protein	NA	A0A2P0ZLD0	Lactobacillus_phage	90.1	1.7e-46
WP_080475236.1|2001456_2001942_-	adenine methyltransferase	NA	A0A2P0ZL79	Lactobacillus_phage	93.8	2.1e-78
WP_064523296.1|2002009_2002501_-	methyltransferase domain-containing protein	NA	O03918	Lactobacillus_phage	89.9	5.8e-84
WP_064523302.1|2003077_2003419_-	VRR-NUC domain-containing protein	NA	A0A2P0ZLB6	Lactobacillus_phage	95.6	1.5e-59
WP_064523305.1|2003673_2004939_-	helicase	NA	A0A2P0ZLC4	Lactobacillus_phage	94.1	5.8e-229
WP_064523308.1|2004935_2005730_-	bifunctional DNA primase/polymerase	NA	A0A2P0ZLB0	Lactobacillus_phage	92.0	2.1e-136
WP_064523311.1|2005800_2006433_-	hypothetical protein	NA	A0A2P0ZLB9	Lactobacillus_phage	97.3	4.6e-102
WP_064523314.1|2006435_2007152_-	AAA family ATPase	NA	A0A2P0ZLB2	Lactobacillus_phage	97.7	1.5e-112
WP_064523317.1|2007148_2008408_-	DEAD/DEAH box helicase family protein	NA	A0A2P0ZLA5	Lactobacillus_phage	96.7	8.0e-231
WP_064523319.1|2008559_2009039_-	siphovirus Gp157 family protein	NA	A0A2P0ZLB3	Lactobacillus_phage	89.9	1.8e-77
WP_064523322.1|2009309_2009540_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_162936243.1|2009532_2009697_-	hypothetical protein	NA	A0A2P0ZLA3	Lactobacillus_phage	96.2	1.0e-24
WP_162936244.1|2009689_2009866_-	hypothetical protein	NA	A0A2P0ZLB1	Lactobacillus_phage	89.7	1.4e-24
WP_064523325.1|2009846_2010128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021357721.1|2010265_2010538_-	hypothetical protein	NA	A0A2P0ZLA9	Lactobacillus_phage	100.0	1.2e-43
WP_064523328.1|2010537_2010741_-	hypothetical protein	NA	A0A2P0ZLA4	Lactobacillus_phage	98.5	1.5e-30
WP_064523331.1|2010812_2011301_+	DUF2321 domain-containing protein	NA	Q6SEF3	Lactobacillus_prophage	43.5	2.7e-33
2010933:2010948	attL	TGCCCAAAATGTGATT	NA	NA	NA	NA
WP_064523334.1|2011428_2011638_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064523337.1|2011889_2012297_+	helix-turn-helix transcriptional regulator	NA	Q9T1J3	Lactobacillus_phage	36.0	1.2e-10
WP_064523340.1|2012306_2012780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063486788.1|2012870_2013551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064523346.1|2014280_2015438_+|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	98.2	3.6e-217
WP_015379841.1|2015728_2016604_-	homoserine kinase	NA	NA	NA	NA	NA
WP_003640905.1|2016612_2017899_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_015379840.1|2017964_2018411_-	SprT family protein	NA	NA	NA	NA	NA
WP_054519103.1|2018410_2020582_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
2019032:2019047	attR	AATCACATTTTGGGCA	NA	NA	NA	NA
WP_003640902.1|2020875_2021310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031263668.1|2021364_2024019_-	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	28.9	6.8e-70
WP_003640900.1|2024474_2025302_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.0	6.5e-72
WP_003640899.1|2025301_2026780_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.1	2.5e-106
WP_013355215.1|2026936_2027674_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_003640897.1|2027843_2028545_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003644997.1|2028568_2029705_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003640895.1|2029783_2030575_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	36.1	3.5e-30
WP_003640894.1|2030935_2031757_+	nicotinamide mononucleotide transporter	NA	A0A2K9VCL6	Lactobacillus_phage	42.2	3.3e-52
WP_003640893.1|2031949_2033056_+	anion permease	NA	NA	NA	NA	NA
WP_015379837.1|2033214_2034057_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_064523349.1|2034091_2034427_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024971775.1|2034457_2034982_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003640889.1|2035162_2035621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003640888.1|2036179_2037022_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003643855.1|2037076_2038549_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.3	2.1e-68
WP_003642090.1|2045096_2046596_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.5	1.6e-89
WP_003642089.1|2046699_2047707_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003642088.1|2047706_2048594_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_003643854.1|2048742_2050980_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	47.8	6.0e-104
>prophage 6
NZ_CP015966	Lactiplantibacillus plantarum strain LZ206 chromosome, complete genome	3212951	2100895	2199013	3212951	protease,transposase,bacteriocin,tRNA	uncultured_Mediterranean_phage(16.67%)	93	NA	NA
WP_015379813.1|2100895_2102167_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.7	4.5e-96
WP_003642042.1|2102633_2104247_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_003642041.1|2104419_2105028_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_064523373.1|2105072_2105513_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_024971479.1|2105875_2106808_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_187291423.1|2106816_2108175_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
WP_015379810.1|2108194_2109004_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_043992605.1|2109173_2110160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379808.1|2110242_2111265_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003643830.1|2111553_2112534_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_064523377.1|2112899_2113724_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003646504.1|2113959_2115342_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.2	5.7e-28
WP_003642030.1|2115410_2116247_-	pur operon repressor	NA	NA	NA	NA	NA
WP_003642029.1|2116739_2117003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003646503.1|2117017_2117560_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_003646500.1|2118740_2119538_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003642023.1|2119530_2120229_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_015379805.1|2120496_2121441_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_015379804.1|2121750_2122617_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003642020.1|2122749_2123001_-	Veg family protein	NA	NA	NA	NA	NA
WP_003642019.1|2123105_2123996_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003643826.1|2123992_2124556_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_003643825.1|2124542_2125319_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_086989537.1|2125703_2126479_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_064523380.1|2126503_2126914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043992601.1|2127476_2128367_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015379798.1|2128400_2129585_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_015379797.1|2129914_2130241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064523384.1|2130719_2132771_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
WP_015379795.1|2133092_2133482_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_015379793.1|2134076_2134919_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003642011.1|2134918_2135623_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_003642010.1|2135644_2136604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642009.1|2136596_2137871_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642008.1|2137916_2138834_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_043992598.1|2139233_2140247_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_015379789.1|2140359_2141106_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003642003.1|2141255_2142152_-	ROK family protein	NA	NA	NA	NA	NA
WP_003642002.1|2142272_2143709_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
WP_043992963.1|2143726_2145082_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642000.1|2145304_2145727_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003641999.1|2145716_2145905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379786.1|2145911_2147273_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641997.1|2147345_2148056_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043992597.1|2148461_2149478_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_064523387.1|2149911_2150688_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_064523390.1|2150946_2153256_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027821496.1|2153350_2153554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379782.1|2153691_2154378_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015379781.1|2154471_2155152_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015379780.1|2155238_2155907_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015379779.1|2155974_2156664_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_064523393.1|2156750_2158130_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004271307.1|2160581_2161505_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.7e-33
WP_015379774.1|2161704_2162880_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_015379773.1|2162911_2163463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643807.1|2163476_2163626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379772.1|2163757_2164504_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015379769.1|2165610_2165778_+|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnJ	bacteriocin	NA	NA	NA	NA
WP_003641972.1|2165808_2165982_+|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnK	bacteriocin	NA	NA	NA	NA
WP_003643805.1|2165978_2166647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641969.1|2167058_2167262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064523765.1|2167466_2167982_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_120787350.1|2168137_2168341_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080125207.1|2168447_2168759_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_050495850.1|2169220_2169409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643800.1|2169420_2169564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011100995.1|2170225_2171410_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_064523396.1|2171454_2172831_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_003641966.1|2173358_2174174_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_015379762.1|2174333_2175206_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015825116.1|2175276_2176068_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003646460.1|2176071_2177226_+	MFS transporter	NA	NA	NA	NA	NA
WP_015379760.1|2177229_2177847_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003641945.1|2178042_2178765_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_003643774.1|2178779_2180609_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_064523399.1|2180623_2182141_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_043992584.1|2182606_2183938_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003641941.1|2184015_2184987_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_003643770.1|2184987_2186514_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_064523403.1|2186751_2187099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064523406.1|2187270_2189151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064523408.1|2189590_2190490_-	oxidoreductase	NA	NA	NA	NA	NA
WP_003646441.1|2190626_2191547_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_003641936.1|2191712_2192285_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003641935.1|2192388_2192844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641934.1|2192862_2193333_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_064523413.1|2193442_2194639_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|2194669_2195179_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003643763.1|2195291_2195660_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_015379750.1|2195924_2197430_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_015379749.1|2197587_2198256_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_015379748.1|2198449_2199013_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP015966	Lactiplantibacillus plantarum strain LZ206 chromosome, complete genome	3212951	2844651	2854019	3212951	bacteriocin	Planktothrix_phage(16.67%)	7	NA	NA
WP_080475227.1|2844651_2846673_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	3.5e-18
WP_003645478.1|2846765_2847737_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.2	1.8e-137
WP_015381012.1|2847785_2849075_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.0	3.5e-72
WP_003645480.1|2849391_2850690_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	3.8e-18
WP_021357419.1|2850912_2851242_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_015381010.1|2851436_2852771_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	7.9e-27
WP_054519129.1|2852906_2854019_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.3	1.3e-35
