The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015857	Lactiplantibacillus plantarum strain LZ227 chromosome, complete genome	3131750	80817	89328	3131750		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645861.1|80817_81300_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
WP_027822323.1|81283_82414_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003642587.1|82416_83148_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_003642588.1|83149_83404_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_015380736.1|83403_84084_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_021356102.1|84076_86296_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.1	3.5e-144
WP_027822324.1|86280_87735_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.8	7.3e-50
WP_015380733.1|87731_88757_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	1.2e-59
WP_003645867.1|88749_89328_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
>prophage 2
NZ_CP015857	Lactiplantibacillus plantarum strain LZ227 chromosome, complete genome	3131750	254349	347005	3131750	portal,integrase,terminase,head,holin,transposase,tail,capsid	Lactobacillus_phage(48.72%)	106	289777:289798	343377:343393
WP_086989537.1|254349_255124_+|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_064578048.1|255291_256482_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_003642741.1|256705_256936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642742.1|256961_257183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380658.1|257329_257794_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015380657.1|258015_258909_+	C40 family peptidase	NA	NA	NA	NA	NA
WP_015380656.1|258975_259839_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003642746.1|260400_260565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642747.1|260623_261367_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003642748.1|261472_262660_+	MFS transporter	NA	NA	NA	NA	NA
WP_003644671.1|262873_263191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642750.1|263266_263827_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_011101810.1|264583_265522_-	EamA family transporter	NA	NA	NA	NA	NA
WP_015380652.1|265718_265988_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_003642754.1|265997_267341_+	PFL family protein	NA	NA	NA	NA	NA
WP_003646617.1|267713_268442_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.1	2.1e-34
WP_003642756.1|268438_269962_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_064578049.1|270257_271439_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	29.9	3.9e-46
WP_003642758.1|271674_272532_+	GRP family sugar transporter	NA	NA	NA	NA	NA
WP_003642759.1|272752_274105_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_154811976.1|274596_275372_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_064578051.1|275376_275577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578052.1|275981_277976_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.3	7.2e-32
WP_003642762.1|277993_279571_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_064578053.1|279542_281306_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	40.9	4.8e-96
WP_003639252.1|282246_282390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101805.1|282748_282892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578054.1|283579_286300_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003642771.1|288420_288906_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015380646.1|288954_289227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642773.1|289251_289485_-	hypothetical protein	NA	NA	NA	NA	NA
289777:289798	attL	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_064578055.1|289944_291102_-|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.5	2.3e-54
289777:289798	attL	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_050480169.1|291172_291886_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064578056.1|292032_292212_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027823049.1|292481_292709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054519349.1|292722_293523_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_064578057.1|293522_294917_+	virulence protein	NA	A0A0A7RTG3	Clostridium_phage	33.4	9.0e-66
WP_027823041.1|295061_295541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027823040.1|295555_295747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054519350.1|295733_296072_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	36.6	1.9e-09
WP_064578058.1|297149_297623_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_064578059.1|297619_299323_+|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.1	1.2e-120
WP_054519337.1|299477_300578_+|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	33.6	1.0e-48
WP_054519336.1|300574_302116_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	26.0	1.1e-45
WP_027823052.1|302525_302795_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_024971530.1|302952_303324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380645.1|304128_304335_+	hypothetical protein	NA	NA	NA	NA	NA
303801:303822	attR	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_064578062.1|304685_305807_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.7	1.3e-46
303801:303822	attR	TTGGCTGTCCTTTTGGCTGACT	NA	NA	NA	NA
WP_063490409.1|305926_306754_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_099739059.1|306756_307551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076636272.1|307927_308104_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	51.7	2.6e-10
WP_063722276.1|308423_308615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578064.1|308874_309510_-	DUF2304 domain-containing protein	NA	NA	NA	NA	NA
WP_080474029.1|309665_310091_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	46.8	6.2e-26
WP_064578065.1|310087_310435_-	helix-turn-helix domain-containing protein	NA	A8ASM2	Listeria_phage	37.8	5.1e-10
WP_064578066.1|310592_310796_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080474030.1|310863_311034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578067.1|311045_311351_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_046947674.1|311417_311930_+	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	42.9	2.1e-28
WP_187337847.1|312038_312185_+	hypothetical protein	NA	E9LUT9	Lactobacillus_phage	87.2	2.9e-15
WP_064578068.1|312184_312442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578069.1|312438_312825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578071.1|312821_313721_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.4	2.3e-62
WP_187337853.1|313752_314505_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	51.4	2.7e-72
WP_064578075.1|314585_315494_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_064578077.1|315490_315778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578078.1|315774_316497_+	phage antirepressor KilAC domain-containing protein	NA	A0A141E1D3	Streptococcus_phage	46.4	5.5e-51
WP_064578079.1|316501_317020_+	hypothetical protein	NA	O03915	Lactobacillus_phage	53.6	3.9e-38
WP_064578080.1|317016_317391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056953070.1|317393_317705_+	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	90.3	7.2e-48
WP_154811977.1|317867_318017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578081.1|318256_318727_+	hypothetical protein	NA	B4XYT9	Lactobacillus_phage	40.0	1.4e-15
WP_103420664.1|318962_319130_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_064578082.1|319418_320609_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	28.3	3.0e-33
WP_064578083.1|320605_321349_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_080474032.1|321458_321626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578084.1|321604_321817_+	hypothetical protein	NA	A0A1C8E971	Bacillus_phage	72.9	1.4e-26
WP_064578085.1|321866_322118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578086.1|322208_322724_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	70.1	5.7e-50
WP_064578087.1|322716_324006_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4IYR5	uncultured_Caudovirales_phage	49.8	2.8e-114
WP_080474033.1|323995_325672_+|portal	phage portal protein	portal	D2IYW2	Enterococcus_phage	32.9	3.7e-66
WP_064578088.1|325685_326630_+|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_064578089.1|326738_327386_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_064578090.1|327399_328470_+	hypothetical protein	NA	A0A0P0HSG2	Acinetobacter_phage	33.2	1.7e-40
WP_064578091.1|328484_328835_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_080474089.1|328839_329163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578093.1|329152_329707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074029844.1|329708_330095_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_064578095.1|330106_330694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578096.1|330711_331224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578097.1|331292_331529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578098.1|331528_335455_+	tape measure protein	NA	E9LUR1	Lactobacillus_phage	48.4	7.9e-83
WP_064578099.1|335464_336361_+|tail	phage tail family protein	tail	A8ATA8	Listeria_phage	29.3	3.5e-18
WP_187337848.1|336360_337539_+|tail	phage tail protein	tail	A0A0M7RDS2	Lactobacillus_phage	29.1	3.6e-23
WP_064578101.1|337535_337799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578102.1|337785_338085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578103.1|338085_340002_+	metallophosphoesterase	NA	A0A2K9VD08	Lactobacillus_phage	35.1	1.3e-51
WP_064578104.1|340017_340761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080474034.1|340757_341066_+	DUF2977 domain-containing protein	NA	E0Y3M4	Staphylococcus_virus	31.7	2.0e-05
WP_080474035.1|341062_341203_+	XkdX family protein	NA	NA	NA	NA	NA
WP_064578620.1|341329_342445_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	66.7	6.8e-32
WP_060418016.1|342445_342742_+	hypothetical protein	NA	A0A1I9KK55	Lactobacillus_phage	77.6	2.0e-39
WP_064578106.1|342728_343103_+|holin	holin	holin	A0A2P0ZLG6	Lactobacillus_phage	72.4	1.5e-15
WP_064578107.1|343580_344432_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011101730.1|344654_345047_+	YxeA family protein	NA	NA	NA	NA	NA
WP_003644665.1|345274_347005_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	2.6e-46
>prophage 3
NZ_CP015857	Lactiplantibacillus plantarum strain LZ227 chromosome, complete genome	3131750	631357	717831	3131750	lysis,portal,integrase,terminase,tRNA,holin,protease,transposase,tail,capsid	Lactobacillus_phage(78.85%)	94	624410:624427	692233:692250
624410:624427	attL	ATGGAAAAAGCCGTTGAC	NA	NA	NA	NA
WP_064578146.1|631357_632521_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	36.5	5.4e-56
WP_027822546.1|633568_633751_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	66.7	8.8e-14
WP_003641358.1|634056_634257_-	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	100.0	4.9e-26
WP_064578147.1|634271_635150_-	HIRAN domain-containing protein	NA	A0A2H4J549	uncultured_Caudovirales_phage	34.8	3.0e-06
WP_003641360.1|635212_635602_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	54.3	4.6e-36
WP_003641361.1|635632_635959_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	44.1	6.9e-17
WP_003644552.1|636215_636431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027823017.1|637301_637553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050339257.1|639189_639399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154811978.1|639411_639576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164882561.1|639799_639964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578149.1|640101_640479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027823021.1|640536_640797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578150.1|640938_641187_+	hypothetical protein	NA	E9LUT6	Lactobacillus_phage	84.1	1.9e-35
WP_057138670.1|641189_641390_+	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	87.9	2.9e-26
WP_064578151.1|641401_641626_+	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	87.7	7.0e-29
WP_164882560.1|641674_641821_+	hypothetical protein	NA	E9LUT9	Lactobacillus_phage	95.7	1.4e-17
WP_064578152.1|641820_642681_+	DUF1351 domain-containing protein	NA	A0A0P0IV40	Lactobacillus_phage	35.6	1.4e-32
WP_056953065.1|642680_643307_+	ERF family protein	NA	D7RWM8	Brochothrix_phage	37.4	2.3e-13
WP_064578153.1|643303_643765_+	single-stranded DNA-binding protein	NA	A0A218MNB4	uncultured_virus	70.9	1.1e-39
WP_064578154.1|643779_644472_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	88.7	5.0e-118
WP_064578155.1|645288_646074_+	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	90.4	1.6e-131
WP_064578156.1|646209_646518_+	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	90.2	1.3e-46
WP_128468352.1|646510_646669_+	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	90.4	1.9e-17
WP_153629594.1|646671_646818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080474041.1|646810_647239_+	hypothetical protein	NA	Q5ULU9	Lactobacillus_virus	87.9	3.1e-73
WP_056953073.1|647446_647758_+	hypothetical protein	NA	A0A2P0ZLD0	Lactobacillus_phage	93.2	8.5e-49
WP_064578158.1|647769_648183_+	hypothetical protein	NA	A0A2P0ZLC0	Lactobacillus_phage	98.5	8.9e-70
WP_064578159.1|648258_648960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060811411.1|649858_650059_+	hypothetical protein	NA	A0A2P0ZLC2	Lactobacillus_phage	86.4	5.1e-15
WP_063730053.1|650042_650381_+	HNH endonuclease	NA	A0A2P0ZLC6	Lactobacillus_phage	98.2	6.6e-63
WP_064578160.1|650380_650623_+	hypothetical protein	NA	A0A2P0ZLD3	Lactobacillus_phage	82.5	2.5e-32
WP_054396974.1|650640_650883_+	hypothetical protein	NA	A0A2P0ZLD2	Lactobacillus_phage	95.0	6.8e-38
WP_064578161.1|651275_652955_+|terminase	terminase large subunit	terminase	A0A2P0ZLE5	Lactobacillus_phage	97.9	0.0e+00
WP_050339977.1|652973_654116_+|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	97.6	4.0e-213
WP_064578162.1|654102_654825_+|protease	Clp protease ClpP	protease	A0A2P0ZLE3	Lactobacillus_phage	74.2	5.3e-94
WP_064578163.1|654847_656020_+|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	54.8	1.0e-110
WP_056953089.1|656191_656449_+	hypothetical protein	NA	A0A2P0ZLD5	Lactobacillus_phage	95.3	4.2e-38
WP_056953084.1|656429_656819_+	hypothetical protein	NA	A0A2P0ZLD1	Lactobacillus_phage	89.1	5.8e-63
WP_064578164.1|656815_657223_+	HK97 gp10 family phage protein	NA	A0A2P0ZLD7	Lactobacillus_phage	94.1	2.0e-66
WP_003643909.1|657219_657642_+	hypothetical protein	NA	A0A2P0ZLE4	Lactobacillus_phage	98.6	7.4e-72
WP_064578165.1|657656_658268_+|tail	phage tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	96.1	4.3e-105
WP_064578166.1|658360_658675_+	hypothetical protein	NA	A0A2P0ZLF3	Lactobacillus_phage	95.2	7.0e-51
WP_054396950.1|658698_658920_+	hypothetical protein	NA	A0A2P0ZLD9	Lactobacillus_phage	100.0	1.0e-32
WP_064578167.1|658938_663483_+|tail	phage tail tape measure protein	tail	A0A2P0ZLF1	Lactobacillus_phage	90.4	0.0e+00
WP_064578168.1|663486_664308_+|tail	phage tail family protein	tail	A0A2P0ZLE2	Lactobacillus_phage	96.3	1.2e-150
WP_054519015.1|669330_669822_+	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	63.8	1.3e-48
WP_064578169.1|669823_670258_+	hypothetical protein	NA	A0A2P0ZLE9	Lactobacillus_phage	80.6	3.7e-58
WP_064578170.1|670274_670655_+	hypothetical protein	NA	A0A2P0ZLF7	Lactobacillus_phage	75.2	2.7e-49
WP_015380197.1|670660_670870_+	hypothetical protein	NA	A0A2P0ZLG4	Lactobacillus_phage	58.0	1.3e-08
WP_064578171.1|670869_671154_+|lysis	lysis protein	lysis	A0A2P0ZLE8	Lactobacillus_phage	96.8	2.0e-41
WP_080474043.1|671153_672212_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P0ZLG2	Lactobacillus_phage	71.3	2.7e-115
WP_003644510.1|672211_672475_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_064578172.1|672487_672865_+|holin	holin	holin	A0A2K9VCG4	Lactobacillus_phage	63.8	3.7e-14
WP_064578173.1|674108_675320_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_016527118.1|675798_677541_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_064578174.1|677559_678351_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.3	1.3e-29
WP_064578175.1|679554_680127_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003645635.1|680826_681768_-	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	48.7	3.1e-78
WP_015640487.1|682213_682606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003645633.1|682769_683162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578176.1|683197_684367_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003645631.1|684416_685046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089197934.1|685363_685594_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_003640747.1|685683_686316_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_003644501.1|686467_686707_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640745.1|686804_687041_+	YneF family protein	NA	NA	NA	NA	NA
WP_003645630.1|687097_687733_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003645629.1|687844_688603_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003645628.1|688586_688892_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003640741.1|688976_689975_+	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
WP_064578177.1|690247_691003_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003640739.1|691227_692031_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_064578178.1|692133_693012_+	elongation factor Ts	NA	NA	NA	NA	NA
692233:692250	attR	ATGGAAAAAGCCGTTGAC	NA	NA	NA	NA
WP_003640737.1|693211_693934_+	UMP kinase	NA	NA	NA	NA	NA
WP_003640736.1|693935_694499_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003640735.1|694618_695398_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.1e-23
WP_064578179.1|695413_696199_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003640733.1|696236_697514_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003640732.1|697553_699263_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003640729.1|699756_704070_+	DNA polymerase III subunit alpha	NA	A0A1X9SH08	Bradyrhizobium_phage	34.0	1.0e-14
WP_003640728.1|704365_704842_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_064578180.1|704862_706080_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003640726.1|706124_706424_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003640725.1|706413_706719_+	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003645962.1|706733_709310_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	9.6e-21
WP_003640723.1|709332_709686_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003645963.1|710334_711789_+	MFS transporter	NA	NA	NA	NA	NA
WP_003640721.1|711781_712951_+	chorismate synthase	NA	NA	NA	NA	NA
WP_064578181.1|712959_713487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578182.1|713500_714799_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_064578183.1|714801_715899_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_003645967.1|715901_716423_+	shikimate kinase	NA	NA	NA	NA	NA
WP_003645968.1|716907_717831_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP015857	Lactiplantibacillus plantarum strain LZ227 chromosome, complete genome	3131750	1216348	1227387	3131750	transposase	Lactobacillus_phage(77.78%)	10	NA	NA
WP_003645220.1|1216348_1217344_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.8	3.1e-52
WP_015380221.1|1217970_1218108_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003643094.1|1218203_1218644_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	99.3	8.0e-77
WP_003643095.1|1218714_1219275_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
WP_064578262.1|1219362_1221801_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.4	0.0e+00
WP_003643097.1|1221803_1222418_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_003643099.1|1222761_1223709_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_015640259.1|1223894_1224866_+	Nisin resistance protein	NA	A0A2P0ZL68	Lactobacillus_phage	98.8	2.0e-181
WP_015640258.1|1224956_1226186_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	97.7	2.7e-215
WP_004271307.1|1226463_1227387_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	6.7e-33
>prophage 5
NZ_CP015857	Lactiplantibacillus plantarum strain LZ227 chromosome, complete genome	3131750	1593582	1663163	3131750	protease,transposase,tRNA,bacteriocin	Lactobacillus_phage(20.0%)	57	NA	NA
WP_021357097.1|1593582_1593912_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_015379975.1|1594047_1595376_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_015379974.1|1595524_1596418_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043992670.1|1596566_1597544_+	hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	32.3	2.1e-32
WP_064578324.1|1597558_1598956_+	anion permease	NA	NA	NA	NA	NA
WP_015379971.1|1599512_1600847_-	gluconate transporter	NA	NA	NA	NA	NA
WP_061871768.1|1601096_1602311_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	33.6	2.5e-48
WP_015379969.1|1602326_1603469_+	lactonase family protein	NA	NA	NA	NA	NA
WP_003644074.1|1603561_1604230_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_016526995.1|1604361_1604931_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003641207.1|1604981_1605746_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_080474062.1|1605742_1606993_-	YibE/F family protein	NA	NA	NA	NA	NA
WP_015379965.1|1606956_1607958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187337841.1|1608377_1609160_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003641203.1|1609494_1609821_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015379963.1|1610012_1610894_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_015379962.1|1610936_1612745_-	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.1	1.0e-77
WP_003641200.1|1613002_1613200_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003644064.1|1613419_1613686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578326.1|1613736_1614969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641197.1|1615004_1616411_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_015379959.1|1616862_1617870_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	43.0	1.4e-63
WP_003645743.1|1617908_1619204_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	31.2	4.2e-57
WP_043992667.1|1619264_1619882_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003641193.1|1619990_1620464_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011101224.1|1620739_1622629_-	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	26.2	5.2e-16
WP_064578327.1|1622815_1623742_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.2	5.0e-20
WP_064578328.1|1624462_1625215_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_187337854.1|1625864_1625984_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_064578329.1|1626192_1629762_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_053267329.1|1629876_1630407_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_154811976.1|1630761_1631537_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_154811980.1|1631587_1632271_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016511035.1|1632251_1632761_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_154811976.1|1633248_1634023_+|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_080474064.1|1634695_1635892_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	25.5	4.6e-10
WP_016526986.1|1637488_1640362_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_003645758.1|1640589_1643124_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	27.4	3.5e-68
WP_003644050.1|1643305_1643878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644049.1|1643983_1644316_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003645760.1|1644677_1645688_-	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_016511031.1|1645819_1646620_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_003641176.1|1646823_1647264_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003644046.1|1647324_1647747_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003641174.1|1647761_1647944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644045.1|1647956_1648502_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_003641172.1|1648513_1648768_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_003645763.1|1649008_1650856_-	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	23.7	5.8e-20
WP_003645764.1|1650845_1651229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064578331.1|1654488_1655787_+	MFS transporter	NA	NA	NA	NA	NA
WP_154811981.1|1655863_1656739_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	28.9	2.1e-20
WP_003645769.1|1657610_1657955_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015379934.1|1658174_1658858_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003641165.1|1659423_1659792_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	42.7	5.9e-17
WP_015379932.1|1660025_1660394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015640090.1|1660930_1662355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154811976.1|1662387_1663163_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
>prophage 6
NZ_CP015857	Lactiplantibacillus plantarum strain LZ227 chromosome, complete genome	3131750	1860281	1868905	3131750		Streptococcus_phage(66.67%)	11	NA	NA
WP_064578369.1|1860281_1861277_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.9	1.0e-50
WP_003640969.1|1861415_1862201_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_064578370.1|1862204_1863101_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	2.2e-81
WP_003640967.1|1863199_1863547_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003640966.1|1863571_1864591_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640965.1|1864607_1864937_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_064578371.1|1864933_1865599_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	2.5e-53
WP_003640957.1|1865996_1866248_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003637790.1|1866262_1866862_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640956.1|1866877_1867186_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003643940.1|1867207_1868905_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
>prophage 7
NZ_CP015857	Lactiplantibacillus plantarum strain LZ227 chromosome, complete genome	3131750	2392295	2404743	3131750	portal,integrase,terminase,head,tail,capsid	Staphylococcus_phage(37.5%)	15	2394565:2394578	2404937:2404950
WP_033611500.1|2392295_2392565_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_064578490.1|2392682_2394257_-|capsid	phage major capsid protein	capsid	A0A1J0MFW8	Staphylococcus_phage	35.3	1.1e-40
WP_027822418.1|2394246_2395353_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	33.9	4.7e-49
2394565:2394578	attL	TGGTAAGCCAAAGG	NA	NA	NA	NA
WP_064578492.1|2395539_2397243_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.5	2.4e-121
WP_064578493.1|2397239_2397713_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_064578494.1|2398325_2398715_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	42.6	2.2e-17
WP_064578495.1|2398707_2399046_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	34.7	1.0e-07
WP_064578496.1|2399055_2399241_-	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_027822990.1|2399265_2399685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064578497.1|2399829_2401224_-	virulence protein	NA	Q4ZD27	Staphylococcus_phage	37.1	1.1e-68
WP_064578499.1|2401223_2402024_-	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_027823047.1|2402037_2402268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064578500.1|2402538_2402718_-	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	86.2	2.1e-20
WP_064578501.1|2402866_2403511_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064578503.1|2403588_2404743_+|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	36.7	6.1e-60
2404937:2404950	attR	TGGTAAGCCAAAGG	NA	NA	NA	NA
>prophage 8
NZ_CP015857	Lactiplantibacillus plantarum strain LZ227 chromosome, complete genome	3131750	2748491	2756779	3131750	bacteriocin	Planktothrix_phage(16.67%)	7	NA	NA
WP_027822312.1|2748491_2749433_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.5	2.1e-18
WP_064578640.1|2749525_2750497_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.2	1.8e-137
WP_015381012.1|2750545_2751835_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	37.0	3.5e-72
WP_003645480.1|2752151_2753450_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.6	3.8e-18
WP_021357419.1|2753672_2754002_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_015381010.1|2754196_2755531_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	7.9e-27
WP_054519129.1|2755666_2756779_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.3	1.3e-35
>prophage 1
NZ_CP015858	Lactiplantibacillus plantarum strain LZ227 plasmid LZ227p1, complete sequence	74177	3053	54407	74177	transposase,protease,holin	Lactobacillus_phage(30.77%)	52	NA	NA
WP_064578642.1|3053_3983_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.1	6.7e-25
WP_064578643.1|5938_6805_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	45.1	9.0e-56
WP_003554871.1|6797_7106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578644.1|7342_7594_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	94.0	2.3e-36
WP_046040924.1|7647_8490_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.3	8.8e-157
WP_064578645.1|9033_9591_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	44.6	2.0e-32
WP_064578646.1|9663_9999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016526619.1|10102_10387_+	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_064578647.1|10569_13284_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_064578648.1|13408_13627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578649.1|13627_15220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027822898.1|15286_15610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046041500.1|15682_16081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046041498.1|16073_16394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056988790.1|16386_17688_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	40.0	4.5e-83
WP_056988833.1|18109_18334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056988831.1|18336_19110_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	36.6	3.3e-33
WP_064578650.1|19886_21425_+	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_064578651.1|21734_24380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041161906.1|24643_25027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578652.1|24998_25658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578653.1|25674_27627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041161907.1|27629_27836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578654.1|27836_29000_+	CHAP domain-containing protein	NA	A0A0A0RSI6	Bacillus_phage	35.5	4.5e-10
WP_064578655.1|29012_29642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578656.1|30458_31421_+	DUF3102 domain-containing protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	48.2	4.7e-37
WP_060678043.1|31417_31633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526759.1|31634_31853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526760.1|31849_32149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578657.1|32145_32571_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_080474092.1|32589_33498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578659.1|33783_34080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578660.1|34081_34582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578661.1|34599_35067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578662.1|35038_37228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578663.1|37229_37865_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_064578664.1|38145_38250_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_006293514.1|38690_38795_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_064578665.1|39360_41523_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	47.3	4.5e-104
WP_154811985.1|41684_41849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056988529.1|42016_42646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578666.1|42721_43687_+	DUF3991 and TOPRIM domain-containing protein	NA	NA	NA	NA	NA
WP_064578667.1|43683_43878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578668.1|43880_44486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578669.1|44488_46273_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	33.7	1.8e-82
WP_016526775.1|46339_46654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578670.1|46749_48831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578671.1|48840_49629_+	class A sortase	NA	NA	NA	NA	NA
WP_064578672.1|49658_52598_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_064578673.1|52674_52971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578674.1|53260_54103_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.6	2.8e-155
WP_064578675.1|54143_54407_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	94.7	2.1e-32
>prophage 1
NZ_CP015861	Lactiplantibacillus plantarum strain LZ227 plasmid LZ227p3, complete sequence	35461	0	6654	35461	transposase	Staphylococcus_phage(33.33%)	6	NA	NA
WP_181021348.1|533_1520_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	1.2e-43
WP_064578751.1|3316_3643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064578752.1|3820_4072_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	91.6	1.5e-35
WP_064578753.1|5026_5266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021357841.1|5481_5838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031264030.1|5841_6654_-	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	40.2	4.5e-49
>prophage 2
NZ_CP015861	Lactiplantibacillus plantarum strain LZ227 plasmid LZ227p3, complete sequence	35461	12388	14524	35461		Streptococcus_phage(100.0%)	1	NA	NA
WP_064578756.1|12388_14524_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	46.8	1.6e-109
>prophage 3
NZ_CP015861	Lactiplantibacillus plantarum strain LZ227 plasmid LZ227p3, complete sequence	35461	21429	22410	35461		Enterobacteria_phage(100.0%)	1	NA	NA
WP_064578760.1|21429_22410_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	34.3	1.9e-06
>prophage 4
NZ_CP015861	Lactiplantibacillus plantarum strain LZ227 plasmid LZ227p3, complete sequence	35461	26190	28226	35461	transposase	Bacillus_phage(50.0%)	3	NA	NA
WP_064578762.1|26190_27069_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.1	7.5e-42
WP_003688751.1|27092_27380_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_064578763.1|27638_28226_+	recombinase family protein	NA	M4QQC6	Vibrio_phage	42.4	7.8e-19
>prophage 5
NZ_CP015861	Lactiplantibacillus plantarum strain LZ227 plasmid LZ227p3, complete sequence	35461	31539	32463	35461	transposase	unidentified_phage(100.0%)	1	NA	NA
WP_064578765.1|31539_32463_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	1.1e-32
>prophage 1
NZ_CP015859	Lactiplantibacillus plantarum strain LZ227 plasmid LZ227p4, complete sequence	93544	4119	73850	93544	transposase,holin	Streptococcus_phage(15.38%)	56	NA	NA
WP_053338758.1|4119_5049_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	1.1e-24
WP_011222016.1|5403_5754_-	DUF5388 domain-containing protein	NA	NA	NA	NA	NA
WP_015639692.1|5755_6556_-	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	41.9	2.9e-53
WP_063493464.1|7359_7692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578694.1|9206_9488_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_103851992.1|9477_9882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016526694.1|11210_12119_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003646133.1|14153_14432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064578696.1|14454_14664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064578697.1|14934_16998_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_064578698.1|17094_19230_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	46.0	1.5e-107
WP_064578699.1|19351_19567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578700.1|19570_20695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021353390.1|20851_20941_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_027821237.1|21952_23347_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027821238.1|23436_23784_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	44.3	1.7e-18
WP_003596756.1|23786_25082_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	63.7	6.9e-145
WP_003646125.1|25458_25995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064578701.1|28099_29182_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	31.2	2.4e-18
WP_041161898.1|30514_31231_-	LysM peptidoglycan-binding domain-containing protein	NA	K4ID66	Lactobacillus_phage	55.7	3.6e-10
WP_181021348.1|31613_32600_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	1.2e-43
WP_013356276.1|33016_34213_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	9.9e-29
WP_020923853.1|34212_35052_+	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_064578705.1|35059_35977_+	glycine/betaine ABC transporter	NA	NA	NA	NA	NA
WP_056986431.1|36096_36312_-|transposase	transposase	transposase	A0A1S5SBP9	Streptococcus_phage	49.1	1.8e-05
WP_064578706.1|38224_38662_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064578707.1|39045_40566_-	KUP/HAK/KT family potassium transporter	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	35.8	1.5e-58
WP_064578708.1|40665_41277_-	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	35.5	2.4e-18
WP_064578709.1|41389_41635_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	73.4	2.3e-17
WP_064578710.1|41610_41916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_181021341.1|42145_42463_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064578712.1|42459_43290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016378676.1|43449_43554_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_064578713.1|43842_45234_+	MFS transporter	NA	NA	NA	NA	NA
WP_064578714.1|45233_45896_+	HD domain-containing protein	NA	A0A1S5XYU7	Kurlavirus	31.4	1.3e-14
WP_021353390.1|46021_46111_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_072533468.1|46663_47122_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_043993132.1|47149_49297_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.3	3.0e-254
WP_020923824.1|49403_50330_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P8A9	Corynebacterium_phage	31.1	1.2e-34
WP_027821209.1|50344_51295_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	54.6	7.2e-99
WP_027821210.1|51815_52103_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_064578715.1|52520_53846_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	28.4	2.4e-36
WP_012390814.1|54036_54846_+	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_027822410.1|54878_55823_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_020923829.1|57221_57776_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	45.1	8.9e-33
WP_064578716.1|58376_59558_-|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	28.6	1.2e-26
WP_020923831.1|60053_62090_-	KUP/HAK/KT family potassium transporter	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	33.4	1.6e-63
WP_027823033.1|63007_63910_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.3	8.2e-52
WP_128484923.1|64017_64792_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.3	1.0e-26
WP_027822938.1|65163_66318_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_020923857.1|66440_68009_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_072533465.1|68345_68483_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_064578719.1|68781_70008_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	47.5	2.8e-87
WP_064578693.1|71298_72144_-	LysM peptidoglycan-binding domain-containing protein	NA	K4ID66	Lactobacillus_phage	55.7	4.3e-10
WP_063484976.1|72608_72872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053338758.1|72920_73850_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	1.1e-24
