The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011460	Vibrio anguillarum strain 90-11-286 chromosome I, complete sequence	3048854	457039	464278	3048854		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_010320454.1|457039_457786_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.5	1.0e-68
WP_013857716.1|457785_458412_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.9	8.0e-38
WP_026028368.1|458417_459350_+	murein hydrolase activator NlpD	NA	I3PV79	Clostridium_phage	32.8	5.9e-13
WP_017047531.1|459422_460424_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.8	3.5e-35
WP_026028369.1|460556_463145_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	20.9	6.9e-35
WP_064624375.1|463387_464278_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.8	5.2e-59
>prophage 2
NZ_CP011460	Vibrio anguillarum strain 90-11-286 chromosome I, complete sequence	3048854	705084	712155	3048854		Faustovirus(16.67%)	9	NA	NA
WP_013857499.1|705084_706299_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.4	2.4e-30
WP_010320409.1|706355_706739_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	1.8e-53
WP_010320408.1|706801_707125_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	53.3	3.6e-26
WP_026028094.1|707191_707707_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_064624545.1|707728_709582_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.2	7.2e-111
WP_010320405.1|709593_709932_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_010320404.1|709982_710177_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_026028095.1|710361_711657_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.5	1.1e-33
WP_064624547.1|711729_712155_+	nucleoside-diphosphate kinase	NA	K7YW26	Megavirus	41.4	5.1e-20
>prophage 3
NZ_CP011460	Vibrio anguillarum strain 90-11-286 chromosome I, complete sequence	3048854	1622786	1711365	3048854	integrase,plate,transposase	Vibrio_phage(30.0%)	63	1613494:1613510	1712574:1712588
1613494:1613510	attL	TAGCCTTAGCACCAACA	NA	NA	NA	NA
WP_064624621.1|1622786_1624982_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1613494:1613510	attL	TAGCCTTAGCACCAACA	NA	NA	NA	NA
WP_064624619.1|1624996_1627342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064624617.1|1627341_1628742_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_064625339.1|1629054_1630734_-	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	25.8	4.2e-17
WP_064625342.1|1630852_1631839_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	6.0e-24
WP_026028729.1|1632112_1633552_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_064625344.1|1633636_1634557_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_064625346.1|1634685_1636200_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_064625348.1|1636246_1637014_-	potassium channel family protein	NA	A0A2I7QWW4	Vibrio_phage	38.5	4.4e-06
WP_064625349.1|1637477_1639109_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	80.0	2.6e-11
WP_017042970.1|1639172_1640165_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_064625351.1|1640161_1641502_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_064625353.1|1641855_1644660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017048641.1|1644812_1645232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064625356.1|1645628_1646585_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_017050579.1|1646574_1646889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064625358.1|1646876_1647740_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_064625361.1|1647732_1648479_+	putative DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017044810.1|1648475_1649075_+	DoxX family protein	NA	NA	NA	NA	NA
WP_013856712.1|1649195_1650776_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_064625363.1|1650787_1651924_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_013856710.1|1651936_1652038_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_064625364.1|1652151_1652514_-	RidA family protein	NA	NA	NA	NA	NA
WP_064625366.1|1652526_1653579_-	lactonase family protein	NA	NA	NA	NA	NA
WP_019280949.1|1654217_1654787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064625368.1|1654807_1657312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064625370.1|1657314_1660476_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_064625374.1|1662323_1663328_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064625379.1|1663998_1664787_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064625383.1|1665381_1666362_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	33.1	2.7e-40
WP_064625385.1|1666409_1666907_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_064625386.1|1667389_1668895_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_064625388.1|1669298_1669874_+	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_064625390.1|1670064_1670346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088721186.1|1670471_1671627_+|transposase	IS3-like element ISVa4 family transposase	transposase	Q716C2	Shigella_phage	36.1	1.8e-35
WP_064625392.1|1672657_1673926_-|transposase	IS4-like element ISVa14 family transposase	transposase	NA	NA	NA	NA
WP_185762005.1|1674300_1675835_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_064625398.1|1678641_1680543_-	hypothetical protein	NA	NA	NA	NA	NA
1679361:1679377	attR	TAGCCTTAGCACCAACA	NA	NA	NA	NA
WP_176313653.1|1680558_1681191_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
1679361:1679377	attR	TAGCCTTAGCACCAACA	NA	NA	NA	NA
WP_064625402.1|1681199_1684652_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_064625404.1|1684653_1685796_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_019282547.1|1685803_1687120_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_064625406.1|1687119_1687587_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_064625408.1|1687586_1688534_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_064625410.1|1688567_1689263_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_064625412.1|1689265_1690399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064625414.1|1690395_1692591_-	MFS transporter	NA	NA	NA	NA	NA
WP_064625417.1|1692600_1693755_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_064625419.1|1693897_1696504_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	31.8	2.6e-82
WP_013856687.1|1696512_1697496_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_064625421.1|1697477_1699259_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_013856685.1|1699251_1699668_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_013856684.1|1699664_1701020_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_064625423.1|1701066_1702548_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_013856682.1|1702547_1703057_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_013856681.1|1703126_1703657_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_064625425.1|1703683_1705075_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_064625427.1|1705749_1707741_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.2	1.5e-21
WP_029189801.1|1707740_1708304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013856676.1|1708313_1708610_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_019280941.1|1709669_1709810_-	hypothetical protein	NA	A0A067ZIA1	Vibrio_phage	63.4	4.5e-10
WP_013856673.1|1709818_1710157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019282554.1|1710153_1711365_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	31.2	6.3e-39
1712574:1712588	attR	TATTTTCTTTGTTTT	NA	NA	NA	NA
>prophage 4
NZ_CP011460	Vibrio anguillarum strain 90-11-286 chromosome I, complete sequence	3048854	2301639	2308274	3048854		Staphylococcus_phage(66.67%)	7	NA	NA
WP_026027639.1|2301639_2302110_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	8.4e-32
WP_013856195.1|2302318_2303428_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.3	9.7e-63
WP_010320134.1|2303516_2304173_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.0	1.5e-34
WP_064625817.1|2304174_2305272_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.8	1.1e-47
WP_010320136.1|2305278_2305728_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_064625818.1|2305870_2307121_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.3e-97
WP_038148735.1|2307134_2308274_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	2.9e-62
>prophage 5
NZ_CP011460	Vibrio anguillarum strain 90-11-286 chromosome I, complete sequence	3048854	2847698	2857646	3048854		Micromonas_sp._RCC1109_virus(28.57%)	10	NA	NA
WP_064626020.1|2847698_2848631_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	33.8	1.4e-41
WP_157722360.1|2848662_2849058_-	GtrA family protein	NA	NA	NA	NA	NA
WP_064626021.1|2849075_2849354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064626022.1|2849361_2850375_-	NAD(P)-dependent oxidoreductase	NA	M4QPK0	Synechococcus_phage	24.8	2.4e-12
WP_064626023.1|2850492_2852319_-	thiamine pyrophosphate-binding protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	47.9	6.1e-155
WP_064626024.1|2852333_2853344_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_064626025.1|2853343_2854354_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	42.6	1.1e-68
WP_064626026.1|2854350_2855232_-	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	42.9	4.1e-56
WP_064626027.1|2855250_2856564_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	34.9	3.1e-52
WP_185762019.1|2856563_2857646_-	CDP-glucose 4,6-dehydratase	NA	A0A0P0YNH4	Yellowstone_lake_phycodnavirus	24.7	1.3e-06
>prophage 6
NZ_CP011460	Vibrio anguillarum strain 90-11-286 chromosome I, complete sequence	3048854	2863729	2870648	3048854		Enterobacteria_phage(50.0%)	7	NA	NA
WP_064626031.1|2863729_2865070_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.0	3.0e-10
WP_064626032.1|2865084_2865891_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_064626033.1|2866047_2866593_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.5	5.3e-54
WP_064626034.1|2866595_2867483_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.1	1.3e-38
WP_064626035.1|2867479_2868358_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.6	6.4e-110
WP_064626036.1|2868381_2869446_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.0	1.6e-102
WP_064626037.1|2869706_2870648_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	38.9	6.6e-36
>prophage 1
NZ_CP011461	Vibrio anguillarum strain 90-11-286 chromosome II, complete sequence	1293370	133926	178921	1293370	transposase	Staphylococcus_phage(11.11%)	33	NA	NA
WP_026027704.1|133926_134958_+|transposase	IS630-like element ISVa15 family transposase	transposase	NA	NA	NA	NA
WP_185762063.1|135168_136569_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	45.0	2.6e-60
WP_081265567.1|136639_139552_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	34.3	1.3e-58
WP_064626218.1|139625_140627_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_064626219.1|140699_141134_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_064626220.1|141241_143305_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	24.5	7.7e-21
WP_064626221.1|143487_145641_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_064626222.1|145779_146004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013867906.1|146071_146371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626223.1|146458_147718_+	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_064626224.1|147903_149448_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_064626225.1|149591_150257_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_064626083.1|151080_152217_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_064626227.1|154072_155173_-	autoinducer 2-binding periplasmic protein LuxP	NA	NA	NA	NA	NA
WP_017046397.1|155397_156549_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_064626228.1|156644_156968_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	49.3	3.0e-12
WP_064626229.1|156968_157622_-	YceH family protein	NA	NA	NA	NA	NA
WP_026028336.1|157679_157883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010319897.1|158073_158391_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_013867916.1|158700_158952_+	YgjV family protein	NA	A0A248SJ16	Salicola_phage	40.3	1.6e-05
WP_026029114.1|159100_160621_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_010319894.1|160673_161528_-	aquaporin family protein	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	29.3	2.9e-14
WP_064626230.1|162057_163707_+	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_064626231.1|163703_165017_+	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_064626232.1|165013_166240_+	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_064626233.1|166329_167421_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_081265568.1|167610_167844_+	thioredoxin	NA	NA	NA	NA	NA
WP_076611988.1|168203_169373_+|transposase	ISL3-like element ISVa10 family transposase	transposase	A0A0A8WEF4	Clostridium_phage	20.7	2.3e-06
WP_064626234.1|169594_172309_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_064626235.1|173103_174576_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	49.7	1.2e-129
WP_064624465.1|174847_176155_-|transposase	IS4-like element ISVa16 family transposase	transposase	NA	NA	NA	NA
WP_185762030.1|176460_177583_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.8	1.9e-26
WP_064626236.1|177940_178921_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011461	Vibrio anguillarum strain 90-11-286 chromosome II, complete sequence	1293370	185904	238326	1293370	transposase,protease,integrase	Vibrio_phage(10.0%)	43	185096:185111	226905:226920
185096:185111	attL	ACGATCTGCCAAAAAA	NA	NA	NA	NA
WP_064626241.1|185904_186405_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_064626242.1|187141_188050_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	60.5	1.0e-102
WP_064626243.1|188701_190012_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_064626244.1|190304_191171_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_064626245.1|191279_192185_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064626246.1|192468_193923_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_081265569.1|193919_194450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064626248.1|194446_196915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064626249.1|196908_199269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064626250.1|199392_199647_+	thioredoxin TrxC	NA	NA	NA	NA	NA
WP_026027460.1|199849_201001_+	MFS transporter	NA	NA	NA	NA	NA
WP_013867924.1|201017_201473_-	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_064626251.1|201519_201720_+	DUF2986 domain-containing protein	NA	NA	NA	NA	NA
WP_010319683.1|201708_202182_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_064626252.1|202245_203001_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_029189754.1|203069_203882_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_064626253.1|204024_204360_-	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_064626254.1|204362_206951_-	nitrite reductase large subunit	NA	NA	NA	NA	NA
WP_064626255.1|207590_208190_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_064626256.1|208398_209796_+	lysine decarboxylase	NA	NA	NA	NA	NA
WP_064626257.1|209799_212307_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_064626258.1|212353_213214_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017037465.1|213599_214025_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064626259.1|214041_214800_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_064626260.1|215037_215349_-|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	64.3	5.9e-26
WP_064626261.1|215552_216941_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	27.8	4.2e-47
WP_064626262.1|217083_217872_+	lipase	NA	Q6XLV5	Feldmannia_irregularis_virus	30.2	1.1e-07
WP_019283198.1|218476_219922_-	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_064626263.1|219931_221590_-	DUF3763 domain-containing protein	NA	A0A2H4PB07	Aphanizomenon_phage	27.4	8.6e-31
WP_017048791.1|221867_222383_+	NUDIX hydrolase	NA	Q5ULM8	Lactobacillus_virus	30.5	3.0e-06
WP_064626264.1|222492_223497_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_013867941.1|223620_224331_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064626265.1|224341_225607_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	37.0	3.7e-58
WP_017047351.1|226213_227431_+	amino acid permease	NA	NA	NA	NA	NA
226905:226920	attR	TTTTTTGGCAGATCGT	NA	NA	NA	NA
WP_064626266.1|227617_229045_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.5	1.3e-11
WP_029189705.1|229140_230157_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	46.5	8.0e-80
WP_088721589.1|230365_231109_+	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_064626268.1|231162_231882_+	allophanate hydrolase subunit 1	NA	NA	NA	NA	NA
WP_064626269.1|231878_232808_+	biotin-dependent carboxyltransferase	NA	NA	NA	NA	NA
WP_064626270.1|232852_234301_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_064626271.1|234609_237051_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_064626272.1|237050_237725_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	2.7e-23
WP_064626273.1|237723_238326_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 3
NZ_CP011461	Vibrio anguillarum strain 90-11-286 chromosome II, complete sequence	1293370	326637	345950	1293370	transposase,terminase,tail,plate	Vibrio_phage(36.36%)	27	NA	NA
WP_001900911.1|326637_327366_-	helix-turn-helix transcriptional regulator	NA	A0A2I7S9A5	Vibrio_phage	33.2	1.8e-28
WP_032481898.1|327552_327771_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	66.2	2.4e-18
WP_064626322.1|327781_329836_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	M4M9R2	Vibrio_phage	29.6	3.5e-74
WP_001900914.1|329832_330765_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	30.8	9.7e-32
WP_001900877.1|330767_331166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626323.1|331162_331381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626324.1|331380_331632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626325.1|331628_332279_+	DUF3164 family protein	NA	Q6QIE4	Burkholderia_phage	27.1	1.1e-08
WP_064626326.1|332289_332511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626327.1|332797_333946_-	restriction endonuclease subunit S	NA	A0A2H4J4K4	uncultured_Caudovirales_phage	53.8	2.0e-34
WP_064626328.1|333957_335979_-	N-6 DNA methylase	NA	A0A2H4JBT5	uncultured_Caudovirales_phage	62.0	3.1e-240
WP_185762058.1|336276_336552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626330.1|336548_336998_+	regulatory protein GemA	NA	NA	NA	NA	NA
WP_048615421.1|336982_337258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_185762059.1|337392_337725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064626974.1|337666_338029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064626332.1|338030_338570_-	lysozyme	NA	E5G6N1	Salmonella_phage	43.7	1.4e-27
WP_064626333.1|338566_338827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064626334.1|338851_340018_-|plate	baseplate J/gp47 family protein	plate	A0A059WFM2	Vibrio_phage	34.0	8.1e-44
WP_064626335.1|340019_341051_-	hypothetical protein	NA	Q6QIA2	Burkholderia_phage	27.4	4.7e-19
WP_064626336.1|341041_341260_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_064626337.1|341256_341655_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_064626338.1|341656_342244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064626339.1|342240_342879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001900923.1|343018_343570_+	DUF3486 family protein	NA	NA	NA	NA	NA
WP_064626340.1|343566_345219_+|terminase	phage terminase large subunit	terminase	A0A2K9VGU9	Faecalibacterium_phage	30.2	1.0e-36
WP_064626341.1|345227_345950_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
>prophage 4
NZ_CP011461	Vibrio anguillarum strain 90-11-286 chromosome II, complete sequence	1293370	1088564	1152731	1293370	tail,lysis,integrase,plate,portal,transposase,protease,terminase,tRNA	Vibrio_phage(30.77%)	72	1108695:1108723	1147974:1148002
WP_064626718.1|1088564_1089761_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	31.0	3.0e-57
WP_064626720.1|1090147_1091038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626723.1|1091067_1092408_-	site-specific DNA-methyltransferase	NA	A0A222ZMD5	Mycobacterium_phage	33.4	1.9e-49
WP_017042942.1|1093045_1093249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064626729.1|1093326_1093710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017042096.1|1093706_1093964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064626732.1|1094111_1094804_-	hypothetical protein	NA	Q6JII4	Burkholderia_virus	26.9	1.1e-11
WP_064626735.1|1094874_1095135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064626738.1|1095273_1095990_-	Cro/Cl family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	42.5	1.4e-30
WP_064626741.1|1096095_1096350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017042100.1|1096389_1096938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626744.1|1097113_1097914_+	hypothetical protein	NA	A0A067ZIA1	Vibrio_phage	54.9	1.6e-35
WP_064626747.1|1097916_1098654_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	43.5	1.8e-41
WP_064626750.1|1098666_1099251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626753.1|1099442_1100492_-	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	63.0	5.5e-108
WP_064626756.1|1100654_1100870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064626759.1|1101096_1102071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017050076.1|1102057_1102492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626762.1|1103147_1105628_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_064626765.1|1107516_1108053_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_064626768.1|1108236_1108404_+	YjzC family protein	NA	NA	NA	NA	NA
WP_064626771.1|1108430_1108664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_185762048.1|1108656_1108779_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
1108695:1108723	attL	CAACGCGTGGCATTTTTACTATGCGTTGG	NA	NA	NA	NA
WP_064626774.1|1108806_1109442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626776.1|1109596_1110295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_185762066.1|1110318_1110441_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_064626779.1|1110471_1110822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626781.1|1110983_1112912_+	DUF3696 domain-containing protein	NA	Q2P9X8	Enterobacteria_phage	40.8	1.1e-16
WP_064626783.1|1112899_1113922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017042796.1|1115198_1115393_+	hypothetical protein	NA	A0A1V1FD92	Vibrio_phage	64.5	1.4e-14
WP_064626785.1|1115376_1115865_+	lysozyme	NA	A0A1U9GSH3	Vibrio_phage	90.7	5.0e-80
WP_064626787.1|1115837_1116329_+|lysis	lysis protein	lysis	A0A1V0E843	Vibrio_phage	39.0	1.4e-16
WP_017042799.1|1116667_1117138_+	DUF1441 family protein	NA	NA	NA	NA	NA
WP_064626789.1|1117118_1119206_+|terminase	phage terminase large subunit family protein	terminase	A0A219YAX2	Aeromonas_phage	37.5	2.6e-125
WP_064626791.1|1119202_1119421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626793.1|1119413_1120913_+|portal	phage portal protein	portal	A0A0A0YUB7	Pseudomonas_phage	34.2	2.1e-76
WP_017042803.1|1120905_1123086_+|protease	Clp protease ClpP	protease	A0A0K2CYC6	Paenibacillus_phage	32.7	1.2e-24
WP_064626795.1|1123161_1123500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626797.1|1123502_1123838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626799.1|1123815_1124340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626801.1|1124305_1124812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626992.1|1124822_1125473_+|plate	phage baseplate assembly protein V	plate	A2I2X5	Vibrio_virus	39.2	1.1e-16
WP_064626803.1|1125469_1125805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626805.1|1125801_1126791_+|plate	baseplate J/gp47 family protein	plate	Q6R4V6	Vibrio_virus	38.8	7.1e-57
WP_064626807.1|1126774_1127389_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_064626809.1|1127381_1128590_+|tail	phage tail protein	tail	A0A1V0E875	Vibrio_phage	61.3	3.2e-11
WP_064626811.1|1128586_1129150_+	hypothetical protein	NA	R9TMQ2	Vibrio_phage	71.4	1.5e-35
WP_064626813.1|1129207_1129447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626815.1|1129446_1130616_+|tail	phage tail protein	tail	Q6R4W2	Vibrio_virus	43.4	2.1e-84
WP_064626817.1|1130608_1131085_+|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_081265611.1|1131149_1131872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626818.1|1131983_1134713_+|tail	phage tail tape measure protein	tail	A2I2Y1	Vibrio_virus	35.4	2.5e-43
WP_017043789.1|1134715_1135081_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_017043788.1|1135080_1135284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626820.1|1135283_1136261_+	hypothetical protein	NA	A2I2Y5	Vibrio_virus	35.2	1.0e-52
WP_064626822.1|1136260_1137508_+|integrase	site-specific integrase	integrase	A0A067ZJC5	Vibrio_phage	34.6	9.0e-57
WP_010319593.1|1138324_1140253_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.6	3.8e-123
WP_080569453.1|1140256_1140808_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	39.0	1.2e-13
WP_010319591.1|1140911_1141106_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_010319590.1|1141147_1141501_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017043784.1|1141572_1142535_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.8	7.6e-56
WP_064626825.1|1142776_1143349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626827.1|1144008_1144677_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_064626834.1|1145474_1146836_+	hypothetical protein	NA	R9TRQ8	Vibrio_phage	26.3	3.9e-29
WP_064626835.1|1147495_1147951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081265612.1|1147947_1148058_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
1147974:1148002	attR	CAACGCGTGGCATTTTTACTATGCGTTGG	NA	NA	NA	NA
WP_081265634.1|1148418_1148541_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_064626837.1|1148563_1149226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626839.1|1149380_1149776_+	DUF3465 domain-containing protein	NA	NA	NA	NA	NA
WP_081265635.1|1150722_1150845_+	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_064626843.1|1150903_1151347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064626083.1|1151594_1152731_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
