The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019602	Croceicoccus marinus strain E4A9 chromosome, complete genome	3001363	994285	1049739	3001363	protease,transposase,tRNA,capsid,integrase,head	Tupanvirus(18.18%)	54	1044684:1044742	1054908:1054966
WP_066843412.1|994285_995509_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	37.1	8.2e-55
WP_066843415.1|995508_996075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066843417.1|996165_996363_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_157668138.1|996362_996647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066843419.1|996643_996898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066843421.1|996894_997119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910460.1|997115_997445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668139.1|997583_998264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066843429.1|998648_998954_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_066843431.1|999068_999308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066843434.1|999304_999538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668140.1|999674_1000295_+|head,protease	HK97 family phage prohead protease	head,protease	NA	NA	NA	NA
WP_083987643.1|1000291_1001392_+|capsid	phage major capsid protein	capsid	C4ML06	Xanthomonas_virus	39.7	1.6e-62
WP_066843442.1|1001729_1001948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668141.1|1002379_1002913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668142.1|1002937_1003285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066843448.1|1003864_1004224_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_066843450.1|1004454_1004682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668143.1|1004703_1005093_-	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_066843453.1|1005545_1006328_-	NAD kinase	NA	NA	NA	NA	NA
WP_066843456.1|1006402_1009945_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_066843460.1|1009990_1010287_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_066843462.1|1010352_1012419_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_157668144.1|1012519_1012933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910462.1|1012923_1013478_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	61.9	9.2e-22
WP_066843466.1|1014329_1015553_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_066848286.1|1015662_1016958_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	35.2	9.3e-49
WP_066843470.1|1017059_1017830_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_066843473.1|1017928_1018285_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_066843476.1|1018496_1019090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083987648.1|1019126_1019582_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066848299.1|1019578_1019983_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_087910463.1|1020030_1021272_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_066843482.1|1021584_1022253_+	porin family protein	NA	NA	NA	NA	NA
WP_066843485.1|1022310_1022802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066843488.1|1022794_1023274_-	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_083987989.1|1023342_1025178_-	lytic transglycosylase domain-containing protein	NA	K4NWI2	Pseudomonas_phage	46.2	2.9e-27
WP_066843494.1|1025508_1026399_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_066843496.1|1026476_1026959_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.6	5.0e-32
WP_066848302.1|1027197_1027728_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_087910543.1|1027757_1030172_+	response regulator	NA	NA	NA	NA	NA
WP_066843498.1|1030277_1031348_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	65.2	2.9e-120
WP_066843501.1|1031528_1034198_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	37.5	1.0e-73
WP_066843504.1|1034246_1036004_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_083987990.1|1036154_1038242_-	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_083987652.1|1038521_1041242_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	31.8	1.5e-48
WP_083987654.1|1041138_1041810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066843514.1|1042090_1043200_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_066848309.1|1043555_1044518_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	44.8	1.5e-67
1044684:1044742	attL	GGCCTGTCACGCCGGAGGTCGCGGGTTCGAGCCCCGTCACTCGCGCCACCTTGGGAATT	NA	NA	NA	NA
WP_083987991.1|1045050_1045884_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_066848313.1|1046445_1047999_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_066843517.1|1047988_1048768_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	34.1	2.0e-30
WP_083987656.1|1048847_1048982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066848315.1|1049364_1049739_+|transposase	transposase	transposase	NA	NA	NA	NA
1054908:1054966	attR	GGCCTGTCACGCCGGAGGTCGCGGGTTCGAGCCCCGTCACTCGCGCCACCTTGGGAATT	NA	NA	NA	NA
>prophage 2
NZ_CP019602	Croceicoccus marinus strain E4A9 chromosome, complete genome	3001363	1187259	1243734	3001363	transposase,integrase	Stx2-converting_phage(44.44%)	54	1181223:1181239	1188814:1188830
1181223:1181239	attL	TCCTGCCGCCCCAGCCA	NA	NA	NA	NA
WP_157668148.1|1187259_1188696_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_157668149.1|1189200_1189437_+	hypothetical protein	NA	NA	NA	NA	NA
1188814:1188830	attR	TCCTGCCGCCCCAGCCA	NA	NA	NA	NA
WP_157668150.1|1189651_1189864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066843840.1|1189868_1190069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066843843.1|1190068_1190686_+	DedA family protein	NA	NA	NA	NA	NA
WP_157668151.1|1190649_1191168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668246.1|1191391_1191478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066843849.1|1191546_1191783_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_157668152.1|1191923_1192499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083987676.1|1192952_1194083_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_066843861.1|1194155_1195670_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_066842213.1|1195656_1196385_+	ATPase	NA	A0A059NT77	Lactococcus_phage	37.9	2.2e-31
WP_066843864.1|1196571_1196916_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_083987678.1|1197025_1198108_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_083987680.1|1199384_1201418_-	glycogen debranching protein	NA	NA	NA	NA	NA
WP_066843872.1|1201552_1204426_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_066843877.1|1204689_1206114_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_066843881.1|1206139_1207162_-	arabinan endo-1,5-alpha-L-arabinosidase	NA	NA	NA	NA	NA
WP_066843884.1|1207164_1207797_-	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	NA	NA	NA	NA
WP_066843887.1|1207793_1208693_-	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
WP_066843890.1|1208714_1209641_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_066843892.1|1209644_1210640_-	FAH family protein	NA	NA	NA	NA	NA
WP_066843895.1|1210708_1212238_-	aldehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
WP_083987682.1|1212350_1213106_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_066843897.1|1213199_1214534_-	sugar MFS transporter	NA	NA	NA	NA	NA
WP_066843900.1|1214671_1215820_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_066843903.1|1215837_1217634_+	dihydroxy-acid dehydratase family protein	NA	NA	NA	NA	NA
WP_083987684.1|1218019_1218796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066843909.1|1218710_1219229_-	cytochrome c	NA	NA	NA	NA	NA
WP_066848417.1|1219508_1219823_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_083987688.1|1219841_1219958_-	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
WP_066843912.1|1219981_1220989_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_066843915.1|1220988_1222440_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_066843918.1|1222522_1223086_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	37.2	5.2e-20
WP_066843919.1|1223264_1223828_+	elongation factor P	NA	NA	NA	NA	NA
WP_066843930.1|1223994_1224816_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_066843933.1|1225065_1226856_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_066843936.1|1226869_1227505_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_157668153.1|1227664_1227820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066843939.1|1227989_1228277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066843942.1|1228441_1230574_+	PEP-CTERM system histidine kinase PrsK	NA	NA	NA	NA	NA
WP_066843945.1|1230573_1231953_+	PEP-CTERM-box response regulator transcription factor	NA	NA	NA	NA	NA
WP_157668154.1|1232045_1232231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066843948.1|1232458_1235368_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	59.1	0.0e+00
WP_157668155.1|1235568_1236000_+	hypothetical protein	NA	C6ZCZ9	Enterobacteria_phage	30.3	3.1e-09
WP_083987690.1|1235983_1237006_+	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	43.0	9.9e-62
WP_157668156.1|1237005_1237842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062067998.1|1238045_1238264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066842363.1|1238263_1239907_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.0	2.7e-109
WP_062068002.1|1239980_1240322_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	59.2	1.3e-31
WP_066842361.1|1240318_1240684_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_066843951.1|1241314_1241692_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_066843954.1|1241688_1242030_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	57.3	4.3e-30
WP_066843956.1|1242090_1243734_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.5	1.1e-110
>prophage 3
NZ_CP019602	Croceicoccus marinus strain E4A9 chromosome, complete genome	3001363	1333806	1397237	3001363	transposase,tRNA,protease,integrase	Acinetobacter_phage(15.79%)	60	1329173:1329189	1397552:1397568
1329173:1329189	attL	GGCGATGGCGGCGATCT	NA	NA	NA	NA
WP_066844170.1|1333806_1334730_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_066848458.1|1334726_1336823_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_066844173.1|1336955_1339622_+	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	37.2	2.2e-89
WP_066844175.1|1339626_1340418_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_066844178.1|1340513_1341299_+	ComF family protein	NA	NA	NA	NA	NA
WP_066844181.1|1341647_1342016_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_066844184.1|1342078_1343881_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_066844187.1|1343931_1344849_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	52.0	6.1e-79
WP_066844191.1|1344845_1346159_-	MFS transporter	NA	NA	NA	NA	NA
WP_066844194.1|1346171_1346819_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_083987714.1|1346902_1347895_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_066844196.1|1347906_1348368_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_066848462.1|1348328_1348832_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	41.5	2.3e-19
WP_083987716.1|1348870_1350073_-	bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_066844198.1|1350145_1351183_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_066848466.1|1351197_1352319_+	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_066844201.1|1352318_1353767_+	response regulator	NA	NA	NA	NA	NA
WP_083987718.1|1353881_1356209_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_066844204.1|1356243_1357626_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_083987720.1|1357807_1358428_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_083987722.1|1358483_1359791_+	GTPase HflX	NA	NA	NA	NA	NA
WP_066844211.1|1359787_1360582_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_157668164.1|1360639_1360807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066844214.1|1360803_1361571_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_066844217.1|1361567_1362344_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_066844220.1|1362343_1363909_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	37.3	1.7e-97
WP_066844222.1|1363974_1364943_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_066844224.1|1364939_1365584_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	34.3	1.9e-18
WP_087910549.1|1365580_1366618_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_087910550.1|1366874_1367903_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_066844225.1|1368340_1369606_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q8W6M6	Sinorhizobium_phage	45.0	1.3e-92
WP_066844228.1|1369628_1370402_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066844231.1|1371361_1372090_-	ATPase	NA	A0A059NT77	Lactococcus_phage	37.9	1.7e-31
WP_066844234.1|1372076_1373591_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_066848480.1|1373727_1374111_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_066844237.1|1374107_1374455_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	56.2	5.6e-33
WP_066844240.1|1374516_1376055_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	47.4	9.2e-120
WP_066844242.1|1376415_1377162_-	M50 family metallopeptidase	NA	NA	NA	NA	NA
WP_083987724.1|1377247_1377553_-	YHYH domain-containing protein	NA	NA	NA	NA	NA
WP_066844244.1|1378389_1378719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083987728.1|1378823_1379084_-	hypothetical protein	NA	A0A218KCE8	Bacillus_phage	40.0	2.7e-08
WP_083987730.1|1379085_1379487_-	AAA domain-containing protein	NA	A0A2L0UZ48	Agrobacterium_phage	54.7	2.3e-14
WP_087910551.1|1379560_1380043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083988003.1|1380271_1381438_-	toxic anion resistance protein	NA	NA	NA	NA	NA
WP_066844252.1|1381449_1381965_-	RES domain-containing protein	NA	NA	NA	NA	NA
WP_087910552.1|1381961_1382426_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_066844259.1|1382489_1383389_-	aldolase	NA	NA	NA	NA	NA
WP_066848484.1|1383385_1384462_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	35.4	2.0e-41
WP_087910553.1|1384485_1385229_-	sucrose-6-phosphate hydrolase	NA	NA	NA	NA	NA
WP_066848486.1|1385225_1386368_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	33.2	1.7e-22
WP_083987732.1|1386419_1387484_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_083988004.1|1387483_1388413_-	hypothetical protein	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	33.1	1.8e-09
WP_066844273.1|1388631_1389642_-	ATP-dependent carboxylate-amine ligase	NA	NA	NA	NA	NA
WP_066844276.1|1389706_1390288_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	31.9	2.0e-06
WP_066844279.1|1390420_1390999_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.0	3.1e-28
WP_083987734.1|1391084_1392194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066848489.1|1392252_1393356_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	43.5	7.1e-66
WP_066844285.1|1393415_1394600_-	Tellurium resistance	NA	NA	NA	NA	NA
WP_066844289.1|1394668_1395250_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	31.2	1.5e-14
WP_066844297.1|1396319_1397237_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	31.1	4.0e-30
1397552:1397568	attR	AGATCGCCGCCATCGCC	NA	NA	NA	NA
>prophage 4
NZ_CP019602	Croceicoccus marinus strain E4A9 chromosome, complete genome	3001363	2346032	2391548	3001363	transposase,integrase	Stx2-converting_phage(44.44%)	36	2380797:2380812	2400102:2400117
WP_066843951.1|2346032_2346410_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_066843954.1|2346406_2346748_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	57.3	4.3e-30
WP_066846461.1|2346808_2348452_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.1	1.4e-89
WP_066847877.1|2350322_2350502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066846469.1|2351073_2351520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668205.1|2351667_2353287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668206.1|2353279_2353900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668207.1|2353896_2354544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083987878.1|2354745_2357526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066846486.1|2357803_2358832_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_066846489.1|2359003_2359705_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_066846491.1|2359860_2360622_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_066846494.1|2360623_2361115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066848999.1|2361081_2361618_-	DUF2231 domain-containing protein	NA	NA	NA	NA	NA
WP_083988053.1|2361531_2362320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066846497.1|2362316_2364794_+	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_066846502.1|2364793_2365102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066846505.1|2367568_2368471_+	hypothetical protein	NA	A0A2K9V2V7	Faecalibacterium_phage	32.7	4.0e-06
WP_066846508.1|2368564_2369104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668208.1|2369193_2369778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066846513.1|2369820_2370576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668209.1|2370887_2371532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066846519.1|2371579_2371906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054525571.1|2372393_2372615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066559831.1|2373414_2373813_-	single-stranded DNA-binding protein	NA	E8ZD59	Streptococcus_phage	33.6	6.4e-09
WP_083987880.1|2374470_2376147_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_066846528.1|2376143_2378141_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_157668210.1|2378496_2382255_+	hypothetical protein	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	28.5	5.5e-17
2380797:2380812	attL	GGTCGCCAAGGCGCGC	NA	NA	NA	NA
WP_066843951.1|2382305_2382683_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_066843954.1|2382679_2383021_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	57.3	4.3e-30
WP_066843956.1|2383081_2384725_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.5	1.1e-110
WP_066846532.1|2384901_2385276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066846534.1|2385657_2387334_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_066846537.1|2387655_2388516_-	DUF1259 domain-containing protein	NA	NA	NA	NA	NA
WP_066846539.1|2388625_2390020_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	76.5	7.5e-36
WP_066846541.1|2390366_2391548_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	33.0	7.7e-42
2400102:2400117	attR	GCGCGCCTTGGCGACC	NA	NA	NA	NA
>prophage 5
NZ_CP019602	Croceicoccus marinus strain E4A9 chromosome, complete genome	3001363	2553214	2656241	3001363	transposase,tRNA,protease,integrase	Staphylococcus_phage(13.33%)	95	2561823:2561839	2621592:2621608
WP_066846809.1|2553214_2555737_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	40.9	1.9e-175
WP_066846811.1|2555736_2556261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066846814.1|2556247_2557282_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_087910567.1|2557292_2557796_-	OstA family protein	NA	NA	NA	NA	NA
WP_066846816.1|2557866_2558511_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_066846819.1|2558536_2559157_-	ribonuclease D	NA	U3RK32	uncultured_virus	33.8	3.7e-11
WP_066846822.1|2559276_2559954_+	uracil-DNA glycosylase	NA	A0A2K9QQR6	Equid_alphaherpesvirus	44.0	2.6e-42
WP_066846825.1|2560111_2561548_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_066846828.1|2561559_2566212_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
2561823:2561839	attL	GGACGTCCTCGTCGGTC	NA	NA	NA	NA
WP_157668218.1|2566416_2567619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083987904.1|2567758_2569003_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_083987905.1|2569263_2571111_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.1	1.1e-58
WP_066846843.1|2571178_2571433_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_066846846.1|2571552_2571798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066846849.1|2571948_2572266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047822680.1|2572487_2572655_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_066846852.1|2572811_2573462_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_066849110.1|2573783_2574578_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_066846855.1|2574585_2575659_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	34.1	8.3e-35
WP_066849113.1|2575896_2576547_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_066846858.1|2576563_2577892_-	ATPase	NA	NA	NA	NA	NA
WP_157668219.1|2578067_2578592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066846864.1|2578683_2580462_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	34.8	7.5e-73
WP_066846866.1|2580518_2583152_-	methionine synthase	NA	NA	NA	NA	NA
WP_083987906.1|2583172_2584249_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	52.4	2.4e-13
WP_066846871.1|2584245_2585151_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_066846873.1|2585147_2586200_-	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_066846875.1|2586328_2586646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066846877.1|2586645_2586882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066846879.1|2586956_2587211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066846882.1|2587204_2587477_-	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066846885.1|2587559_2588261_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_066846887.1|2588397_2589159_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_066849117.1|2589642_2589837_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_083987907.1|2590111_2590267_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_066846893.1|2590415_2592689_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_066846897.1|2592910_2593747_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083988060.1|2593931_2594780_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_083988061.1|2594868_2595780_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_066846902.1|2595866_2597804_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	42.2	6.1e-113
WP_066846905.1|2597865_2598339_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_066846916.1|2598335_2599385_-	DUF3667 domain-containing protein	NA	NA	NA	NA	NA
WP_066846919.1|2599501_2599846_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_066846921.1|2599968_2601153_+	phosphatidylserine/phosphatidylglycerophosphate/ cardiolipin synthase family protein	NA	NA	NA	NA	NA
WP_066846926.1|2601431_2601989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066846927.1|2601988_2602288_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066846931.1|2602398_2602941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066846934.1|2603048_2603906_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_066846936.1|2604015_2604693_-	endonuclease III	NA	NA	NA	NA	NA
WP_066846939.1|2604692_2605421_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_083988062.1|2605456_2605990_+	hypothetical protein	NA	A0A2I7S9Y2	Vibrio_phage	39.6	4.7e-15
WP_157668220.1|2606027_2607167_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_066846942.1|2607211_2608291_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_083987908.1|2608596_2610123_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_157668221.1|2610119_2612579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668222.1|2612622_2613033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083987909.1|2613151_2613619_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_066846364.1|2614003_2615083_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_066846946.1|2616693_2617035_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	57.3	1.9e-30
WP_066848315.1|2617031_2617406_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_066849123.1|2617691_2618780_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157668223.1|2618857_2619412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066846948.1|2619514_2620033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668224.1|2620169_2620472_-	MafI family immunity protein	NA	NA	NA	NA	NA
WP_083988063.1|2620914_2621862_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
2621592:2621608	attR	GGACGTCCTCGTCGGTC	NA	NA	NA	NA
WP_157668225.1|2621919_2623005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668226.1|2624136_2624730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910515.1|2625351_2625996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066849129.1|2626151_2627696_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_066846961.1|2627860_2629363_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_066846964.1|2629359_2630196_+	AAA domain-containing protein	NA	U5N3V8	Enterobacteria_phage	37.7	5.3e-37
WP_066849129.1|2630304_2631849_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_066849131.1|2632126_2633164_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	30.4	1.1e-15
WP_066561326.1|2633474_2634296_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_066846966.1|2635155_2636172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085995949.1|2636625_2637989_-|transposase	IS3 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	24.0	4.5e-09
WP_157668227.1|2638041_2638254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910516.1|2638270_2638681_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_066846970.1|2638811_2639045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668228.1|2639140_2639404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668229.1|2639475_2639625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066846985.1|2640064_2642338_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_066849134.1|2642607_2645217_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	29.3	6.5e-17
WP_066846987.1|2645273_2645708_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_066846989.1|2645725_2646049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066846991.1|2646119_2646698_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_066846994.1|2646714_2646942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066846996.1|2647019_2647871_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_066846997.1|2648191_2648800_+	HNH endonuclease	NA	H6WG01	Cyanophage	37.0	2.9e-16
WP_066846998.1|2648832_2649396_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_083988064.1|2649417_2650431_-	ferrochelatase	NA	NA	NA	NA	NA
WP_083988065.1|2650475_2652935_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_083988066.1|2653018_2654023_-	Mrp/NBP35 family ATP-binding protein	NA	NA	NA	NA	NA
WP_066849139.1|2654250_2655390_+|protease	protease modulator HflK	protease	NA	NA	NA	NA
WP_066847002.1|2655389_2656241_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 1
NZ_CP019603	Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence	761621	161141	227875	761621	holin,transposase,integrase	Escherichia_phage(14.29%)	55	187215:187229	228245:228259
WP_066849713.1|161141_162677_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	25.5	2.7e-18
WP_066849716.1|162666_163473_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	32.9	7.1e-31
WP_066849719.1|166015_168553_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_066849722.1|169331_170588_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157668258.1|170653_172618_-	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_083988096.1|172677_174771_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_066561326.1|174793_175615_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157668259.1|175659_175944_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_066849737.1|176109_178218_+	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_066849739.1|178294_180373_-	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_066849741.1|180622_181459_-	dienelactone hydrolase	NA	NA	NA	NA	NA
WP_066849743.1|181484_182804_-	MFS transporter	NA	NA	NA	NA	NA
WP_066849745.1|182838_183195_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_083988098.1|183393_185820_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_066849756.1|186144_187101_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_066849760.1|187100_188468_-	phosphotransferase	NA	NA	NA	NA	NA
187215:187229	attL	CTGATCAGGTCCGGC	NA	NA	NA	NA
WP_066849763.1|188552_188990_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_066850660.1|189007_189817_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_066849766.1|190112_191336_+	cytochrome P450	NA	NA	NA	NA	NA
WP_066849774.1|191446_191746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066849777.1|191764_192463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066849783.1|193405_193708_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	36.1	7.3e-05
WP_066849786.1|193707_193989_-	plasmid maintenance system killer	NA	NA	NA	NA	NA
WP_066849789.1|194412_196977_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	34.3	1.1e-16
WP_066849791.1|197081_197282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066849793.1|197606_198830_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.5	1.7e-39
WP_157668260.1|198810_199200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066849798.1|199196_200150_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_066849801.1|200453_200942_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_157668261.1|201315_201468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668262.1|201630_201864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066849814.1|202768_203410_+	porin family protein	NA	NA	NA	NA	NA
WP_066850661.1|203673_204168_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_087910603.1|204173_205628_-	cobyric acid synthase	NA	NA	NA	NA	NA
WP_066849818.1|205615_206569_-	cobalamin biosynthesis protein CobD	NA	NA	NA	NA	NA
WP_066849821.1|206561_207554_-	pyridoxal phosphate-dependent class II aminotransferase	NA	NA	NA	NA	NA
WP_066849824.1|207535_208246_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_066849827.1|208242_208809_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_066849830.1|208805_209822_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_066849832.1|209818_210226_-	DUF1636 domain-containing protein	NA	NA	NA	NA	NA
WP_066849835.1|210225_212145_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	29.7	1.1e-05
WP_066850663.1|212973_213573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066849837.1|213569_214184_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	C7F482	Cyanophage	29.8	2.2e-08
WP_066849839.1|214180_215473_+	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_066849842.1|215881_217075_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_157668263.1|217606_218155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668264.1|218151_219528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066849852.1|220056_221061_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_066850664.1|221533_222079_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_066849855.1|222147_223113_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_066849858.1|223265_223787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066849861.1|223783_224233_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_066849863.1|224232_225087_+	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_066849865.1|227013_227394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668265.1|227326_227875_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
228245:228259	attR	GCCGGACCTGATCAG	NA	NA	NA	NA
>prophage 2
NZ_CP019603	Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence	761621	712025	741723	761621	transposase	Stx2-converting_phage(40.0%)	23	NA	NA
WP_066850611.1|712025_713669_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.3	3.6e-90
WP_066843954.1|713729_714071_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	57.3	4.3e-30
WP_066843951.1|714067_714445_-|transposase	transposase	transposase	Q76S41	Shigella_phage	29.2	3.1e-05
WP_066850612.1|714824_715655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066850613.1|715790_716183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066850614.1|716179_717439_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_066850615.1|717709_718261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066850616.1|718257_718455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668295.1|718789_719281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066850618.1|719280_720741_+	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_066846942.1|721123_722203_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157668296.1|722228_723374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066561326.1|723428_724250_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157668297.1|724493_724952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066850621.1|725476_726256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066850622.1|726565_727240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066850623.1|727262_728339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066850624.1|728335_729037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668298.1|729141_729384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066850626.1|734833_735865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066844231.1|736338_737067_-	ATPase	NA	A0A059NT77	Lactococcus_phage	37.9	1.7e-31
WP_066842340.1|737795_739019_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.5	4.4e-40
WP_066846942.1|740643_741723_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP019604	Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence	346204	113136	165409	346204	transposase	Stx2-converting_phage(57.14%)	42	NA	NA
WP_066561326.1|113136_113958_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157668309.1|113969_116246_-	TM0106 family RecB-like putative nuclease	NA	NA	NA	NA	NA
WP_066850952.1|116472_117045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066850821.1|117056_117413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066850822.1|117530_118745_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_083988191.1|118741_119044_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066850823.1|120856_122131_-	replication protein A	NA	NA	NA	NA	NA
WP_066850824.1|122293_123304_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_083988192.1|123300_124500_-	AAA family ATPase	NA	A0A1I9KF58	Aeromonas_phage	28.6	7.6e-37
WP_066850825.1|124862_128564_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_066850826.1|128563_129784_-	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_087910624.1|129985_130657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066850827.1|130705_131092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066850828.1|131143_131368_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_066850829.1|131371_131710_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_083988193.1|131791_132058_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_083988194.1|132114_134127_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_066850831.1|134123_134894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066850832.1|134890_135466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066848315.1|135748_136123_+|transposase	transposase	transposase	Q76S41	Shigella_phage	33.3	6.9e-05
WP_066843519.1|136119_136461_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	55.3	1.6e-29
WP_066843521.1|136521_138186_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.4	7.6e-112
WP_066850833.1|138334_138817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066850834.1|138809_139517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066850835.1|139516_140224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668310.1|140988_144678_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_066850837.1|145251_146706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066850955.1|146754_147558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066850838.1|148100_149552_-	caspase family protein	NA	NA	NA	NA	NA
WP_157668311.1|150089_150818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066850840.1|150830_151718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066850841.1|152811_154635_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_066850842.1|154643_156518_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_066842647.1|157103_158387_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_157668312.1|158593_159688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066850844.1|160222_160852_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_066850845.1|160997_161288_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_066850846.1|161280_161535_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_157668313.1|161755_162571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062068004.1|162988_163354_+|transposase	transposase	transposase	Q76S41	Shigella_phage	37.5	8.8e-05
WP_062068002.1|163350_163692_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	59.2	1.3e-31
WP_066850848.1|163765_165409_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.0	1.6e-109
