The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006976	Pasteurella multocida subsp. multocida HB01 chromosome, complete genome	2416068	35036	140119	2416068	transposase,integrase,tail,terminase,tRNA	Mannheimia_phage(40.32%)	113	34887:34932	81145:81190
34887:34932	attL	CATGGCATGCAAGAGGTCGTCGGTTCGATCCCGATTATCTCCACCA	NA	NA	NA	NA
WP_064775600.1|35036_36209_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	52.9	5.9e-111
WP_051127937.1|36584_36857_-	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	41.1	4.9e-08
WP_016533427.1|37155_37455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016570062.1|37464_37998_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	36.6	1.3e-20
WP_014391447.1|38132_38732_-	hypothetical protein	NA	A0A218KC93	Bacillus_phage	37.6	4.6e-19
WP_014391448.1|38782_39571_-	DUF2303 family protein	NA	C5IHK3	Burkholderia_virus	29.2	3.2e-20
WP_016570064.1|39642_39996_-	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
WP_016533530.1|40038_40230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016570065.1|40241_40706_-	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	69.0	6.1e-35
WP_064775601.1|40709_41321_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
WP_016533454.1|41313_42165_-	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	63.9	4.8e-62
WP_016570067.1|42168_43155_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	39.9	5.8e-51
WP_016570068.1|43332_43569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775602.1|43555_43840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390710.1|43906_44218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016569990.1|44279_44915_-	antirepressor	NA	A6XMM0	Bacillus_virus	53.3	2.1e-22
WP_014391102.1|45376_45910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391456.1|45997_46261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533507.1|46485_46716_-	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
WP_016533476.1|47334_47718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533477.1|47714_48194_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	47.1	8.3e-19
WP_016533478.1|48196_48460_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_064775603.1|48605_49295_-	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	1.7e-73
WP_005720263.1|49422_49632_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
WP_014391093.1|49700_49928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775604.1|49985_50687_+	DNA-binding protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	7.1e-35
WP_014390722.1|50683_51037_+	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
WP_016533442.1|51038_51941_+	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.7	5.5e-32
WP_016533441.1|51940_52630_+	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
WP_041423202.1|52639_53170_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
WP_016569985.1|53159_53618_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
WP_016533468.1|53691_53904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775605.1|53991_54594_+	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	6.3e-32
WP_016533470.1|54593_54959_+	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
WP_143930513.1|55148_55334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014391475.1|55547_55808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014667794.1|55804_56335_+	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	50.9	9.7e-45
WP_014667795.1|56307_56631_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_064775606.1|56536_56818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014390736.1|56852_57287_-	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	38.0	1.0e-20
WP_016533497.1|57315_57498_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	54.2	3.8e-09
WP_014390737.1|57580_58078_+|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	70.7	7.4e-47
WP_016533292.1|58061_59288_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	77.0	9.4e-192
WP_016533291.1|59302_60748_+	DUF1073 domain-containing protein	NA	A0A0M3LPQ5	Mannheimia_phage	58.6	2.4e-146
WP_014390740.1|60701_61673_+	hypothetical protein	NA	F1C5D8	Cronobacter_phage	41.0	1.6e-53
WP_016533290.1|61687_63034_+	hypothetical protein	NA	A0A0M3LQ78	Mannheimia_phage	55.3	4.0e-127
WP_016533289.1|63033_63468_+	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	75.7	1.1e-54
WP_016533288.1|63479_64478_+	hypothetical protein	NA	A0A0M3LQZ1	Mannheimia_phage	74.7	9.1e-145
WP_151202332.1|64488_65037_+	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	73.9	5.9e-13
WP_042743192.1|65017_65386_+	hypothetical protein	NA	A0A0M3LQS8	Mannheimia_phage	42.1	4.7e-22
WP_014390746.1|65388_65733_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	57.9	3.0e-31
WP_014390747.1|65737_66109_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	51.2	1.3e-24
WP_016533319.1|66105_66477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014390749.1|66488_66971_+|tail	phage tail protein	tail	A0A0M3LPR0	Mannheimia_phage	62.0	2.0e-44
WP_016533320.1|67024_67696_+	hypothetical protein	NA	A0A0M3LPR4	Mannheimia_phage	42.9	1.5e-42
WP_016533321.1|67726_68191_+	hypothetical protein	NA	A0A0M3LR40	Mannheimia_phage	50.0	5.2e-34
WP_016533322.1|68258_68654_+	hypothetical protein	NA	A0A0M3LR23	Mannheimia_phage	83.2	7.7e-55
WP_042743193.1|68712_71157_+|tail	tail length tape measure protein	tail	A0A0M3LSE2	Mannheimia_phage	57.0	1.6e-150
WP_014390756.1|71159_71489_+	Gifsy-1 prophage VmtM	NA	S5MW28	Escherichia_phage	37.1	3.2e-14
WP_023430089.1|71578_72292_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	63.9	2.1e-82
WP_064775607.1|72296_73040_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	60.0	1.1e-83
WP_014667799.1|72982_73603_+|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	57.4	1.1e-52
WP_064775608.1|73606_78610_+|tail	phage tail protein	tail	A0A0M3LQ61	Mannheimia_phage	38.9	1.2e-250
WP_064775609.1|78657_78984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775610.1|79123_80260_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
WP_005720092.1|80306_80723_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_005723319.1|81474_83619_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
81145:81190	attR	CATGGCATGCAAGAGGTCGTCGGTTCGATCCCGATTATCTCCACCA	NA	NA	NA	NA
WP_005723318.1|83702_84599_+	lipoprotein NlpI	NA	NA	NA	NA	NA
WP_005754621.1|84706_86539_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.7	1.8e-53
WP_014325701.1|86638_87487_-	ModD protein	NA	NA	NA	NA	NA
WP_014325702.1|87504_88104_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.5	9.7e-17
WP_016504294.1|88105_88903_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_014325704.1|89755_91390_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.6	1.7e-188
WP_005717461.1|91485_91776_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	40.0	4.5e-12
WP_005717460.1|91864_92335_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_005723307.1|92465_94037_-	AbgT family transporter	NA	NA	NA	NA	NA
WP_014325705.1|94365_95784_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_014325706.1|95919_97989_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005751822.1|98018_98399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014325707.1|98529_99153_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_014325708.1|99170_99434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005723293.1|99464_100367_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016504292.1|100648_101902_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_005723289.1|102012_102870_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_005717448.1|103122_104136_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_005717447.1|104206_104653_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_005717446.1|104807_105269_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_005723284.1|105370_106717_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005723282.1|106799_107051_+	YhdT family protein	NA	NA	NA	NA	NA
WP_014325712.1|107040_108474_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_005717441.1|108616_109498_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_005723278.1|109774_110779_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005723276.1|110759_111059_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_014325715.1|111283_115177_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	53.4	1.7e-114
WP_014325716.1|115592_116165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014325717.1|116178_117417_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	25.6	1.0e-12
WP_005720092.1|118705_119122_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
WP_064775610.1|119168_120305_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
WP_016504262.1|121743_124173_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005723258.1|124318_125056_-	ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	32.5	1.5e-14
WP_014325720.1|125067_126012_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_005717426.1|126024_126813_-	hemin ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014325721.1|127120_127675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014325722.1|128155_129235_+	endonuclease	NA	NA	NA	NA	NA
WP_010907004.1|129324_130980_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	34.9	7.4e-83
WP_005723242.1|131197_131752_-	DUF5358 domain-containing protein	NA	NA	NA	NA	NA
WP_064775613.1|133841_135503_+	putative transporter	NA	NA	NA	NA	NA
WP_005723236.1|135550_135841_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_014325723.1|136085_137396_+	porin	NA	NA	NA	NA	NA
WP_014325724.1|137458_138001_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	45.7	4.8e-23
WP_014325725.1|138010_138679_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_005717387.1|138744_139473_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	38.1	4.9e-31
WP_014325726.1|139654_140119_+|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
>prophage 2
NZ_CP006976	Pasteurella multocida subsp. multocida HB01 chromosome, complete genome	2416068	1103887	1113245	2416068		Tupanvirus(33.33%)	9	NA	NA
WP_014326205.1|1103887_1105162_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.5	1.8e-92
WP_005753554.1|1105202_1105820_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_014326206.1|1105819_1106707_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_064775639.1|1106776_1107724_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.7	1.9e-43
WP_005753553.1|1107799_1109353_-	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	49.6	8.4e-20
WP_010906540.1|1109587_1110379_+	zinc ABC transporter ATP-binding protein ZnuC	NA	A0A2K9L3Z8	Tupanvirus	32.8	3.7e-16
WP_005724066.1|1110387_1111173_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_005724065.1|1111249_1112230_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	1.3e-15
WP_014326208.1|1112246_1113245_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	2.3e-15
>prophage 3
NZ_CP006976	Pasteurella multocida subsp. multocida HB01 chromosome, complete genome	2416068	1464331	1520613	2416068	holin,capsid,transposase,integrase,tail,terminase	Mannheimia_phage(36.17%)	75	1470211:1470261	1521065:1521115
WP_014326374.1|1464331_1467163_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.3	0.0e+00
WP_005719438.1|1467334_1467835_+	single-stranded DNA-binding protein	NA	I3PUY5	Vibrio_phage	55.6	4.0e-40
WP_014325726.1|1468017_1468482_+|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	36.1	2.3e-13
WP_005725034.1|1469058_1469913_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	40.3	5.8e-31
1470211:1470261	attL	CTTCTAAGCCGTAGGTCATTGGTTCGAATCCAATAGGGCGTGCCATTAATT	NA	NA	NA	NA
WP_014391441.1|1470287_1471343_-|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	37.9	1.6e-62
WP_075271365.1|1471246_1471549_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014391442.1|1471732_1472455_-	DNA-binding protein	NA	G0ZND1	Cronobacter_phage	52.5	3.3e-35
WP_064775645.1|1472465_1472687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015691048.1|1472931_1473840_-	hypothetical protein	NA	A0A0M4S6X1	Salmonella_phage	36.1	2.5e-40
WP_064775646.1|1473943_1474432_-	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	51.2	3.2e-34
WP_080637896.1|1474443_1474656_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_016533502.1|1474643_1475009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775647.1|1475005_1475605_-	hypothetical protein	NA	A0A218KC93	Bacillus_phage	34.2	3.9e-18
WP_014391448.1|1475655_1476444_-	DUF2303 family protein	NA	C5IHK3	Burkholderia_virus	29.2	3.2e-20
WP_016570064.1|1476515_1476869_-	hypothetical protein	NA	I6XKT1	Burkholderia_virus	31.8	1.7e-05
WP_016533530.1|1476911_1477103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016570065.1|1477114_1477579_-	single-stranded DNA-binding protein	NA	A0A2I7RK19	Vibrio_phage	69.0	6.1e-35
WP_064775601.1|1477582_1478194_-	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	76.4	6.3e-88
WP_016533454.1|1478186_1479038_-	phage recombination protein Bet	NA	A0A2H4JAQ4	uncultured_Caudovirales_phage	63.9	4.8e-62
WP_016570067.1|1479041_1480028_-	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	39.9	5.8e-51
WP_016570068.1|1480205_1480442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775602.1|1480428_1480713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014390710.1|1480779_1481091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016569990.1|1481152_1481788_-	antirepressor	NA	A6XMM0	Bacillus_virus	53.3	2.1e-22
WP_014391102.1|1482249_1482783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014391456.1|1482870_1483134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533507.1|1483358_1483589_-	hypothetical protein	NA	A0A0M3LNV4	Mannheimia_phage	52.8	3.4e-10
WP_016533476.1|1484207_1484591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533477.1|1484587_1485067_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	47.1	8.3e-19
WP_016533478.1|1485069_1485333_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_064775603.1|1485478_1486168_-	helix-turn-helix transcriptional regulator	NA	Q7Y5W5	Haemophilus_phage	58.2	1.7e-73
WP_005720263.1|1486295_1486505_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	52.3	5.5e-12
WP_014391093.1|1486573_1486801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775604.1|1486858_1487560_+	DNA-binding protein	NA	A0A2I7RHG4	Vibrio_phage	55.8	7.1e-35
WP_014390722.1|1487556_1487910_+	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	33.6	1.3e-08
WP_016533442.1|1487911_1488814_+	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	37.7	5.5e-32
WP_016533441.1|1488813_1489503_+	replication protein P	NA	D0UIL4	Aggregatibacter_phage	34.1	1.4e-32
WP_041423202.1|1489512_1490043_+	phage N-6-adenine-methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	58.9	1.0e-54
WP_016569985.1|1490032_1490491_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	53.4	5.8e-38
WP_016533468.1|1490564_1490777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775605.1|1490864_1491467_+	recombinase NinG	NA	H6WRY9	Salmonella_phage	38.2	6.3e-32
WP_016533470.1|1491466_1491832_+	hypothetical protein	NA	A0A0M3LR87	Mannheimia_phage	27.3	3.5e-09
WP_143930513.1|1492021_1492207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533461.1|1492420_1492786_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_016533462.1|1492757_1493342_+	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	55.3	6.5e-58
WP_016569983.1|1493344_1493668_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_064775648.1|1493946_1494303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775649.1|1494432_1494687_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064775650.1|1494674_1495055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775651.1|1495193_1495895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533416.1|1495881_1496310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081273988.1|1496625_1497216_+	hypothetical protein	NA	A0A2H4J1J5	uncultured_Caudovirales_phage	39.5	4.9e-21
WP_064775652.1|1497218_1498490_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	61.7	8.6e-148
WP_064775653.1|1498499_1499903_+	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	59.6	4.4e-153
WP_064775738.1|1499892_1501494_+|capsid	minor capsid protein	capsid	A0A0M3LQ07	Mannheimia_phage	52.1	3.3e-152
WP_015691070.1|1501496_1501715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691071.1|1501689_1502124_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	D0UIJ3	Aggregatibacter_phage	61.2	3.1e-41
WP_015691073.1|1502459_1503230_+	hypothetical protein	NA	A0A1V0DY60	Dinoroseobacter_phage	36.2	1.5e-25
WP_015691074.1|1503247_1504405_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	43.3	8.3e-81
WP_015691075.1|1504461_1504698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691076.1|1504714_1505182_+	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	55.7	1.4e-34
WP_015691077.1|1505183_1505558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015691078.1|1505559_1505961_+	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	61.4	2.1e-39
WP_015691079.1|1505960_1506353_+	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	46.2	5.5e-29
WP_016533104.1|1506365_1507382_+	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	69.9	7.6e-131
WP_016533103.1|1507454_1507871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016533102.1|1508240_1508570_+|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	49.1	4.8e-26
WP_064775655.1|1508874_1509570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775657.1|1512403_1513108_+|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	64.1	1.6e-82
WP_064775658.1|1513110_1513851_+	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	60.0	1.3e-84
WP_042743292.1|1513793_1514384_+|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	57.1	3.1e-52
WP_064775659.1|1514387_1518500_+|tail	phage tail protein	tail	A0A0M3LQG1	Mannheimia_phage	40.6	9.3e-236
WP_064775609.1|1518547_1518874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064775610.1|1519013_1520150_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	58.0	3.8e-123
WP_005720092.1|1520196_1520613_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	63.5	3.3e-48
1521065:1521115	attR	CTTCTAAGCCGTAGGTCATTGGTTCGAATCCAATAGGGCGTGCCATTAATT	NA	NA	NA	NA
>prophage 4
NZ_CP006976	Pasteurella multocida subsp. multocida HB01 chromosome, complete genome	2416068	2265543	2338167	2416068	plate,head,transposase,integrase,tail,tRNA	Vibrio_phage(22.58%)	80	2283355:2283369	2298992:2299006
WP_005723723.1|2265543_2266575_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	1.1e-111
WP_005717662.1|2266595_2266832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005717659.1|2266833_2267412_+	thymidine kinase	NA	A0A1Z1LZ42	Serratia_phage	52.1	2.4e-52
WP_015702704.1|2267499_2268855_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_015702705.1|2268951_2269797_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_015702706.1|2269957_2270539_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_015702707.1|2270541_2271429_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_016504289.1|2271539_2272952_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_015702709.1|2272983_2275545_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_015702710.1|2275680_2276454_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_015702711.1|2276493_2277009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005751903.1|2277008_2277533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015702712.1|2277535_2277898_+	protein ComD	NA	NA	NA	NA	NA
WP_015702713.1|2277907_2279242_+	type IV pilus secretin PilQ	NA	NA	NA	NA	NA
WP_005717623.1|2279424_2279952_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_005754750.1|2279968_2281057_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_005723696.1|2281060_2281966_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.9	1.8e-62
WP_005723691.1|2282012_2282318_-	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_005723689.1|2282410_2282722_+	DUF2547 family protein	NA	NA	NA	NA	NA
WP_005754746.1|2282805_2285493_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
2283355:2283369	attL	TTTGATTATTTACGT	NA	NA	NA	NA
WP_005717611.1|2285585_2285987_+	8-oxo-dGTP diphosphatase MutT	NA	NA	NA	NA	NA
WP_005717609.1|2286052_2286319_-	DUF5339 domain-containing protein	NA	NA	NA	NA	NA
WP_016533093.1|2286447_2287527_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_005723681.1|2287526_2288030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533094.1|2288085_2290668_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	41.9	4.5e-188
WP_064775695.1|2290876_2293171_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_005717653.1|2294112_2294958_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_064775740.1|2295272_2296271_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	60.7	1.7e-106
WP_005723677.1|2296415_2296721_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_005723675.1|2296730_2297084_-	mercuric transporter MerT	NA	NA	NA	NA	NA
WP_064775696.1|2297055_2298108_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_016570130.1|2298292_2298472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775698.1|2301003_2301570_-|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	46.4	5.3e-41
2298992:2299006	attR	ACGTAAATAATCAAA	NA	NA	NA	NA
WP_064775699.1|2301562_2302675_-|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	35.6	3.6e-57
WP_064775741.1|2302664_2303030_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_064775700.1|2303082_2303664_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_064775701.1|2303678_2304731_-	hypothetical protein	NA	A4JWL3	Burkholderia_virus	40.3	2.1e-59
WP_064775702.1|2304730_2304952_-	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	43.3	8.5e-11
WP_064775703.1|2304939_2305890_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_064775704.1|2305898_2308202_-|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	38.1	4.2e-68
WP_064775705.1|2308241_2308433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075284997.1|2308429_2308552_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_064775706.1|2308578_2308857_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_064775707.1|2308939_2309455_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_101766767.1|2309454_2310849_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	47.3	5.1e-109
WP_064775709.1|2310855_2311323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775710.1|2311322_2311772_-	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_064775711.1|2311771_2312230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775712.1|2312282_2313209_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	49.3	1.7e-76
WP_064775713.1|2313218_2314322_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	41.8	3.3e-71
WP_064775714.1|2314558_2315014_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_064775715.1|2315215_2315404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775742.1|2315540_2316806_-|head	phage head morphogenesis protein	head	J9STS2	Pseudomonas_phage	44.4	3.1e-65
WP_151202333.1|2316807_2318250_-	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	53.5	2.6e-116
WP_064775743.1|2318245_2319718_-	hypothetical protein	NA	M1NVQ0	Vibrio_phage	62.1	6.0e-161
WP_064775717.1|2319804_2320386_-	DUF3486 family protein	NA	A0A2I7S9D1	Vibrio_phage	44.5	2.4e-36
WP_064775718.1|2320408_2320711_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	60.4	2.2e-25
WP_064775719.1|2320707_2321037_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_064775721.1|2321154_2321415_-	DUF2681 domain-containing protein	NA	NA	NA	NA	NA
WP_064775722.1|2321411_2321639_-	DUF2644 domain-containing protein	NA	F6MIK0	Haemophilus_phage	72.4	6.0e-20
WP_064775723.1|2321649_2322186_-	N-acetylmuramoyl-L-alanine amidase	NA	F6MIJ9	Haemophilus_phage	69.1	1.1e-72
WP_064775724.1|2322263_2322626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775725.1|2322700_2323075_-	transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	46.2	3.3e-23
WP_064775726.1|2323074_2323620_-	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	44.1	1.8e-38
WP_064775727.1|2323616_2324123_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	32.7	5.0e-14
WP_064775728.1|2324196_2324898_-	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	30.6	3.9e-17
WP_061406041.1|2324906_2325122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061406042.1|2325139_2325331_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061406043.1|2325408_2325927_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	64.3	2.3e-54
WP_046339044.1|2325919_2326159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775729.1|2326368_2326614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775730.1|2326634_2326838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016533375.1|2326837_2327755_-	AAA family ATPase	NA	A0A2I7S9C3	Vibrio_phage	43.4	2.3e-62
WP_064775731.1|2327781_2329785_-|transposase	transposase	transposase	M4M9R2	Vibrio_phage	35.2	1.0e-94
WP_064775732.1|2329768_2330005_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	57.1	3.7e-12
WP_081273992.1|2330244_2330718_+	ci repressor-like protein	NA	NA	NA	NA	NA
WP_064775694.1|2332893_2334762_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.8	4.5e-36
WP_005751910.1|2334837_2336586_-	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	32.6	1.1e-41
WP_005717672.1|2336701_2336917_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005723723.1|2337135_2338167_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	1.1e-111
