The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014762	Klebsiella pneumoniae strain KPNIH39 chromosome, complete genome	5351509	79814	156710	5351509	portal,capsid,integrase,plate,tail,tRNA,head,protease,terminase	Enterobacteria_phage(42.11%)	84	83997:84038	119232:119273
WP_002882894.1|79814_80435_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
WP_004187877.1|80507_81182_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_002882898.1|81249_82623_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
WP_002882901.1|82619_83318_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
WP_004178004.1|83467_83971_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
83997:84038	attL	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTT	NA	NA	NA	NA
WP_064798288.1|84156_85137_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	82.7	5.2e-153
WP_042944001.1|85206_85500_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	76.3	5.9e-36
WP_048272240.1|85654_85927_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	85.6	6.3e-40
WP_049074458.1|85953_86172_+	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	9.6e-07
WP_048756373.1|86184_86424_+	DUF4754 family protein	NA	NA	NA	NA	NA
WP_032415217.1|86426_86699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064798289.1|86767_86992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032414429.1|86988_87567_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	40.0	9.3e-33
WP_064798290.1|87575_88544_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	50.8	6.0e-77
WP_023279599.1|88530_88704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153649041.1|88714_88867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279597.1|88889_89051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064798291.1|89027_89405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064798292.1|89403_91998_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	53.0	9.8e-199
WP_040172224.1|92043_92844_+	trypsin-like peptidase domain-containing protein	NA	A0A2H4JE36	uncultured_Caudovirales_phage	36.0	6.4e-32
WP_040172221.1|93324_93825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040172218.1|93851_94904_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.1	6.9e-143
WP_040172216.1|94903_96625_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.0	6.2e-226
WP_040172213.1|96785_97619_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.6	3.2e-95
WP_040172210.1|97643_98693_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.0	1.5e-105
WP_040172207.1|98740_99640_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	77.0	3.5e-87
WP_040172204.1|99742_100240_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	71.5	5.3e-61
WP_040172202.1|100239_100440_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	64.6	1.5e-14
WP_040172200.1|100430_100712_+	hypothetical protein	NA	B9A7B8	Serratia_phage	58.4	6.3e-19
WP_040172197.1|100708_101260_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	40.2	3.9e-28
WP_077268198.1|101500_101800_+	peptidase	NA	NA	NA	NA	NA
WP_040172192.1|101796_102255_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	47.7	3.7e-32
WP_040172190.1|102251_102893_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	47.3	1.3e-43
WP_040172189.1|102892_103477_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.4	3.9e-63
WP_032427152.1|103473_103839_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	58.3	7.9e-30
WP_040172186.1|103825_104725_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	59.5	4.9e-89
WP_040172183.1|104717_105314_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	48.8	2.5e-41
WP_148721850.1|105317_107120_+	hypothetical protein	NA	S6C390	Klebsiella_phage	29.6	3.0e-53
WP_142908617.1|107127_108807_+	hypothetical protein	NA	A0A2H4YGX0	Raoultella_phage	35.5	9.5e-86
WP_032427147.1|108813_109062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040172173.1|109110_110403_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	47.1	3.7e-45
WP_040172170.1|110501_110990_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.7	3.1e-53
WP_064798294.1|111002_113957_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	45.8	8.5e-215
WP_148721852.1|113946_114120_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	68.8	3.0e-11
WP_040172163.1|114116_114416_-	hypothetical protein	NA	B9A7B2	Serratia_phage	76.0	5.9e-31
WP_032424801.1|114470_114986_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.6	1.5e-63
WP_040172159.1|114985_116167_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	1.6e-156
WP_064798295.1|116320_117475_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	80.9	7.2e-178
WP_019724745.1|117519_117768_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_064798486.1|117878_118211_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_064798296.1|118215_119112_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_002882907.1|119364_120267_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
119232:119273	attR	CACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTT	NA	NA	NA	NA
WP_002882911.1|120463_121426_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002882913.1|121487_121973_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_002882914.1|122065_122986_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002882917.1|123055_124390_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
WP_002882918.1|124399_124930_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_002882919.1|125021_125990_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_002882921.1|126083_127112_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_004177997.1|127262_129458_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_002882922.1|129710_129923_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002882924.1|130024_130342_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_004150388.1|130609_131770_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_002882944.1|131772_134205_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_064798297.1|134179_135316_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_004187859.1|135454_137011_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_002882947.1|137048_137420_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004187855.1|137511_138420_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002882952.1|138648_139536_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_004177983.1|139679_140561_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004146274.1|140624_141728_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_004177977.1|141782_142445_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	4.6e-28
WP_004187845.1|142650_143637_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004177973.1|143661_144312_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_004181636.1|144355_147007_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_004177969.1|147265_148417_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_004181637.1|148530_149535_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_004187843.1|149541_150318_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_004187840.1|150417_151791_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_002883015.1|152049_152967_+	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_002883016.1|152949_154350_-	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_004151856.1|154546_155182_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_002883021.1|155197_155557_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_002883023.1|155609_156710_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP014762	Klebsiella pneumoniae strain KPNIH39 chromosome, complete genome	5351509	1827900	1837363	5351509	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_004191152.1|1827900_1829016_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004191149.1|1829012_1830953_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	2.5e-37
WP_002896516.1|1831029_1831251_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1831576_1831894_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1831924_1834204_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1834323_1834542_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1834895_1835597_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004191145.1|1835641_1837363_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.2e-14
>prophage 3
NZ_CP014762	Klebsiella pneumoniae strain KPNIH39 chromosome, complete genome	5351509	2069596	2151138	5351509	portal,capsid,holin,transposase,integrase,tail,tRNA,head,protease,terminase	Escherichia_phage(15.69%)	98	2061548:2061565	2158592:2158609
2061548:2061565	attL	GACGGTGGGGTTTGGCGT	NA	NA	NA	NA
WP_004190938.1|2069596_2070088_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004176560.1|2070225_2071347_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004147969.1|2071432_2072899_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_004150807.1|2072898_2073570_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_004179353.1|2073852_2074659_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023279125.1|2074742_2075105_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004190926.1|2075159_2076530_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	4.7e-107
WP_004190923.1|2076533_2077175_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_004190921.1|2077229_2078336_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|2078392_2078851_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|2078867_2079518_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|2079758_2081009_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_000741346.1|2081121_2082264_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	82.2	9.1e-173
WP_000089156.1|2082253_2082490_-	excisionase	NA	NA	NA	NA	NA
WP_040176407.1|2082790_2083009_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	3.5e-09
WP_040176408.1|2083001_2083397_-	hypothetical protein	NA	A0A077K9V6	Edwardsiella_phage	33.8	1.0e-06
WP_004864289.1|2083393_2083909_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	76.4	2.9e-70
WP_021314787.1|2084252_2085329_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.4	2.8e-147
WP_032434886.1|2085456_2086242_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	2.9e-61
WP_029497329.1|2086241_2086541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044067386.1|2086630_2087548_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.5	8.9e-46
WP_000690183.1|2088340_2089036_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	2.7e-87
WP_001191665.1|2089133_2089376_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_064798339.1|2089410_2089872_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.5	8.4e-69
WP_001208720.1|2090109_2090289_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_024176409.1|2090278_2091232_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	75.5	3.7e-103
WP_064798340.1|2091228_2092038_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	70.0	1.6e-110
WP_000779146.1|2092047_2092425_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_064164646.1|2092437_2093418_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	1.1e-134
WP_004899672.1|2093431_2094010_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_009310076.1|2094738_2095719_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_040221209.1|2096289_2096856_+	hypothetical protein	NA	S5FXQ0	Shigella_phage	27.7	5.6e-06
WP_017145563.1|2097016_2097412_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|2097398_2097680_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_023316711.1|2097679_2098309_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.4	1.5e-105
WP_064798342.1|2098316_2098592_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	51.7	3.2e-15
WP_032426434.1|2098765_2098966_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	65.1	7.9e-16
WP_064172986.1|2099030_2099276_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	64.2	2.5e-19
WP_071953818.1|2099787_2100138_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.0	6.0e-51
WP_023316719.1|2100293_2100791_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.0	1.9e-63
WP_004206689.1|2100794_2102546_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.2	5.2e-252
WP_064798344.1|2102693_2103920_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	84.8	1.2e-207
WP_000999827.1|2103912_2104512_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_064798345.1|2104521_2105760_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	67.5	1.0e-153
WP_023316722.1|2105837_2106155_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	4.8e-23
WP_031592512.1|2106163_2106502_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.9	3.3e-38
WP_019705270.1|2106498_2106948_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_064798346.1|2106944_2107292_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	62.8	3.1e-31
WP_064798347.1|2107348_2108053_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.1	9.5e-80
WP_040204832.1|2108083_2108488_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.2	5.0e-33
WP_040204831.1|2108490_2108796_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	67.7	3.3e-29
WP_064798348.1|2108869_2109103_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	48.6	1.4e-08
WP_064798349.1|2109162_2112549_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.6	5.2e-301
WP_004177132.1|2112569_2113043_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_004864228.1|2113029_2113506_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_031592495.1|2113518_2113899_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	84.1	5.3e-61
WP_064798350.1|2113895_2116973_+	kinase	NA	A0A286S259	Klebsiella_phage	62.3	0.0e+00
WP_064798351.1|2119091_2119964_+	hypothetical protein	NA	A0A2H4N7C5	Pectobacterium_phage	26.5	2.1e-12
WP_023284988.1|2121784_2122156_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.9	8.3e-27
WP_004892953.1|2122334_2122487_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_004190918.1|2122759_2123473_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004190914.1|2123469_2123862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150797.1|2123854_2124178_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_020805510.1|2124297_2124474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140530.1|2124627_2124855_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004190910.1|2124967_2126161_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004190907.1|2126228_2126564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150795.1|2126783_2126969_+	general stress protein	NA	NA	NA	NA	NA
WP_004148027.1|2127059_2127554_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004190904.1|2127580_2128087_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004179357.1|2128103_2128991_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140511.1|2129046_2130453_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004183659.1|2130449_2131460_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140506.1|2131575_2131773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190902.1|2132339_2132972_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_015958198.1|2133011_2133182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|2133580_2134267_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004140498.1|2134379_2134544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140497.1|2134577_2136086_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150788.1|2136206_2137097_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190899.1|2137103_2138888_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004190896.1|2138960_2140169_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150784.1|2140471_2141515_+	type II asparaginase	NA	NA	NA	NA	NA
WP_064798352.1|2142176_2143091_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	2.5e-72
WP_004150783.1|2143180_2143819_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004190891.1|2143949_2144213_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|2144272_2144398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213093.1|2144515_2144590_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|2144589_2144691_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004176549.1|2144748_2145762_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
WP_004190888.1|2146062_2146302_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_072196459.1|2146291_2146630_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_004190885.1|2146634_2147144_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004140471.1|2147289_2147982_+	CTP synthase	NA	NA	NA	NA	NA
WP_072200170.1|2148013_2149189_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140469.1|2149296_2150091_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|2150074_2150521_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901088.1|2150637_2151138_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
2158592:2158609	attR	GACGGTGGGGTTTGGCGT	NA	NA	NA	NA
>prophage 4
NZ_CP014762	Klebsiella pneumoniae strain KPNIH39 chromosome, complete genome	5351509	2242636	2310334	5351509	holin,integrase,tail,protease,terminase	Salmonella_phage(20.0%)	80	2253714:2253730	2277102:2277118
WP_002901758.1|2242636_2243683_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_002901761.1|2243730_2243982_-	YciN family protein	NA	NA	NA	NA	NA
WP_002901763.1|2244388_2246986_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.6	2.9e-89
WP_002901772.1|2247331_2248306_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_002901776.1|2248551_2248719_+	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_004176472.1|2249107_2251780_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_002901778.1|2251826_2252429_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.2e-43
WP_002901779.1|2252592_2253360_+	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_002901780.1|2253495_2253804_+	LapA family protein	NA	NA	NA	NA	NA
2253714:2253730	attL	CGCGGAGCGGAAAATTA	NA	NA	NA	NA
WP_002901781.1|2253810_2254980_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_004151907.1|2255171_2255909_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_004190739.1|2255908_2256235_+	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_002901783.1|2256366_2256585_-	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_002901785.1|2256860_2257610_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002901786.1|2257681_2257861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002901787.1|2258019_2259954_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.6	7.0e-08
WP_020802459.1|2260035_2261193_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004140277.1|2261383_2262172_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_023279113.1|2262370_2262913_-	HutD family protein	NA	NA	NA	NA	NA
WP_031593531.1|2263160_2264540_+	cytosine permease	NA	NA	NA	NA	NA
WP_004140269.1|2264584_2265394_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|2265395_2266388_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|2266387_2267278_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_064798354.1|2267424_2268642_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	3.3e-120
WP_004892750.1|2268862_2269102_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.1	8.0e-23
WP_012542038.1|2269109_2269418_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	4.2e-24
WP_064798355.1|2269414_2270080_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	62.2	1.5e-66
WP_064798356.1|2270114_2271224_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	88.1	3.1e-186
WP_064798357.1|2271236_2274287_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	56.9	5.2e-292
WP_016946289.1|2274424_2274580_-	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	74.5	2.6e-14
WP_004179600.1|2274588_2274780_-	YebW family protein	NA	NA	NA	NA	NA
WP_050485525.1|2275168_2275603_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.0	2.3e-15
WP_023320775.1|2275707_2275935_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	50.0	3.4e-15
WP_023301222.1|2275937_2276474_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	68.3	2.4e-59
WP_064798358.1|2276485_2276749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064798359.1|2276826_2277747_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	61.3	1.7e-92
2277102:2277118	attR	CGCGGAGCGGAAAATTA	NA	NA	NA	NA
WP_064798360.1|2277743_2278487_+	Replication protein P	NA	A0A0K2FIT1	Enterobacteria_phage	58.1	1.4e-70
WP_064798361.1|2278479_2278848_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	4.9e-11
WP_004216517.1|2279039_2279294_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.7	5.3e-09
WP_004216515.1|2279596_2280511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004216513.1|2280507_2281248_+	HIRAN domain-containing protein	NA	NA	NA	NA	NA
WP_124060728.1|2281542_2281920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077254392.1|2282827_2283052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105166445.1|2283125_2283725_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	78.4	5.6e-89
WP_032418472.1|2283933_2284230_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.9	4.6e-36
WP_023282412.1|2284226_2284583_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	64.1	1.5e-41
WP_023282413.1|2284698_2285520_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.1	4.0e-98
WP_001294159.1|2286213_2286600_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_071603196.1|2286586_2286868_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	47.3	2.4e-18
WP_023282414.1|2286867_2287497_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	74.4	9.3e-87
WP_064798364.1|2287499_2287775_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	38.2	4.2e-07
WP_032418475.1|2287725_2287920_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	90.6	2.2e-26
WP_023282416.1|2287916_2288210_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	71.1	1.3e-30
WP_023282417.1|2288664_2288886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023282418.1|2288958_2289153_+	hypothetical protein	NA	A0A1L6Z528	Klebsiella_phage	73.3	3.3e-19
WP_064798365.1|2289556_2289802_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	95.1	2.7e-34
WP_023325165.1|2290150_2291146_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.1e-38
WP_016946682.1|2291129_2292443_+|terminase	terminase	terminase	A0A0S2SYF1	Pseudomonas_phage	73.6	2.2e-183
WP_047694609.1|2292444_2293845_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	4.1e-127
WP_040221886.1|2293828_2294941_+	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	55.2	2.8e-110
WP_016946679.1|2295025_2295811_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_064798366.1|2295821_2296775_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.0	1.9e-131
WP_158237057.1|2296783_2297056_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_023300922.1|2297096_2297492_+	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
WP_004190649.1|2297493_2297748_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_004190646.1|2297757_2297991_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_064798367.1|2297977_2298361_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	9.2e-21
WP_064798368.1|2298362_2298914_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.3	1.5e-27
WP_004190640.1|2298910_2299303_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_064798369.1|2299326_2300499_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	2.1e-23
WP_008807841.1|2300552_2301035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016946674.1|2301172_2301379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217333.1|2301455_2301812_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_050495392.1|2301922_2302291_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	42.9	1.9e-15
WP_064798370.1|2302364_2305019_+|tail	phage tail length tape measure family protein	tail	A0A2D1GPC9	Escherichia_phage	34.5	6.7e-86
WP_031591816.1|2305102_2305438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031591815.1|2305751_2306216_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_064185972.1|2306396_2306879_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	94.4	2.2e-80
WP_064798371.1|2306888_2307269_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	94.4	4.0e-69
WP_064798372.1|2307265_2310334_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	98.0	0.0e+00
>prophage 5
NZ_CP014762	Klebsiella pneumoniae strain KPNIH39 chromosome, complete genome	5351509	2352625	2430236	5351509	portal,capsid,holin,integrase,plate,transposase,tail,head,protease,terminase	Klebsiella_phage(57.89%)	85	2346767:2346782	2379358:2379373
2346767:2346782	attL	CGATAGTGGGCCAGCG	NA	NA	NA	NA
WP_004176437.1|2352625_2353387_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.3e-21
WP_032427976.1|2353603_2355136_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.5e-21
WP_016197745.1|2355334_2355883_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_023328653.1|2356079_2357261_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	83.5	3.1e-200
WP_004198241.1|2357241_2357433_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	3.9e-20
WP_023328651.1|2357568_2357970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023328650.1|2357966_2358191_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	91.9	8.3e-30
WP_032428838.1|2358180_2358906_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	85.0	3.4e-109
WP_032430926.1|2358911_2359430_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	97.1	5.5e-93
WP_023304718.1|2359534_2360362_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	9.3e-111
WP_023328648.1|2360358_2360547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023328647.1|2360543_2360969_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	5.9e-53
WP_023328645.1|2361155_2361410_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	92.9	3.2e-38
WP_023304721.1|2361402_2361768_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
WP_019705436.1|2361768_2361993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019705435.1|2362163_2362358_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	50.0	4.5e-08
WP_019705434.1|2362347_2362656_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	56.3	3.9e-22
WP_023328643.1|2362814_2363522_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	49.8	1.5e-53
WP_071953780.1|2363646_2363874_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	60.0	1.5e-15
WP_032430925.1|2363949_2364138_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_023328642.1|2364134_2364965_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	66.2	1.1e-79
WP_023328641.1|2364976_2365855_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.9	1.4e-85
WP_023328640.1|2365851_2367231_+	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	64.7	8.1e-160
WP_023328639.1|2367217_2367586_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	58.6	5.2e-37
WP_023328637.1|2367667_2368144_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	77.8	1.1e-68
WP_023328636.1|2368140_2368923_+	antitermination protein	NA	F1C595	Cronobacter_phage	79.5	7.7e-115
WP_032430945.1|2369076_2369334_+	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	97.6	5.4e-41
WP_031280381.1|2369239_2369686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017145563.1|2370249_2370645_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|2370631_2370913_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_023304728.1|2370912_2371542_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
WP_031591484.1|2371549_2371825_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	44.4	4.7e-11
WP_031591489.1|2372060_2372345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304730.1|2372477_2372750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408647.1|2373074_2373311_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	94.9	1.6e-31
WP_023301206.1|2373391_2373598_+	DUF551 domain-containing protein	NA	A0A286N2R2	Klebsiella_phage	97.1	5.1e-34
WP_017880218.1|2373669_2373960_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	99.0	1.4e-53
WP_017880219.1|2373972_2374182_+	hypothetical protein	NA	A0A286N2R4	Klebsiella_phage	100.0	7.0e-31
WP_004143905.1|2374304_2374739_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_064798377.1|2374748_2376281_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	99.6	1.1e-295
WP_064798378.1|2376283_2377561_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	99.5	1.8e-246
WP_004216821.1|2377566_2378247_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
WP_064798379.1|2378258_2379422_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.2	2.9e-211
2379358:2379373	attR	CGCTGGCCCACTATCG	NA	NA	NA	NA
WP_044067369.1|2379458_2379701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040229903.1|2379648_2379975_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	99.1	1.7e-55
WP_040229906.1|2380035_2380248_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	74.3	3.2e-15
WP_040213580.1|2380249_2380582_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	2.0e-56
WP_031591507.1|2380574_2381114_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	95.5	2.8e-92
WP_000561415.1|2381110_2381476_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	3.9e-61
WP_040221233.1|2381532_2382024_+|tail	phage major tail protein	tail	A0A286S1Q8	Klebsiella_phage	99.4	5.0e-88
WP_023339171.1|2382067_2382421_+|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	98.3	2.4e-60
WP_040229635.1|2382453_2382717_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	97.7	3.4e-43
WP_042346245.1|2382780_2383173_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	42.2	3.6e-20
WP_040229637.1|2383242_2385678_+|tail	phage tail length tape measure protein	tail	A0A286S1S3	Klebsiella_phage	89.3	0.0e+00
WP_004899614.1|2385677_2386157_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.7	1.7e-93
WP_023328628.1|2386143_2386626_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	96.2	6.3e-83
WP_017880229.1|2386635_2387016_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_023328626.1|2387012_2390081_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_023328624.1|2392200_2393073_+	hypothetical protein	NA	A0A2H4N7C5	Pectobacterium_phage	26.4	2.8e-12
WP_023328623.1|2393175_2393415_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	53.2	9.5e-16
WP_023328622.1|2393414_2393732_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	6.9e-22
WP_019705237.1|2395095_2395344_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
WP_004176434.1|2396189_2396681_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_032427977.1|2396723_2398268_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_015958243.1|2398277_2399621_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004190548.1|2399617_2400307_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_023328620.1|2400303_2402010_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002902160.1|2402014_2402506_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_064798380.1|2402770_2405425_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.6	1.3e-97
WP_064798381.1|2407930_2409145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050484415.1|2409145_2409532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063666504.1|2409596_2411948_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.2	6.9e-18
WP_009310076.1|2413687_2414668_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_004190528.1|2415093_2415354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190525.1|2415340_2416108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179560.1|2416287_2416809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279043.1|2417001_2418099_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	7.4e-47
WP_153831088.1|2418273_2418798_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_023279041.1|2419544_2420753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_175327209.1|2420701_2424208_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004190512.1|2424204_2425803_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004190510.1|2425833_2426889_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004190508.1|2426885_2427356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004212348.1|2427432_2429187_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_023279038.1|2429150_2430236_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 6
NZ_CP014762	Klebsiella pneumoniae strain KPNIH39 chromosome, complete genome	5351509	2635273	2646160	5351509		Escherichia_phage(87.5%)	9	NA	NA
WP_023300966.1|2635273_2635894_-	aldolase	NA	A0A077SK32	Escherichia_phage	99.5	4.0e-114
WP_004183946.1|2635886_2637152_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002903955.1|2637163_2638066_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|2638326_2639088_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|2639108_2639969_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_004176262.1|2640266_2640527_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|2640613_2641702_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176258.1|2641732_2642998_-	MFS transporter	NA	NA	NA	NA	NA
WP_021440086.1|2643052_2646160_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 7
NZ_CP014762	Klebsiella pneumoniae strain KPNIH39 chromosome, complete genome	5351509	3645822	3652729	5351509	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|3645822_3647301_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|3647297_3648020_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|3648338_3649700_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004151134.1|3649942_3650839_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004899467.1|3651081_3651855_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_023278799.1|3651865_3652729_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 1
NZ_CP014763	Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence	284894	3779	74094	284894	integrase,transposase,protease	uncultured_Caudovirales_phage(25.0%)	57	NA	NA
WP_023205099.1|3779_3920_+|protease	ATP-dependent metalloprotease FtsH	protease	NA	NA	NA	NA
WP_004118778.1|4007_4466_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_023280936.1|4488_5403_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_013307890.1|5505_6393_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_023329026.1|6482_7124_+	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_023280938.1|7172_8318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023280939.1|8307_8748_+	heat resistance system thioredoxin Trx-GI	NA	A0A023NHA9	Dinoroseobacter_phage	34.7	4.5e-11
WP_023280940.1|8751_10467_+	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_023280941.1|10463_10961_+	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_023280943.1|11927_13079_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	7.5e-26
WP_023280945.1|13922_14918_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	27.9	3.5e-19
WP_048270273.1|15051_17190_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_029497503.1|17186_18971_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	26.8	9.6e-20
WP_003031967.1|19501_20470_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.1	2.8e-13
WP_087759866.1|21087_22208_-|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
WP_101677559.1|23820_24333_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_025714559.1|24456_24966_-	arsenate reductase ArsC	NA	A0A2H4J437	uncultured_Caudovirales_phage	40.4	1.7e-14
WP_025714558.1|25038_25467_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.2e-50
WP_032951259.1|25524_26814_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.5	6.2e-170
WP_025714556.1|26854_28621_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_025714555.1|28644_29010_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_025714554.1|29034_29514_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	52.6	1.1e-36
WP_025714553.1|29570_29924_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	45.7	2.6e-22
WP_009310076.1|30168_31149_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.2e-184
WP_004149658.1|31482_32199_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000677445.1|32233_32869_-	type 3 fimbria minor subunit MrkF	NA	NA	NA	NA	NA
WP_064798502.1|32882_33878_-	type 3 fimbria adhesin subunit MrkD	NA	NA	NA	NA	NA
WP_000813718.1|33868_36355_-	type 3 fimbria usher protein MrkC	NA	NA	NA	NA	NA
WP_000820818.1|36366_37068_-	type 3 fimbria chaperone MrkB	NA	NA	NA	NA	NA
WP_000756959.1|37163_37772_-	type 3 fimbria major subunit MrkA	NA	NA	NA	NA	NA
WP_072196505.1|38096_39065_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.9	4.5e-173
WP_020804663.1|39260_39926_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004187025.1|41014_41263_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_001189111.1|42977_44486_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000227969.1|45027_46104_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001000602.1|46544_47696_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.7	6.7e-99
WP_001067855.1|48272_48977_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_040217245.1|49419_51867_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	70.5	1.6e-25
WP_009653212.1|51885_53319_-	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_004099051.1|53407_54691_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_004099052.1|54820_57013_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_004099053.1|57385_58354_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_009309916.1|59281_60160_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_020804312.1|60200_60617_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261276.1|60613_60844_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004213562.1|61772_62594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213560.1|62590_63370_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
WP_004213558.1|63514_64444_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
WP_077250517.1|64756_64915_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.7	2.2e-05
WP_040217012.1|64893_66642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032427877.1|66830_67088_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_040118447.1|67611_68478_+	ParA family protein	NA	NA	NA	NA	NA
WP_004902347.1|68477_69509_+	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	26.1	2.9e-08
WP_004902343.1|69508_69946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004902338.1|69942_70266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004214667.1|72292_73075_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	96.1	3.0e-135
WP_040217490.1|73071_74094_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	90.6	7.8e-184
>prophage 2
NZ_CP014763	Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence	284894	85074	122770	284894	transposase,protease,integrase	Salmonella_phage(33.33%)	33	74482:74495	94473:94486
74482:74495	attL	GGTCTTTCTTCCAT	NA	NA	NA	NA
WP_040217228.1|85074_86091_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_040217224.1|86996_87602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040217223.1|87588_87831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064798504.1|87878_88343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040217219.1|88352_88760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040217217.1|88802_89762_+	DNA replication protein	NA	NA	NA	NA	NA
WP_032720851.1|89758_90517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040217214.1|90513_90837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012540152.1|91052_91370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064798505.1|91435_92572_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_040217276.1|92749_93004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040215144.1|94017_95550_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
94473:94486	attR	ATGGAAGAAAGACC	NA	NA	NA	NA
WP_052455510.1|96032_96818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026560.1|97138_98038_+	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	49.0	6.9e-67
WP_004026564.1|100928_101864_+|protease	omptin family outer membrane protease Kop	protease	NA	NA	NA	NA
WP_004210306.1|102335_102818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017146616.1|103061_103376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004181742.1|104318_104531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040217023.1|104624_104903_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_001189111.1|106275_107784_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_148721855.1|109323_109821_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_077268204.1|110253_111222_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.7	2.7e-178
WP_064798507.1|111491_112991_-	kinase	NA	NA	NA	NA	NA
WP_064798508.1|113018_114752_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_004026583.1|114751_115792_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026585.1|115884_116523_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_040216808.1|116523_117165_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	24.1	9.1e-05
WP_004026588.1|117189_117828_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_040216810.1|118142_118964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040216811.1|119039_119498_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_040216813.1|119500_120724_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_040216815.1|120734_121691_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_040216817.1|121690_122770_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	1.7e-40
>prophage 3
NZ_CP014763	Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence	284894	167314	232320	284894	transposase	Salmonella_phage(33.33%)	47	NA	NA
WP_016530671.1|167314_167593_-|transposase	transposase	transposase	Q71TE9	Escherichia_phage	68.2	4.3e-28
WP_004118901.1|168218_169211_-	DsbA family protein	NA	NA	NA	NA	NA
WP_040216544.1|169207_170797_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	25.0	2.1e-34
WP_032413280.1|170833_172240_-	cytosine permease	NA	NA	NA	NA	NA
WP_064798510.1|174287_175844_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_110570736.1|177416_177626_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	54.8	1.0e-13
WP_040216683.1|179000_180368_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_032413289.1|180466_181228_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_004118884.1|181224_181782_+	HutD family protein	NA	NA	NA	NA	NA
WP_162550805.1|185297_186206_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_004118873.1|186258_187650_+	cytosine permease	NA	NA	NA	NA	NA
WP_064798512.1|187661_188870_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_004118865.1|188862_189672_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_077256199.1|191944_193543_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	32.4	8.6e-20
WP_077253754.1|193634_193748_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	81.1	4.7e-10
WP_077268205.1|195178_196147_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	1.2e-178
WP_040217049.1|198627_200319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052455511.1|200315_201218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040217047.1|201359_202538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040217046.1|202659_202845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117065219.1|203186_203474_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_040217043.1|203965_205702_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_040217041.1|205691_207110_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_142390228.1|207169_207496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016151349.1|207521_208490_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	5.0e-180
WP_071953846.1|208509_208695_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	61.4	1.2e-10
WP_032413443.1|209407_209851_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_040217285.1|209847_210318_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_017901409.1|210427_210688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077268204.1|212338_213307_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.7	2.7e-178
WP_040217080.1|213736_214921_+	MFS transporter	NA	NA	NA	NA	NA
WP_040217078.1|214990_215875_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040217075.1|216847_217750_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.3	4.1e-11
WP_040217073.1|218042_218762_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_040217071.1|218828_220151_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	28.1	5.6e-17
WP_040217069.1|220147_221614_-	APC family permease	NA	NA	NA	NA	NA
WP_043875145.1|221682_223053_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_040217077.1|223224_224076_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043875144.1|224130_224880_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_040217065.1|224883_225531_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_077268206.1|225572_226541_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	1.6e-178
WP_040217144.1|227696_228044_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_023288266.1|228040_228379_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	81.0	2.3e-47
WP_011251285.1|229134_229446_+	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_011251286.1|229442_229862_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077268207.1|230008_230977_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	90.7	1.6e-170
WP_001101446.1|231294_232320_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP014765	Klebsiella pneumoniae strain KPNIH39 plasmid pKpQIL-9b8, complete sequence	106559	10758	56765	106559	transposase,integrase	Escherichia_phage(27.78%)	42	18921:18935	58123:58137
WP_004152392.1|10758_13788_+|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|13894_14920_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|14916_15696_+	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152396.1|15983_16865_+	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152397.1|17114_18434_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152398.1|18710_19895_-|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
18921:18935	attL	GGCATCACCGCGATA	NA	NA	NA	NA
WP_004152400.1|20398_20758_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152401.1|21414_21825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152402.1|21923_22544_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_023307208.1|22632_25530_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_000509966.1|25624_26230_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004194048.1|26889_28071_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000091613.1|28497_28812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|29066_29423_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|29412_29814_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|29810_30101_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003100881.1|30175_33142_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_000427623.1|33220_34225_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004197809.1|34406_34610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197808.1|34623_34827_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004197807.1|34860_35229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020805591.1|35272_35767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020805590.1|35797_36370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000272716.1|36366_36615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020315560.1|37051_37741_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_004193995.1|37772_38462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568025.1|39016_39235_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001568026.1|39236_39542_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_072158608.1|39710_40106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644730.1|40132_40456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020315256.1|40452_41469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019705993.1|41803_43072_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.4	1.1e-59
WP_019705992.1|43076_46334_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_032436768.1|46334_47609_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_019706038.1|47605_49633_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_004197635.1|49786_50581_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_006788217.1|51028_51208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197649.1|51327_51954_-	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_004197644.1|52570_53446_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.8	1.1e-82
WP_004197646.1|53857_55129_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
WP_001568036.1|55128_55560_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_001568038.1|55793_56765_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
58123:58137	attR	TATCGCGGTGATGCC	NA	NA	NA	NA
