The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015130	Klebsiella pneumoniae strain Kpn555 chromosome, complete genome	5336571	237452	286099	5336571	terminase,integrase,tRNA,holin,tail	Klebsiella_phage(20.0%)	62	236649:236665	247067:247083
236649:236665	attL	CCCGCCAGCAGCTGGCT	NA	NA	NA	NA
WP_020316476.1|237452_238196_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	6.0e-16
WP_004148192.1|238473_239457_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_004151591.1|239982_241356_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
WP_064838751.1|241401_242337_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.1	1.4e-139
WP_064838752.1|242385_243624_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	67.1	7.8e-162
WP_023159475.1|243625_243838_-	excisionase family protein	NA	A0A0U2RY08	Escherichia_phage	71.8	1.1e-23
WP_032430507.1|243902_244142_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	82.1	6.1e-31
WP_064838754.1|244149_244458_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	7.1e-24
WP_064838756.1|244454_245066_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	78.9	1.8e-39
WP_064838757.1|245058_245400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064838759.1|245434_246523_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	56.5	7.4e-108
WP_064838761.1|246535_249631_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	57.7	3.7e-293
247067:247083	attR	AGCCAGCTGCTGGCGGG	NA	NA	NA	NA
WP_023282477.1|249768_249924_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
WP_040217592.1|249932_250124_-	YebW family protein	NA	NA	NA	NA	NA
WP_043875424.1|250517_250931_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048987746.1|251042_251273_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	44.0	4.7e-12
WP_064838763.1|251275_251812_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	68.9	1.1e-59
WP_064838765.1|252159_253077_+	replication protein	NA	K7PGZ0	Enterobacteria_phage	65.1	1.5e-98
WP_064838767.1|253073_253817_+	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	55.2	4.1e-65
WP_016946299.1|253809_254145_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	4.4e-11
WP_064838768.1|254137_254923_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.7	8.7e-66
WP_064838770.1|254919_255123_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	87.9	2.7e-27
WP_064838771.1|255115_255370_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	49.3	1.6e-08
WP_004184517.1|255366_255603_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.0	1.5e-13
WP_064838773.1|255595_255970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049110734.1|255969_256227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064838775.1|256223_258209_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.5	7.3e-202
WP_077255024.1|258973_259198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087812871.1|259271_259871_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.4	1.3e-90
WP_004892208.1|260079_260376_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	72.9	1.2e-36
WP_004190680.1|260372_260741_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	63.8	3.5e-41
WP_022631482.1|260737_261520_+	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	2.9e-114
WP_064838779.1|261836_262283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940884.1|262895_263195_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004218565.1|263191_263731_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_004190674.1|263727_264072_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|264068_264344_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_123618920.1|264655_264868_+	hypothetical protein	NA	A0A286N2Q9	Klebsiella_phage	71.4	7.8e-22
WP_004218558.1|265302_265548_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_064838781.1|266410_267415_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	44.5	1.7e-37
WP_064838782.1|267392_268700_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.4	8.8e-148
WP_016946681.1|268699_270100_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.7	6.4e-128
WP_064838784.1|270083_271196_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.6	8.7e-112
WP_004190654.1|271708_272494_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.4	1.7e-66
WP_004190653.1|272504_273458_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_151391665.1|273466_273739_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_004216825.1|273779_274175_+	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	39.3	1.1e-13
WP_004190649.1|274176_274431_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_004190646.1|274440_274674_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_029602988.1|274660_275044_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	5.4e-21
WP_004190641.1|275045_275597_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	40.4	1.7e-28
WP_064838786.1|275593_275986_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_064838788.1|276009_277182_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	5.5e-24
WP_008807841.1|277235_277718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016946674.1|277855_278062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217333.1|278138_278495_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_032416607.1|278605_278974_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	42.9	3.3e-15
WP_064838790.1|279047_281702_+|tail	phage tail length tape measure family protein	tail	A0A192Y7S1	Enterobacteria_phage	31.4	9.7e-85
WP_064840249.1|281701_282175_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.9	2.5e-60
WP_004899613.1|282161_282644_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	98.1	1.1e-84
WP_017880229.1|282653_283034_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	100.0	4.6e-73
WP_064838792.1|283030_286099_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.3	0.0e+00
>prophage 2
NZ_CP015130	Klebsiella pneumoniae strain Kpn555 chromosome, complete genome	5336571	386194	427470	5336571	capsid,terminase,head,holin,tail	Salmonella_phage(32.56%)	56	NA	NA
WP_064838831.1|386194_386710_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	2.0e-23
WP_002903398.1|387002_387161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032454800.1|387769_388033_-	pyocin activator PrtN family protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.6e-11
WP_064838837.1|388424_389141_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	44.8	1.0e-41
WP_064171434.1|389133_389478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064838839.1|389474_389699_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	56.8	3.6e-17
WP_023297265.1|389929_390151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064165593.1|390223_390517_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_064838841.1|391140_391344_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	73.1	2.7e-19
WP_175295299.1|391374_391551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064838843.1|391602_392439_-	hypothetical protein	NA	A0A0R6PIN1	Moraxella_phage	27.8	8.7e-24
WP_023339685.1|392401_392581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139041349.1|392675_392774_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_047667478.1|392788_393487_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	83.7	3.1e-107
WP_032443511.1|393598_393826_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	76.1	1.1e-24
WP_064838844.1|393865_394147_+	hypothetical protein	NA	A2SY75	Escherichia_phage	58.2	2.4e-18
WP_023312759.1|394350_394605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064838846.1|394601_395696_+	hypothetical protein	NA	S5FM81	Shigella_phage	41.8	8.2e-22
WP_064838848.1|395722_396118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064838849.1|396331_397117_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	2.0e-62
WP_064838851.1|397244_398321_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.1	2.8e-147
WP_064838855.1|399146_399335_+	hypothetical protein	NA	A0A192Y8X2	Salmonella_phage	88.7	4.8e-23
WP_004196547.1|400132_400402_+	hypothetical protein	NA	H6WRY4	Salmonella_phage	80.7	3.5e-35
WP_064838857.1|400636_401230_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.4	1.2e-43
WP_064838859.1|401226_401997_+	hypothetical protein	NA	D5LH17	Escherichia_phage	52.0	7.2e-65
WP_072122464.1|401993_402638_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	81.4	2.1e-102
WP_064838861.1|402634_403234_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	58.9	1.0e-66
WP_133124641.1|404121_404427_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	97.9	3.3e-45
WP_064162818.1|404413_404893_+	glycoside hydrolase family 104 protein	NA	A5VW81	Enterobacteria_phage	82.4	3.9e-69
WP_012967894.1|404908_405085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064142410.1|405106_405289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064838863.1|405407_405701_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	69.1	9.8e-31
WP_064838865.1|406036_406282_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	91.4	4.8e-31
WP_064838866.1|406643_406937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064840252.1|406940_408398_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	86.8	5.2e-258
WP_032429033.1|408379_408979_+	hypothetical protein	NA	S4TR53	Salmonella_phage	64.1	1.2e-72
WP_064838868.1|408971_409340_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	79.5	1.0e-48
WP_060598770.1|409518_410031_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	67.3	1.0e-51
WP_049009200.1|410034_411693_+|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	70.9	2.7e-234
WP_064838870.1|411751_413686_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	91.1	0.0e+00
WP_087672146.1|413724_413892_+	hypothetical protein	NA	S4TR49	Salmonella_phage	78.2	3.5e-17
WP_064838876.1|416289_416616_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	60.7	8.6e-28
WP_032701061.1|416687_416900_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	60.0	1.5e-09
WP_008806068.1|416901_417252_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	62.9	3.9e-34
WP_008806069.1|417244_417730_+	HK97 gp10 family phage protein	NA	A0A0U3TGT7	Pseudomonas_phage	65.2	1.5e-52
WP_008806070.1|417726_418089_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	77.7	2.9e-48
WP_023343204.1|418153_418636_+	hypothetical protein	NA	Q9MCU9	Escherichia_phage	58.9	7.5e-52
WP_023343205.1|418815_419346_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	90.3	8.7e-86
WP_064838877.1|419392_419746_+|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	96.6	3.5e-59
WP_004143895.1|419778_420042_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
WP_004143894.1|420107_420575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064838879.1|420619_423067_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	66.5	7.7e-278
WP_059689813.1|423066_423546_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.1	3.0e-93
WP_064838881.1|423532_424015_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	92.5	3.2e-79
WP_064838883.1|424024_424405_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	95.2	6.2e-70
WP_064838884.1|424401_427470_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.2	0.0e+00
>prophage 3
NZ_CP015130	Klebsiella pneumoniae strain Kpn555 chromosome, complete genome	5336571	508465	519351	5336571		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|508465_509086_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_064187096.1|509078_510344_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	4.6e-234
WP_002903955.1|510355_511258_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|511518_512280_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_001620095.1|512300_513161_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004176262.1|513458_513719_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|513805_514894_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176258.1|514923_516189_-	MFS transporter	NA	NA	NA	NA	NA
WP_064838913.1|516243_519351_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 4
NZ_CP015130	Klebsiella pneumoniae strain Kpn555 chromosome, complete genome	5336571	1441352	1456224	5336571		Escherichia_phage(33.33%)	14	NA	NA
WP_064839238.1|1441352_1442714_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	1.9e-12
WP_159321336.1|1442703_1443477_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_064839240.1|1443565_1444120_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	8.6e-52
WP_064839242.1|1444134_1445025_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	7.4e-29
WP_004175258.1|1445056_1445926_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_064839244.1|1445939_1447004_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	2.2e-104
WP_064839245.1|1447844_1448849_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.7	1.0e-31
WP_004144151.1|1449249_1449372_+	small membrane protein	NA	NA	NA	NA	NA
WP_000704907.1|1449796_1450963_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_023278826.1|1451142_1451697_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.5e-51
WP_021313306.1|1451711_1452602_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_004175258.1|1452633_1453503_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_064839244.1|1453529_1454594_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	2.2e-104
WP_064839247.1|1454817_1456224_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	1.8e-37
>prophage 5
NZ_CP015130	Klebsiella pneumoniae strain Kpn555 chromosome, complete genome	5336571	1499417	1506325	5336571	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|1499417_1500896_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|1500892_1501615_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|1501933_1503295_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_074184757.1|1503536_1504433_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	1.6e-15
WP_004180550.1|1504677_1505451_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_064840266.1|1505461_1506325_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	9.7e-10
>prophage 6
NZ_CP015130	Klebsiella pneumoniae strain Kpn555 chromosome, complete genome	5336571	2519956	2557180	5336571	capsid,plate,terminase,integrase,tRNA,head,lysis,holin,portal,tail	Escherichia_phage(36.59%)	45	2555478:2555494	2557202:2557218
WP_002916879.1|2519956_2520970_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|2521207_2521423_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004149864.1|2521534_2523280_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_004174339.1|2523498_2525340_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_002917636.1|2525439_2525946_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_032420109.1|2526301_2526520_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	88.9	3.2e-34
WP_064839606.1|2526587_2527754_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	81.9	2.8e-177
WP_015959003.1|2527753_2528233_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	82.8	1.9e-71
WP_064839607.1|2528249_2530688_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	73.3	2.5e-297
WP_014343413.1|2530680_2530800_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	2.0e-14
WP_004195711.1|2530832_2531108_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_014343412.1|2531168_2531684_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
WP_064839609.1|2531697_2532879_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	85.6	1.5e-194
WP_064839612.1|2532988_2534065_-|tail	phage tail protein	tail	A0A2H4J931	uncultured_Caudovirales_phage	46.9	4.0e-29
WP_064839614.1|2534076_2534805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064839616.1|2534810_2537075_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	44.0	1.8e-108
WP_077268147.1|2537076_2537664_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	56.0	1.3e-50
WP_047718554.1|2537671_2538580_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	71.2	4.4e-114
WP_064165137.1|2538584_2538932_-	GPW/gp25 family protein	NA	Q7Y4D7	Escherichia_virus	79.1	7.5e-46
WP_064165136.1|2538928_2539564_-|plate	phage baseplate assembly protein V	plate	M1SV78	Escherichia_phage	83.4	1.0e-96
WP_064165135.1|2539632_2540082_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.7	3.6e-48
WP_047718552.1|2540074_2540542_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	77.4	5.1e-66
WP_047718550.1|2540504_2540663_-	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	68.0	1.2e-11
WP_064165134.1|2540637_2541069_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	65.7	1.2e-40
WP_064839620.1|2541065_2541563_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	85.5	7.4e-79
WP_009309693.1|2541549_2541840_-|holin	phage holin family protein	holin	O80308	Escherichia_phage	84.7	9.1e-37
WP_004175163.1|2541844_2542048_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	80.6	4.2e-25
WP_009309691.1|2542047_2542554_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_074187707.1|2542650_2543370_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	79.0	1.1e-94
WP_047718542.1|2543397_2544456_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	84.1	3.8e-165
WP_047718540.1|2544529_2545384_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.0	4.8e-126
WP_047718537.1|2545549_2547319_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.9	3.7e-306
WP_004195876.1|2547318_2548362_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.4	6.8e-167
WP_064184806.1|2548759_2549695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064839622.1|2549759_2550491_-	hypothetical protein	NA	Q37850	Escherichia_phage	93.8	2.0e-128
WP_065808430.1|2550572_2551013_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	81.8	2.2e-58
WP_074187341.1|2551127_2553200_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	90.7	0.0e+00
WP_047718529.1|2553348_2553630_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	91.4	3.7e-43
WP_064839624.1|2553630_2553852_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	86.3	2.6e-28
WP_032454118.1|2553851_2554079_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	74.7	4.6e-20
WP_032454119.1|2554147_2554486_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.0	8.0e-53
WP_047719163.1|2554449_2554650_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	3.3e-30
WP_047718526.1|2554657_2555167_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	97.0	4.0e-88
2555478:2555494	attL	TTTGCCAATATTTGCCA	NA	NA	NA	NA
WP_047719162.1|2555591_2556164_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	94.7	9.6e-99
WP_047718525.1|2556163_2557180_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	96.7	9.8e-195
2557202:2557218	attR	TGGCAAATATTGGCAAA	NA	NA	NA	NA
>prophage 7
NZ_CP015130	Klebsiella pneumoniae strain Kpn555 chromosome, complete genome	5336571	3281281	3387799	5336571	capsid,protease,plate,terminase,integrase,tRNA,head,lysis,portal,holin,tail	Escherichia_phage(55.32%)	115	3320637:3320680	3350320:3350363
WP_002882809.1|3281281_3281719_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_004178031.1|3281763_3282705_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_064839760.1|3282718_3283636_-	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	28.6	1.9e-16
WP_004150355.1|3283840_3284083_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002882817.1|3284082_3284466_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004150358.1|3284639_3285569_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_002882818.1|3285565_3286201_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_002882822.1|3286197_3287100_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_085921749.1|3287112_3290163_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_002882828.1|3290319_3291156_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_002882830.1|3291284_3291497_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_064839761.1|3291898_3292879_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_004151864.1|3292890_3293205_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_004150366.1|3293197_3294565_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_064839763.1|3294551_3295394_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002882858.1|3295452_3295722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002882861.1|3295731_3296169_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_064839765.1|3296165_3296759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064839767.1|3296755_3297079_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_064839769.1|3297078_3297738_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_002882865.1|3297837_3298386_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064839771.1|3298473_3299469_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032418234.1|3299584_3301708_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_064839773.1|3301749_3303015_+	MFS transporter	NA	NA	NA	NA	NA
WP_002882870.1|3303052_3303367_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_002882871.1|3303363_3304512_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_064839774.1|3304601_3305606_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004181621.1|3305602_3306610_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_064839776.1|3306606_3308118_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.0	3.9e-14
WP_002882880.1|3308263_3309250_-	rhamnose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002882882.1|3309331_3310162_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_004150375.1|3310311_3311571_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_002882885.1|3311567_3313034_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_002882888.1|3313344_3314181_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_002882891.1|3314254_3315100_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_002882892.1|3315132_3316167_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_002882894.1|3316456_3317077_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	57.9	3.5e-62
WP_002882896.1|3317149_3317824_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_002882898.1|3317891_3319265_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	1.4e-10
WP_002882901.1|3319261_3319960_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
WP_004178004.1|3320109_3320613_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
3320637:3320680	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTT	NA	NA	NA	NA
WP_006822081.1|3320799_3321780_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	99.7	8.0e-186
WP_016237179.1|3321849_3322143_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	99.0	1.0e-48
WP_001308179.1|3322279_3322552_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_001005162.1|3322554_3322725_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|3322721_3323222_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|3323285_3323510_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277958.1|3323509_3323812_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_071889787.1|3323811_3324036_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	97.3	1.5e-34
WP_000027664.1|3324032_3324308_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_064839778.1|3324297_3326574_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.8	0.0e+00
WP_000038165.1|3327656_3328691_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	4.2e-201
WP_000156861.1|3328690_3330463_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085972.1|3330636_3331491_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
WP_001248583.1|3331549_3332623_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
WP_176720749.1|3332650_3333370_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.9	1.1e-118
WP_000988633.1|3333468_3333978_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|3333977_3334181_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|3334184_3334466_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|3334465_3334963_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_064839782.1|3334977_3335403_+	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	97.9	7.7e-61
WP_064839784.1|3335390_3335816_+|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	95.0	1.8e-65
WP_000917182.1|3335923_3336391_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
WP_064839785.1|3336383_3336836_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.0	7.7e-75
WP_019841549.1|3336902_3337538_+|plate	phage baseplate assembly protein V	plate	A0A0F7LDY9	Escherichia_phage	99.5	5.3e-114
WP_000127164.1|3337534_3337882_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_021525816.1|3337886_3338795_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	5.7e-162
WP_001285340.1|3338787_3339399_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_064839788.1|3339395_3340721_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	67.7	2.2e-178
WP_064839790.1|3340720_3341323_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	4.6e-99
WP_064839792.1|3341294_3341738_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	97.3	2.7e-80
WP_071889793.1|3341758_3342169_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	93.5	1.8e-62
WP_025670956.1|3342199_3342793_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.9	3.9e-103
WP_001286675.1|3342852_3344043_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.8e-224
WP_001251408.1|3344055_3344574_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|3344630_3344906_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|3344938_3345058_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_038430675.1|3345050_3347498_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.6	0.0e+00
WP_000978897.1|3347512_3347992_+|tail	phage tail protein	tail	O64315	Escherichia_phage	100.0	5.1e-85
WP_064839794.1|3347991_3349155_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	5.4e-205
WP_000468308.1|3349236_3349455_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000416606.1|3349595_3350237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002882907.1|3350454_3351357_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
3350320:3350363	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTT	NA	NA	NA	NA
WP_002882911.1|3351553_3352516_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002882913.1|3352577_3353063_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_002882914.1|3353155_3354076_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002882917.1|3354145_3355480_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.5	2.1e-43
WP_002882918.1|3355489_3356020_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_002882919.1|3356111_3357080_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_002882921.1|3357173_3358202_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_064839796.1|3358352_3360548_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_002882922.1|3360800_3361013_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002882924.1|3361114_3361432_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_064839798.1|3361699_3362860_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_002882944.1|3362862_3365295_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_064839800.1|3365269_3366406_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_023342388.1|3366544_3368101_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_002882947.1|3368138_3368510_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004895139.1|3368601_3369510_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002882952.1|3369738_3370626_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_004177983.1|3370769_3371651_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004177981.1|3371714_3372818_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_004177977.1|3372872_3373535_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	4.6e-28
WP_004220885.1|3373740_3374727_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004187297.1|3374751_3375402_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_064839802.1|3375445_3378097_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_004177969.1|3378355_3379507_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_004181637.1|3379620_3380625_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_015959218.1|3380631_3381408_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_004146283.1|3381507_3382881_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_002883015.1|3383139_3384057_+	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_002883016.1|3384039_3385440_-	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_004151856.1|3385636_3386272_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_002883021.1|3386287_3386647_+	YijD family membrane protein	NA	NA	NA	NA	NA
WP_002883023.1|3386698_3387799_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP015130	Klebsiella pneumoniae strain Kpn555 chromosome, complete genome	5336571	5031639	5041113	5336571	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|5031639_5032755_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|5032751_5034692_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|5034768_5034990_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|5035315_5035633_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|5035663_5037943_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|5038073_5038292_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|5038645_5039347_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_016532437.1|5039391_5041113_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 1
NZ_CP015131	Klebsiella pneumoniae strain Kpn555 plasmid pKPN-7c3, complete sequence	142858	39497	102287	142858	transposase,integrase	Escherichia_phage(25.0%)	50	44859:44879	63526:63546
WP_000343766.1|39497_40718_-|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_000115885.1|40736_41255_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000619112.1|41389_41638_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.2e-13
WP_000109079.1|41634_42072_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.6	1.1e-25
WP_000952372.1|43194_44367_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
WP_000544830.1|44366_45164_+	IS21-like element IS21 family helper ATPase IstB	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
44859:44879	attL	GATGAAATAGGCTATCTGCCG	NA	NA	NA	NA
WP_000340835.1|45481_45874_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001103694.1|45878_46850_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000633911.1|47078_47723_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_000239529.1|47716_47992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016979.1|48129_48939_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
WP_001159871.1|48939_49245_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|49246_49465_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000990667.1|51786_52428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309253.1|53602_54580_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.5	6.1e-101
WP_064840319.1|54822_55563_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001309252.1|55683_55872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|56238_57408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|58254_58527_-	adhesin biosynthesis transcription regulatory family protein	NA	NA	NA	NA	NA
WP_001298664.1|59769_61740_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977394.1|61746_62538_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001323403.1|63276_64056_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
63526:63546	attR	CGGCAGATAGCCTATTTCATC	NA	NA	NA	NA
WP_001310017.1|64055_65078_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_000612626.1|66157_66505_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|66501_66906_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001189113.1|67407_68916_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001020413.1|71181_72357_-	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_001100763.1|72425_74687_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000981091.1|74855_75632_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_001224623.1|75639_76515_-	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_001080732.1|78965_79301_-	colicin transporter	NA	NA	NA	NA	NA
WP_000142452.1|79429_79777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194542.1|79796_80306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371882.1|80302_80563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000874189.1|83469_83955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267176.1|83979_84465_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|84451_85147_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729218.1|85151_86282_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|86271_87555_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|87557_88937_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|89040_89568_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|89608_91495_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|91841_92657_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949452.1|92839_93346_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_000449408.1|93335_93494_-	DsbA family protein	NA	NA	NA	NA	NA
WP_000428546.1|95104_95698_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|95810_97016_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000088605.1|97097_97721_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_000656305.1|98876_99254_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|99320_102287_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
>prophage 1
NZ_CP015133	Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d6b, complete sequence	26450	1926	25776	26450	transposase	Escherichia_phage(100.0%)	22	NA	NA
WP_004217321.1|1926_2631_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001620097.1|3603_4692_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_001620096.1|4778_5039_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
WP_001620095.1|5336_6197_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|6217_6979_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002210514.1|7239_8142_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
WP_002210515.1|8153_9419_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	100.0	2.7e-234
WP_002210516.1|9411_10032_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004217321.1|10743_11448_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001620097.1|12420_13509_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_001620096.1|13595_13856_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
WP_001620095.1|14153_15014_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|15034_15796_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002210514.1|16056_16959_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
WP_002210515.1|16970_18236_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	100.0	2.7e-234
WP_002210516.1|18228_18849_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004217321.1|19560_20265_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001620097.1|21237_22326_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_001620096.1|22412_22673_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
WP_001620095.1|22970_23831_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|23851_24613_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002210514.1|24873_25776_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
>prophage 1
NZ_CP015132	Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence	224457	2115	49738	224457	transposase,bacteriocin	Shigella_phage(33.33%)	38	NA	NA
WP_000427619.1|2115_3120_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004152284.1|3523_4534_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_016831235.1|4994_6077_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.1	4.4e-185
WP_004182121.1|6198_9273_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_004098904.1|9324_10578_+	lactose permease	NA	NA	NA	NA	NA
WP_024623136.1|12020_12599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020325130.1|12601_12961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087796248.1|13111_14261_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	95.6	9.1e-173
WP_032432508.1|15315_15915_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_032432506.1|15960_16662_-	urea carboxylase-associated family protein	NA	NA	NA	NA	NA
WP_032432505.1|16658_17912_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_169546960.1|17908_18703_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.3	1.1e-28
WP_032432503.1|18725_19367_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032432501.1|19363_20023_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_032432500.1|20033_20879_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_087788032.1|23237_24445_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	9.8e-101
WP_003031962.1|24550_25621_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_003031960.1|26033_27131_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003031958.1|27361_28399_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_032432493.1|28404_29235_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_003031956.1|29300_30056_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032432491.1|30099_30762_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003031954.1|30761_31502_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.0	4.7e-29
WP_050597921.1|31501_32332_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_064840321.1|32352_33219_+	DMT family transporter	NA	NA	NA	NA	NA
WP_101977911.1|33786_34311_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	31.0	6.7e-22
WP_024623132.1|34685_35924_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	22.1	6.2e-10
WP_020325103.1|36368_37367_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_071604881.1|37561_38035_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_071604880.1|39199_39544_+	MFS transporter	NA	NA	NA	NA	NA
WP_020325099.1|39760_41020_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_020325120.1|41036_42155_+	DUF2961 domain-containing protein	NA	NA	NA	NA	NA
WP_087784434.1|42306_43453_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.3	3.5e-148
WP_141769206.1|43469_43805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023307528.1|44574_45432_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004171457.1|45424_45502_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004199332.1|45718_45997_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_117248013.1|47416_49738_-|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 2
NZ_CP015132	Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence	224457	120418	177457	224457	transposase,holin,integrase,protease	uncultured_Caudovirales_phage(31.25%)	52	109440:109455	154583:154598
109440:109455	attL	CTGCTTGAGTTGCTGC	NA	NA	NA	NA
WP_064840328.1|120418_121159_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	4.5e-24
WP_004152065.1|122302_123250_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|123276_123588_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011977741.1|123607_124576_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
WP_004197688.1|125248_125506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080895248.1|126125_127562_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|128544_129822_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|129884_131882_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_148722517.1|132921_134129_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	3.7e-100
WP_004178091.1|135557_135989_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|136239_137715_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|137707_138388_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|138577_139963_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|139991_140345_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|140458_141751_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|141761_144908_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|144994_145435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|145561_148009_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|148049_148247_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|148280_149018_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|149306_149756_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|149989_151807_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001378118.1|151812_152703_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|152742_153123_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|153127_154057_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|154111_154792_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
154583:154598	attR	CTGCTTGAGTTGCTGC	NA	NA	NA	NA
WP_004152084.1|154788_156189_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|156405_156840_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|157071_157251_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|158993_159503_+	aquaporin	NA	NA	NA	NA	NA
WP_004152091.1|159552_160050_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|160381_160708_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152093.1|160704_161418_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|161426_161972_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|162047_162410_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|164306_164843_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|164875_165301_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|165313_166603_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|166650_168402_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|168419_168782_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|168831_169182_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|169539_169809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|169796_170372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|170402_170897_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|170940_171309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|171342_171546_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|171594_171852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|171927_172182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|172357_172624_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|172611_173094_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|173305_174652_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|176494_177457_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP015132	Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence	224457	187280	196802	224457	transposase	Escherichia_phage(100.0%)	9	NA	NA
WP_004217321.1|187280_187985_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001620097.1|188957_190046_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_001620096.1|190132_190393_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
WP_001620095.1|190690_191551_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|191571_192333_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002210514.1|192593_193496_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
WP_002210515.1|193507_194773_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	100.0	2.7e-234
WP_002210516.1|194765_195386_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_001067855.1|196097_196802_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
