The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016071	Lactiplantibacillus plantarum strain NCU116 isolate Chinese pickle chromosome, complete genome	3354689	236	11066	3354689	integrase	Lactobacillus_phage(77.78%)	13	3684:3697	17285:17298
WP_172821796.1|236_413_-	hypothetical protein	NA	A0A2P0ZLB1	Lactobacillus_phage	91.4	3.7e-25
WP_064971842.1|393_675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064971843.1|765_1131_-	DUF771 domain-containing protein	NA	E9LUT3	Lactobacillus_phage	65.1	1.8e-26
WP_047674555.1|1130_1334_-	hypothetical protein	NA	A0A2P0ZLA4	Lactobacillus_phage	92.5	3.1e-28
WP_015380155.1|1337_1547_-	hypothetical protein	NA	A0A2P0ZL97	Lactobacillus_phage	98.6	1.6e-30
WP_064971844.1|1611_1989_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_155123378.1|1985_2150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064971846.1|2465_2846_+	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	80.6	3.7e-54
WP_003643876.1|2855_3287_+	hypothetical protein	NA	A0A2P0ZLA0	Lactobacillus_phage	100.0	7.6e-80
WP_064971847.1|3379_4003_+	hypothetical protein	NA	NA	NA	NA	NA
3684:3697	attL	AAAAACTTAACAAT	NA	NA	NA	NA
WP_064971848.1|4125_6909_+	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	36.7	2.9e-156
WP_064971849.1|7080_8211_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M9JJ77	Lactobacillus_phage	48.2	1.6e-92
WP_016511343.1|8798_11066_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.5	8.8e-119
17285:17298	attR	AAAAACTTAACAAT	NA	NA	NA	NA
>prophage 2
NZ_CP016071	Lactiplantibacillus plantarum strain NCU116 isolate Chinese pickle chromosome, complete genome	3354689	164136	171743	3354689	integrase	Escherichia_phage(50.0%)	9	159949:159963	180371:180385
159949:159963	attL	TTTTTTAAATCGTTT	NA	NA	NA	NA
WP_063722497.1|164136_165084_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI6	Catovirus	34.5	6.8e-41
WP_027822000.1|165101_165875_-	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_063722498.1|165861_166590_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_063722499.1|166601_167372_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_080440298.1|167728_168307_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	42.5	9.3e-33
WP_063722500.1|168338_169181_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.8	2.5e-34
WP_064971857.1|169250_170279_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	41.8	2.4e-68
WP_003644155.1|170288_170870_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.1	4.3e-38
WP_024002619.1|170873_171743_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	61.2	9.2e-101
180371:180385	attR	TTTTTTAAATCGTTT	NA	NA	NA	NA
>prophage 3
NZ_CP016071	Lactiplantibacillus plantarum strain NCU116 isolate Chinese pickle chromosome, complete genome	3354689	602615	611239	3354689		Streptococcus_phage(66.67%)	11	NA	NA
WP_063722777.1|602615_603611_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	37.9	2.2e-50
WP_003640969.1|603749_604535_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_003643942.1|604538_605435_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	9.9e-82
WP_003640967.1|605533_605881_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_063722776.1|605905_606925_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.9	7.4e-33
WP_003640965.1|606941_607271_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_011101140.1|607267_607933_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640957.1|608330_608582_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003637790.1|608596_609196_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640956.1|609211_609520_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003643940.1|609541_611239_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
>prophage 4
NZ_CP016071	Lactiplantibacillus plantarum strain NCU116 isolate Chinese pickle chromosome, complete genome	3354689	741045	802233	3354689	bacteriocin,protease,tRNA	uncultured_Mediterranean_phage(22.22%)	57	NA	NA
WP_060684287.1|741045_742317_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.9	2.6e-96
WP_063722864.1|742783_744397_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.6e-144
WP_003642041.1|744569_745178_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003642040.1|745222_745663_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_024971479.1|746025_746958_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_169484456.1|746966_748325_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
WP_015379810.1|748344_749154_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_024971609.1|749322_750309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379808.1|750391_751414_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003643830.1|751702_752683_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_063722865.1|753048_753873_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003642031.1|754108_755491_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.2	5.7e-28
WP_003642030.1|755559_756396_-	pur operon repressor	NA	NA	NA	NA	NA
WP_063722866.1|756888_757152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063722867.1|757166_757709_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_162899478.1|758258_758420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003646500.1|758788_759586_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003642023.1|759578_760277_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_063722868.1|760545_761490_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003643828.1|761799_762666_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003642020.1|762798_763050_-	Veg family protein	NA	NA	NA	NA	NA
WP_003642019.1|763154_764045_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_022638211.1|764041_764605_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_003643825.1|764591_765368_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_064971879.1|765619_766108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043992601.1|766670_767561_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_015379798.1|767594_768779_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_063722871.1|769059_769434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643823.1|769912_771964_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
WP_011101012.1|772285_772675_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003642012.1|773271_774114_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003646490.1|774113_774818_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_064971880.1|774839_775799_-	IpaB/EvcA family protein	NA	NA	NA	NA	NA
WP_063722873.1|775791_777066_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_003642008.1|777111_778029_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_047672680.1|778997_780131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027822753.1|780585_781599_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642004.1|781711_782458_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080475163.1|782607_783504_-	ROK family protein	NA	NA	NA	NA	NA
WP_027821494.1|783584_785021_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	1.3e-30
WP_003643816.1|785038_786394_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642000.1|786616_787039_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003641999.1|787028_787217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641998.1|787223_788585_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641997.1|788657_789368_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015825134.1|789773_790790_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_064971881.1|791228_792005_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_064971882.1|792263_794573_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_064971883.1|794667_794871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027821497.1|795008_795695_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_053339247.1|795788_796469_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_027821499.1|796555_797224_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_027821500.1|797291_797981_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_027821501.1|798070_799447_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027821502.1|799463_801614_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	3.6e-45
WP_064971884.1|801879_802050_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_003643811.1|802074_802233_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
>prophage 5
NZ_CP016071	Lactiplantibacillus plantarum strain NCU116 isolate Chinese pickle chromosome, complete genome	3354689	2042307	2050818	3354689		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645861.1|2042307_2042790_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
WP_064971978.1|2042773_2043904_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_021356104.1|2043906_2044638_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	2.1e-37
WP_003642588.1|2044639_2044894_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_011101895.1|2044893_2045574_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_021356102.1|2045566_2047786_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.1	3.5e-144
WP_003642591.1|2047770_2049225_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_003645866.1|2049221_2050247_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	2.7e-59
WP_003645867.1|2050239_2050818_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
>prophage 6
NZ_CP016071	Lactiplantibacillus plantarum strain NCU116 isolate Chinese pickle chromosome, complete genome	3354689	2243866	2277175	3354689	terminase,portal,integrase,capsid,tail	Lactobacillus_phage(62.5%)	44	2243626:2243646	2286096:2286116
2243626:2243646	attL	CCGTGCGGGTGATAAGTCGAC	NA	NA	NA	NA
WP_063722928.1|2243866_2244988_-|integrase	tyrosine-type recombinase/integrase	integrase	D6PSS4	Lactobacillus_phage	32.1	2.9e-46
WP_063722927.1|2245148_2245943_-	hypothetical protein	NA	U5U717	Lactobacillus_phage	27.5	1.6e-11
WP_063722926.1|2245959_2246181_+	hypothetical protein	NA	U5U783	Lactobacillus_phage	41.5	1.1e-05
WP_003642778.1|2246365_2246542_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	51.7	2.6e-10
WP_063486624.1|2246818_2247154_-	hypothetical protein	NA	A0A1B0Y4P2	Lactobacillus_phage	52.2	4.1e-25
WP_087613285.1|2247632_2248331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157668938.1|2248515_2249439_-	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_064971992.1|2249539_2249962_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_064971993.1|2249976_2250480_-	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	41.4	3.8e-22
WP_060417532.1|2250626_2250881_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064971994.1|2251037_2251319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642792.1|2251397_2251568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064971995.1|2251579_2251885_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_064971996.1|2251951_2252464_+	transcriptional regulator	NA	D6PST4	Lactobacillus_phage	44.7	1.2e-28
WP_080475178.1|2252834_2253221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064971998.1|2253217_2254117_+	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	53.3	9.3e-64
WP_172821809.1|2254148_2254901_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	49.8	4.7e-69
WP_064971999.1|2254981_2255890_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_064972000.1|2255886_2256174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064972001.1|2256170_2256689_+	hypothetical protein	NA	O03915	Lactobacillus_phage	60.5	4.3e-45
WP_033611989.1|2256685_2257069_+	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_064505709.1|2257335_2257500_-	YjzC family protein	NA	A0A0A7RTS6	Clostridium_phage	66.0	3.0e-13
WP_052048925.1|2257624_2257849_+	helix-turn-helix transcriptional regulator	NA	D2IZX1	Enterococcus_phage	37.5	1.4e-05
WP_076640085.1|2257841_2258054_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	86.0	2.1e-11
WP_003642805.1|2258181_2258643_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	1.1e-39
WP_063964074.1|2259364_2260210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080469165.1|2260256_2260424_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	57.4	7.3e-07
WP_063723236.1|2260410_2260674_+	hypothetical protein	NA	A0A1S5RCN3	Lactobacillus_phage	68.6	1.1e-28
WP_063486483.1|2260713_2261223_+	helix-turn-helix domain-containing protein	NA	A0A2H4IYT3	uncultured_Caudovirales_phage	36.8	4.5e-07
WP_064522746.1|2261203_2262529_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1S5SA45	Streptococcus_phage	55.7	4.5e-139
WP_155123380.1|2262531_2264127_+|portal	phage portal protein	portal	B5LPR1	Bacillus_virus	37.5	7.6e-85
WP_064972004.1|2264119_2265205_+	hypothetical protein	NA	A0A059T7W2	Listeria_phage	31.4	6.2e-38
WP_064972005.1|2265268_2265871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064972006.1|2265884_2266832_+|capsid	N4-gp56 family major capsid protein	capsid	A8ASJ6	Listeria_phage	59.5	3.9e-89
WP_064972007.1|2266920_2267181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064972008.1|2267191_2267596_+	hypothetical protein	NA	A5GYM1	Lactococcus_phage	27.5	5.7e-05
WP_064972009.1|2267596_2267986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046947889.1|2267982_2268384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063722337.1|2268383_2268809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064972010.1|2268826_2269435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064972011.1|2269553_2270072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064972012.1|2270068_2270710_+	hypothetical protein	NA	U3PFU8	Lactobacillus_phage	28.1	1.1e-07
WP_064972013.1|2270725_2276356_+|tail	phage tail tape measure protein	tail	U5U708	Lactobacillus_phage	59.0	8.0e-113
WP_064972014.1|2276356_2277175_+|tail	phage tail family protein	tail	NA	NA	NA	NA
2286096:2286116	attR	CCGTGCGGGTGATAAGTCGAC	NA	NA	NA	NA
>prophage 7
NZ_CP016071	Lactiplantibacillus plantarum strain NCU116 isolate Chinese pickle chromosome, complete genome	3354689	2577860	2666465	3354689	terminase,portal,tRNA,protease,head,integrase,holin,transposase,capsid,tail	Lactobacillus_phage(81.13%)	95	2570910:2570927	2640865:2640882
2570910:2570927	attL	ATGGAAAAAGCCGTTGAC	NA	NA	NA	NA
WP_053338955.1|2577860_2579024_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	36.5	1.2e-55
WP_157951717.1|2579417_2579879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064972033.1|2581061_2581937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064972034.1|2582066_2582741_-	LexA family transcriptional regulator	NA	D7RWL5	Brochothrix_phage	45.1	2.7e-52
WP_063485655.1|2582908_2583157_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IX93	Lactobacillus_phage	61.4	4.0e-17
WP_063487054.1|2583172_2583880_+	Rha family transcriptional regulator	NA	D2IYT0	Enterococcus_phage	58.6	2.8e-63
WP_064972035.1|2583891_2584101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380501.1|2584216_2584543_-	hypothetical protein	NA	E9LUT2	Lactobacillus_phage	98.1	2.7e-53
WP_064972036.1|2584600_2584861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380499.1|2585002_2585251_+	hypothetical protein	NA	E9LUT6	Lactobacillus_phage	84.1	1.9e-35
WP_015380498.1|2585253_2585454_+	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	89.4	1.7e-26
WP_064972037.1|2585465_2585690_+	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	86.5	8.3e-30
WP_016058361.1|2585738_2585885_+	hypothetical protein	NA	E9LUT9	Lactobacillus_phage	100.0	4.3e-19
WP_127064441.1|2585887_2586418_+	host-nuclease inhibitor Gam family protein	NA	E9LUU0	Lactobacillus_phage	99.4	3.6e-92
WP_016058363.1|2586426_2587089_+	AAA family ATPase	NA	E9LUU1	Lactobacillus_phage	100.0	4.2e-122
WP_064972038.1|2587090_2587750_+	DUF669 domain-containing protein	NA	O03912	Lactobacillus_phage	80.4	5.7e-95
WP_064972039.1|2587796_2588489_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	97.8	4.9e-129
WP_155123382.1|2588475_2588682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064972041.1|2588750_2589479_+	replisome organizer	NA	E9LUM6	Lactobacillus_phage	41.3	1.1e-41
WP_064972042.1|2589478_2590264_+	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	91.6	1.1e-132
WP_064972043.1|2590399_2590702_+	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	91.0	6.1e-44
WP_063487063.1|2590704_2591016_+	hypothetical protein	NA	A0A2P0ZLB4	Lactobacillus_phage	91.3	5.0e-49
WP_063487884.1|2591019_2591214_+	hypothetical protein	NA	A0A2P0ZLB7	Lactobacillus_phage	72.4	9.1e-17
WP_127064439.1|2591206_2591365_+	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	88.5	3.3e-17
WP_063487065.1|2591540_2591870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644538.1|2592154_2592580_+	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	77.3	3.3e-59
WP_064972044.1|2592902_2593814_+	DUF4868 domain-containing protein	NA	A0A1Q1PW39	Staphylococcus_phage	25.5	5.4e-11
WP_172821806.1|2594520_2594691_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	94.6	1.3e-22
WP_080475182.1|2594701_2595172_+	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	93.6	1.6e-83
WP_064972047.1|2595177_2595441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063487069.1|2595458_2595710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064972048.1|2595898_2596357_+|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	96.7	1.2e-80
WP_064972049.1|2596359_2598258_+|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	96.8	0.0e+00
WP_064972050.1|2598247_2598442_+	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	98.4	3.3e-27
WP_064972051.1|2598444_2599638_+|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	98.7	2.4e-224
WP_064972052.1|2599615_2600371_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	93.2	1.8e-124
WP_064972053.1|2600370_2601603_+|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	88.9	2.4e-203
WP_016058329.1|2601675_2602014_+|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	100.0	7.0e-57
WP_016058330.1|2601997_2602360_+|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	100.0	5.2e-66
WP_063722567.1|2602349_2602790_+	hypothetical protein	NA	E9LUQ6	Lactobacillus_phage	99.3	5.0e-79
WP_063722568.1|2602786_2603170_+	hypothetical protein	NA	E9LUQ7	Lactobacillus_phage	98.4	9.4e-66
WP_063722569.1|2603170_2603809_+|tail	phage tail protein	tail	E9LUQ8	Lactobacillus_phage	99.5	1.1e-116
WP_016058334.1|2604010_2604394_+	hypothetical protein	NA	E9LUQ9	Lactobacillus_phage	100.0	3.9e-64
WP_016058335.1|2604390_2604582_+	hypothetical protein	NA	E9LUR0	Lactobacillus_phage	100.0	1.5e-27
WP_064972054.1|2604594_2609736_+|tail	phage tail protein	tail	E9LUR1	Lactobacillus_phage	84.4	0.0e+00
WP_064972055.1|2609807_2611577_+|tail	phage tail family protein	tail	E9LUR2	Lactobacillus_phage	95.8	0.0e+00
WP_064972056.1|2611640_2614010_+|tail	phage tail protein	tail	E9LUR3	Lactobacillus_phage	94.7	0.0e+00
WP_064972057.1|2614026_2615331_+	hypothetical protein	NA	A0A2P0ZL34	Lactobacillus_phage	76.8	1.2e-22
WP_053339307.1|2615416_2616592_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_044430958.1|2618155_2618407_+	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	95.8	9.3e-30
WP_003641410.1|2618410_2618572_+	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	96.2	4.7e-19
WP_064972058.1|2618555_2619440_+	hypothetical protein	NA	E9LUR7	Lactobacillus_phage	98.0	1.8e-136
WP_064972059.1|2619455_2620628_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	94.4	1.0e-211
WP_003644510.1|2620627_2620891_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_064972060.1|2620902_2621439_+|holin	holin	holin	E9LUS0	Lactobacillus_phage	95.7	8.0e-39
WP_064972061.1|2622672_2623884_+	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_003644507.1|2624362_2626105_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003645638.1|2626123_2626915_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	4.5e-30
WP_076670309.1|2626895_2628065_+	LCP family protein	NA	NA	NA	NA	NA
WP_063722578.1|2628216_2628789_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_063722579.1|2629488_2630430_-	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	48.7	4.1e-78
WP_015640487.1|2630876_2631269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003645633.1|2631432_2631825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063722580.1|2631860_2633030_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003645631.1|2633079_2633709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089178220.1|2634012_2634243_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_003640747.1|2634332_2634965_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_003644501.1|2635116_2635356_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640745.1|2635453_2635690_+	YneF family protein	NA	NA	NA	NA	NA
WP_003645630.1|2635746_2636382_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_063722581.1|2636493_2637252_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_053267827.1|2637235_2637541_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_003640741.1|2637625_2638624_+	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
WP_003640740.1|2638912_2639635_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003640739.1|2639859_2640663_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003644498.1|2640765_2641644_+	elongation factor Ts	NA	NA	NA	NA	NA
2640865:2640882	attR	ATGGAAAAAGCCGTTGAC	NA	NA	NA	NA
WP_003640737.1|2641843_2642566_+	UMP kinase	NA	NA	NA	NA	NA
WP_003640736.1|2642567_2643131_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_063722583.1|2643250_2644030_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.3	9.0e-23
WP_063722584.1|2644045_2644831_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_064972062.1|2644868_2646146_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_063722585.1|2646185_2647895_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003640729.1|2648388_2652702_+	DNA polymerase III subunit alpha	NA	A0A1X9SH08	Bradyrhizobium_phage	34.0	1.0e-14
WP_003640728.1|2652997_2653474_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_003640727.1|2653494_2654712_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003640726.1|2654756_2655056_+	YlxR family protein	NA	NA	NA	NA	NA
WP_003640725.1|2655045_2655351_+	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_003645962.1|2655365_2657942_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	23.3	9.6e-21
WP_003640723.1|2657964_2658318_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_063722586.1|2660415_2661585_+	chorismate synthase	NA	NA	NA	NA	NA
WP_003645964.1|2661593_2662121_+	amino acid biosynthesis protein	NA	NA	NA	NA	NA
WP_063722587.1|2662134_2663433_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_015825650.1|2663435_2664533_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_003645967.1|2664535_2665057_+	shikimate kinase	NA	NA	NA	NA	NA
WP_080475183.1|2665541_2666465_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP016071	Lactiplantibacillus plantarum strain NCU116 isolate Chinese pickle chromosome, complete genome	3354689	3156357	3164874	3354689		Lactobacillus_phage(85.71%)	8	NA	NA
WP_003645220.1|3156357_3157353_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.8	3.1e-52
WP_015380221.1|3157979_3158117_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_011101401.1|3158212_3158653_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	98.6	3.0e-76
WP_003643095.1|3158723_3159284_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
WP_063723107.1|3159371_3161810_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.5	0.0e+00
WP_063723106.1|3161812_3162427_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	99.5	2.4e-111
WP_003643099.1|3162769_3163717_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_015825455.1|3163902_3164874_+	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	99.4	1.8e-182
>prophage 9
NZ_CP016071	Lactiplantibacillus plantarum strain NCU116 isolate Chinese pickle chromosome, complete genome	3354689	3192309	3283830	3354689	terminase,portal,tRNA,protease,integrase,holin,transposase,capsid,tail,lysis	Lactobacillus_phage(71.15%)	88	3219044:3219060	3286381:3286397
WP_024003017.1|3192309_3193998_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.9	1.5e-75
WP_011101382.1|3194269_3194716_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003643130.1|3195104_3195350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643131.1|3195476_3196868_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_024003015.1|3197143_3198919_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_003645241.1|3199351_3201091_-	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_063723098.1|3201312_3202269_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_003645243.1|3202258_3202882_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	40.6	4.8e-27
WP_064972090.1|3202884_3204060_-	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	31.7	2.9e-49
WP_064972091.1|3204037_3205675_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_063723097.1|3206563_3208870_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_064972092.1|3208883_3210740_+	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_003645248.1|3210812_3211172_+	YisL family protein	NA	NA	NA	NA	NA
WP_003643142.1|3211271_3211793_-	GtrA family protein	NA	NA	NA	NA	NA
WP_003643143.1|3211898_3212912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003645249.1|3213076_3213502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064972093.1|3214065_3214959_-	SH3 domain-containing protein	NA	A0A2P0ZLG2	Lactobacillus_phage	86.1	4.2e-117
WP_054396940.1|3214958_3215243_-|lysis	lysis protein	lysis	A0A2P0ZLE8	Lactobacillus_phage	98.9	3.1e-42
WP_047674473.1|3215242_3215437_-	hypothetical protein	NA	A0A2P0ZLG4	Lactobacillus_phage	98.4	3.4e-24
WP_061871516.1|3215439_3215823_-	hypothetical protein	NA	A0A2P0ZLF7	Lactobacillus_phage	98.4	1.3e-67
WP_064972094.1|3215839_3216274_-	hypothetical protein	NA	A0A2P0ZLE9	Lactobacillus_phage	98.6	1.0e-71
WP_064972150.1|3216275_3216758_-	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	100.0	1.3e-80
WP_064972095.1|3216783_3220737_-	hypothetical protein	NA	A0A2P0ZLE1	Lactobacillus_phage	72.2	0.0e+00
3219044:3219060	attL	TCATTGACTGTAACAAA	NA	NA	NA	NA
WP_064972096.1|3220756_3221578_-|tail	phage tail protein	tail	A0A2P0ZLE2	Lactobacillus_phage	99.6	2.0e-153
WP_064972097.1|3221581_3226126_-|tail	phage tail tape measure protein	tail	A0A2P0ZLF1	Lactobacillus_phage	97.2	0.0e+00
WP_003643912.1|3226144_3226366_-	hypothetical protein	NA	A0A2P0ZLD9	Lactobacillus_phage	98.6	3.9e-32
WP_061871520.1|3226389_3226704_-	hypothetical protein	NA	A0A2P0ZLF3	Lactobacillus_phage	90.4	4.2e-48
WP_061871521.1|3226775_3227048_-	Ig-like domain-containing protein	NA	A0A2P0ZLD8	Lactobacillus_phage	98.9	7.2e-36
WP_054396956.1|3227022_3227628_-|tail	phage tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	99.5	3.7e-109
WP_064972099.1|3227642_3228065_-	hypothetical protein	NA	A0A2P0ZLE4	Lactobacillus_phage	98.6	1.9e-72
WP_015380187.1|3228061_3228469_-	HK97 gp10 family phage protein	NA	A0A2P0ZLD7	Lactobacillus_phage	94.1	2.0e-66
WP_064972100.1|3228465_3228855_-	hypothetical protein	NA	A0A2P0ZLD1	Lactobacillus_phage	97.7	2.7e-68
WP_024002308.1|3228835_3229141_-	hypothetical protein	NA	A0A2P0ZLD5	Lactobacillus_phage	100.0	4.4e-50
WP_064972101.1|3229279_3230458_-|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	99.0	7.3e-218
WP_003643904.1|3230478_3231231_-|protease	Clp protease ClpP	protease	A0A2P0ZLE3	Lactobacillus_phage	98.8	6.0e-133
WP_064972102.1|3231217_3232360_-|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	97.9	8.1e-214
WP_064972103.1|3232378_3234058_-|terminase	terminase large subunit	terminase	A0A2P0ZLE5	Lactobacillus_phage	69.5	2.6e-229
WP_064972151.1|3234054_3234342_-|terminase	P27 family phage terminase small subunit	terminase	A0A2P0ZLC8	Lactobacillus_phage	65.3	4.9e-27
WP_064972104.1|3234449_3234692_-	hypothetical protein	NA	A0A2P0ZLD2	Lactobacillus_phage	98.8	2.1e-39
WP_064972106.1|3234951_3235290_-	HNH endonuclease	NA	A0A2P0ZLC6	Lactobacillus_phage	94.6	3.1e-60
WP_060811411.1|3235273_3235474_-	hypothetical protein	NA	A0A2P0ZLC2	Lactobacillus_phage	86.4	5.1e-15
WP_064972107.1|3235811_3236348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064972152.1|3236546_3237206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054396990.1|3237280_3237694_-	hypothetical protein	NA	A0A2P0ZLC0	Lactobacillus_phage	94.9	3.7e-68
WP_064972108.1|3237704_3238013_-	hypothetical protein	NA	A0A2P0ZLD0	Lactobacillus_phage	91.1	7.8e-47
WP_064972109.1|3238229_3238595_-	hypothetical protein	NA	A0A2I7RY34	Vibrio_phage	38.3	3.0e-13
WP_155123383.1|3238607_3238946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064972111.1|3238929_3239127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064972112.1|3239145_3239478_-	VRR-NUC domain-containing protein	NA	A0A2P0ZLB6	Lactobacillus_phage	87.3	1.5e-51
WP_064972113.1|3239737_3241012_-	helicase	NA	A0A2P0ZLC4	Lactobacillus_phage	97.4	4.8e-239
WP_064972114.1|3241008_3241803_-	bifunctional DNA primase/polymerase	NA	A0A2P0ZLB0	Lactobacillus_phage	86.0	8.3e-125
WP_064972115.1|3241873_3242497_-	hypothetical protein	NA	A0A2P0ZLB9	Lactobacillus_phage	100.0	3.2e-103
WP_064972116.1|3242499_3243216_-	AAA family ATPase	NA	A0A2P0ZLB2	Lactobacillus_phage	99.5	2.7e-114
WP_061871542.1|3243193_3243415_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RUJ5	Clostridium_phage	40.3	5.7e-07
WP_080475195.1|3243411_3244743_-	DEAD/DEAH box helicase family protein	NA	A0A2P0ZLA5	Lactobacillus_phage	93.7	5.9e-240
WP_064972117.1|3244822_3245302_-	siphovirus Gp157 family protein	NA	A0A2P0ZLB3	Lactobacillus_phage	96.9	3.4e-81
WP_063486030.1|3245405_3245723_-	hypothetical protein	NA	A0A2P0ZLA7	Lactobacillus_phage	100.0	7.0e-59
WP_064972118.1|3245992_3246370_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV8	Bacillus_phage	38.5	7.0e-05
WP_172821808.1|3248207_3248348_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155123384.1|3249536_3249674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064972119.1|3250225_3250618_+	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	34.7	7.7e-07
WP_016058040.1|3251651_3252113_+	GNAT family N-acetyltransferase	NA	E9LUK4	Lactobacillus_phage	100.0	1.7e-82
WP_003646108.1|3252271_3252610_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J5G9	uncultured_Caudovirales_phage	38.2	3.7e-05
WP_064972120.1|3252806_3253238_+	YjdF family protein	NA	NA	NA	NA	NA
WP_001748110.1|3253374_3253719_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_064972121.1|3254060_3254657_+|integrase	site-specific integrase	integrase	E2ELN7	Clostridium_phage	33.1	6.7e-18
WP_060678111.1|3254989_3255202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013356275.1|3261253_3262093_+	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_013356274.1|3262100_3263018_+	glycine/betaine ABC transporter	NA	NA	NA	NA	NA
WP_016526705.1|3263263_3264229_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	26.8	7.0e-09
WP_053339316.1|3264383_3265313_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	29.5	1.9e-19
WP_016526703.1|3265350_3265650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013356270.1|3265651_3266512_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	40.2	1.7e-43
WP_053339315.1|3268459_3268741_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_033098918.1|3268730_3269237_+	mRNA interferase PemK	NA	NA	NA	NA	NA
WP_027822961.1|3269306_3270014_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_111443564.1|3270022_3270898_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	28.5	1.8e-19
WP_053339314.1|3270920_3271211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003555660.1|3271233_3271461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064972122.1|3271712_3273773_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_021353390.1|3275227_3275317_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_058906975.1|3275664_3276891_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	48.0	2.3e-89
WP_053339310.1|3277271_3278426_-	S-adenosyl-L-homocysteine hydrolase	NA	NA	NA	NA	NA
WP_014940864.1|3278415_3279078_-	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	29.1	2.8e-09
WP_053339309.1|3279077_3280469_-	MFS transporter	NA	NA	NA	NA	NA
WP_006293514.1|3280756_3280861_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_053339308.1|3281139_3282219_+	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	51.9	9.0e-05
WP_053339307.1|3282654_3283830_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
3286381:3286397	attR	TTTGTTACAGTCAATGA	NA	NA	NA	NA
>prophage 10
NZ_CP016071	Lactiplantibacillus plantarum strain NCU116 isolate Chinese pickle chromosome, complete genome	3354689	3291058	3301147	3354689	transposase	Enterococcus_phage(28.57%)	9	NA	NA
WP_064972154.1|3291058_3293206_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.2	6.1e-255
WP_010623241.1|3293312_3294239_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A2H4P8A9	Corynebacterium_phage	32.1	5.9e-37
WP_046811155.1|3294253_3295204_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	54.3	1.2e-98
WP_112260612.1|3295331_3296144_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_064972123.1|3296257_3296890_+	recombinase family protein	NA	A0A1B0VBM1	Salmonella_phage	30.6	2.4e-13
WP_013356283.1|3296976_3297879_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	40.3	6.3e-52
WP_112260613.1|3297986_3298761_+|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_013356282.1|3299132_3300287_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_112260613.1|3300371_3301147_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
