The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021070	Mesorhizobium sp. WSM1497 chromosome, complete genome	6666492	2779475	2786703	6666492		Burkholderia_phage(50.0%)	9	NA	NA
WP_086081307.1|2779475_2779832_+	hypothetical protein	NA	A0A1S6KZY3	Salmonella_phage	37.4	1.1e-12
WP_157678474.1|2779907_2780303_+	hypothetical protein	NA	A0A1S6KZY3	Salmonella_phage	43.1	2.5e-05
WP_064994693.1|2780271_2780481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064994795.1|2780816_2782076_+	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	53.1	4.0e-113
WP_064994694.1|2782068_2782524_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	57.0	4.4e-46
WP_064994794.1|2782526_2783774_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	45.5	6.1e-98
WP_031200141.1|2783778_2784594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064994695.1|2785767_2786079_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_064994696.1|2786169_2786703_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	50.4	3.1e-22
>prophage 2
NZ_CP021070	Mesorhizobium sp. WSM1497 chromosome, complete genome	6666492	6341657	6417051	6666492	transposase,integrase	Stx2-converting_phage(22.22%)	52	6360073:6360132	6416881:6416977
WP_064995672.1|6341657_6342767_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_064993412.1|6343059_6344592_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	41.2	1.2e-100
WP_064993413.1|6344661_6345018_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	34.3	2.7e-14
WP_064993414.1|6345014_6345458_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_086081363.1|6346455_6347358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064995517.1|6347442_6347841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084016206.1|6348476_6348761_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_084016208.1|6348782_6354200_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	33.4	3.9e-48
WP_084016210.1|6354624_6355332_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_064995288.1|6357302_6357500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084016212.1|6357501_6358680_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
6360073:6360132	attL	CCGTTCTTATGCATCGGGTGAGATTTTGTGGCGGAGCCGTCCTGGCGCCAGCCGAGGTCT	NA	NA	NA	NA
WP_064995508.1|6360169_6361177_-|integrase	site-specific integrase	integrase	A0A142F2H8	Mycobacterium_phage	29.8	1.9e-09
WP_064995509.1|6361173_6362106_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_086081364.1|6362102_6363341_-|integrase	site-specific integrase	integrase	A0A1P8DJP1	Virus_Rctr41k	30.0	3.5e-05
WP_086081365.1|6363557_6363743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140700825.1|6364889_6365288_+|transposase	transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	56.5	8.1e-28
WP_140700826.1|6365118_6365478_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_064995247.1|6365870_6366059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086081383.1|6366707_6367256_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_064995252.1|6367517_6367751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064995251.1|6368083_6368827_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	4.0e-28
WP_064995246.1|6368946_6369921_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_064995250.1|6369981_6370815_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_084016180.1|6375964_6376435_-	thioesterase	NA	NA	NA	NA	NA
WP_086081366.1|6378173_6379076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064995517.1|6379160_6379559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064994923.1|6379915_6380800_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_064994942.1|6381634_6381832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064994928.1|6385083_6386079_-	peptidase M14	NA	NA	NA	NA	NA
WP_084016114.1|6386226_6386628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084016100.1|6387390_6388668_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_064994943.1|6389064_6390246_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_084016102.1|6390951_6392637_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_064994930.1|6392633_6393866_-	carnitine dehydratase	NA	NA	NA	NA	NA
WP_064994931.1|6394035_6396729_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_064994932.1|6396794_6397577_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_084016104.1|6397751_6398735_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064994934.1|6398929_6399781_+	protein dehydratase	NA	NA	NA	NA	NA
WP_157678572.1|6400015_6400645_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_064994945.1|6400596_6400806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064994936.1|6401287_6402208_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_064994937.1|6402335_6403004_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_084016108.1|6403495_6404266_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_084016110.1|6404509_6404860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084016112.1|6405276_6406287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064994946.1|6407363_6408635_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_064995672.1|6408795_6409905_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_086081369.1|6412200_6413310_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_084016273.1|6413671_6414910_+|integrase	site-specific integrase	integrase	A0A1P8DJP1	Virus_Rctr41k	30.0	3.5e-05
WP_064995509.1|6414906_6415839_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_064995508.1|6415835_6416843_+|integrase	site-specific integrase	integrase	A0A142F2H8	Mycobacterium_phage	29.8	1.9e-09
WP_064993565.1|6416919_6417051_-|transposase	transposase	transposase	NA	NA	NA	NA
6416881:6416977	attR	AGACCTCGGCTGGCGCCAGGACGGCTCCGCCACAAAATCTCACCCGATGCATAAGAACGGATCGGCGCCCATCGTCTCGCGCACCAGCGCGGCCAAA	NA	NA	NA	NA
