The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015229	Escherichia coli strain 06-00048 chromosome, complete genome	5498453	376563	437539	5498453	holin,portal,transposase,terminase,capsid	Escherichia_phage(23.08%)	50	NA	NA
WP_085949012.1|376563_377258_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	99.1	1.1e-133
WP_065226213.1|377397_378723_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000339594.1|378948_379803_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_065226214.1|380321_381041_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_065226215.1|381051_382479_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_065226216.1|382471_383167_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_065226217.1|384272_385961_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	2.1e-61
WP_065226218.1|385974_387447_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001314510.1|387460_388048_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_032154316.1|389995_390976_-|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	28.1	8.4e-18
WP_065226219.1|392159_396149_+	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.7	9.0e-127
WP_065226220.1|396290_397379_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001084390.1|397420_398353_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065226221.1|398444_398942_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_064226112.1|399199_399805_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001389972.1|399844_400708_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_065226222.1|400697_402245_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_065226223.1|402244_403663_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_157921673.1|403698_403878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226224.1|403909_404860_+	carbamate kinase family protein	NA	NA	NA	NA	NA
WP_065226225.1|404869_406252_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_065226226.1|406549_406960_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_001042107.1|407213_408197_+	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_065226227.1|408245_409730_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	1.4e-11
WP_000818902.1|409722_410694_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750345.1|410690_411647_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_065226228.1|411733_412783_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	4.9e-72
WP_001558667.1|413025_413841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290613.1|414252_414498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077884127.1|414514_415186_-	LysE family transporter	NA	NA	NA	NA	NA
WP_000691953.1|415332_415608_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_065226229.1|415708_417295_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_000052173.1|417533_418424_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_001285909.1|418468_419638_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_001275873.1|419671_421123_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_000010235.1|421162_423049_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
WP_065226231.1|423921_424227_-	hypothetical protein	NA	C4MZ33	Escherichia_phage	60.9	1.2e-23
WP_065226232.1|424527_425079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226233.1|425801_426044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065226234.1|426059_427046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059257909.1|427163_427346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065226235.1|428629_429100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_185762092.1|429222_429375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226236.1|429462_430305_+	Rha family transcriptional regulator	NA	A0A1P8DTE1	Proteus_phage	37.4	8.6e-11
WP_000208373.1|430545_430770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065226237.1|430805_431408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065226238.1|431496_433404_+|terminase	phage terminase large subunit family protein	terminase	D6PFE7	uncultured_phage	29.9	2.4e-32
WP_065226239.1|433476_433971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226240.1|433981_435493_+|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	27.6	4.2e-32
WP_065226241.1|435538_437539_+|capsid	phage major capsid protein	capsid	G8EXZ9	Synechococcus_phage	24.9	3.9e-30
>prophage 2
NZ_CP015229	Escherichia coli strain 06-00048 chromosome, complete genome	5498453	1129493	1209272	5498453	integrase,tail,holin,portal,transposase,protease,terminase,head,capsid	Escherichia_phage(44.07%)	104	1144587:1144646	1204535:1204599
WP_000156477.1|1129493_1131254_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1131439_1131892_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750418.1|1131967_1133020_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288705.1|1133376_1133886_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|1134104_1134734_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_123007690.1|1134696_1136859_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261236.1|1136868_1137315_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_065226496.1|1137437_1139492_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
WP_000424181.1|1139523_1139982_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1140077_1140740_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1140912_1141326_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1141370_1141688_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_065226498.1|1141745_1142936_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_065226499.1|1143030_1143309_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1143305_1143635_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|1143725_1144385_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
1144587:1144646	attL	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAA	NA	NA	NA	NA
WP_001372523.1|1144792_1145812_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	9.8e-86
WP_000273158.1|1145780_1146032_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_065226500.1|1146098_1148549_-	exonuclease	NA	V5UQJ3	Shigella_phage	44.1	7.1e-106
WP_064236776.1|1148639_1148831_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_065226501.1|1148827_1149016_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_065226502.1|1149573_1149807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226503.1|1149784_1150192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065226504.1|1150207_1150423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092153.1|1150515_1150716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226507.1|1151116_1151404_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_042105938.1|1151404_1151596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042105939.1|1151631_1152027_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	57.1	4.0e-11
WP_097463237.1|1152057_1152429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042105941.1|1152531_1152819_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065226508.1|1152815_1153241_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_071906084.1|1153263_1154232_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	44.9	2.9e-71
WP_040091020.1|1154274_1154676_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	41.8	3.3e-21
WP_047088604.1|1154699_1154981_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	6.7e-29
WP_000699804.1|1154977_1155223_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	50.7	3.8e-12
WP_000004205.1|1155197_1155686_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.5	4.1e-66
WP_065226509.1|1155678_1155933_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	91.7	5.9e-40
WP_065226510.1|1155925_1156237_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	84.5	1.8e-51
WP_016241028.1|1156368_1156836_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.1	6.6e-37
WP_065226511.1|1156837_1157029_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.2e-26
WP_065226512.1|1157031_1157244_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	71.4	3.5e-06
WP_044809950.1|1157243_1157639_+	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	61.2	3.3e-37
WP_000220600.1|1157843_1158143_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	99.0	3.9e-51
WP_001260977.1|1158148_1158406_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	86.7	1.5e-30
WP_065228203.1|1158541_1158820_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_065226513.1|1158821_1159880_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.6	3.1e-90
WP_065226514.1|1159880_1160261_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.6	5.3e-37
WP_065226515.1|1160257_1161079_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	1.3e-77
WP_065226516.1|1161305_1161503_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_097310795.1|1161639_1162353_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000466940.1|1162804_1163230_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	85.8	3.8e-60
WP_000833650.1|1163226_1163379_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000839574.1|1163491_1163707_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	100.0	2.4e-34
WP_065226517.1|1163706_1164204_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	2.1e-89
WP_032145233.1|1164420_1164603_+	membrane protein	NA	A0A0P0ZE50	Stx2-converting_phage	75.4	1.4e-16
WP_001140099.1|1164707_1165058_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_001317918.1|1165206_1165689_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
WP_065226520.1|1166887_1168111_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	46.9	3.9e-97
WP_032166742.1|1168088_1168310_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001168899.1|1168373_1168652_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_065226521.1|1168709_1169303_+	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	54.8	2.9e-45
WP_065226524.1|1170496_1170964_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_065226525.1|1170953_1171175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226526.1|1171391_1171625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042104734.1|1171630_1171930_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_065226527.1|1171926_1173336_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	59.9	5.8e-113
WP_065228205.1|1173538_1173790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226528.1|1173786_1174212_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_065226529.1|1174227_1174509_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_065226530.1|1174554_1174803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001293446.1|1174840_1175314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065226531.1|1175608_1176754_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	68.0	1.5e-143
WP_000798768.1|1176803_1177364_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.9	2.6e-88
WP_029400191.1|1177365_1178580_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	86.3	2.9e-209
WP_001288062.1|1178572_1178872_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	62.1	2.1e-28
WP_001145897.1|1178871_1179312_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.0	9.1e-65
WP_123007684.1|1179295_1179481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029400192.1|1179600_1179957_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	83.8	7.9e-51
WP_065226532.1|1179940_1181602_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.6	5.2e-278
WP_065226533.1|1182866_1183049_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	90.0	2.7e-23
WP_065226534.1|1183048_1184290_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	98.1	1.8e-238
WP_065226535.1|1184267_1184918_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	99.1	2.3e-120
WP_065225932.1|1185779_1187279_+|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_040090800.1|1187275_1188031_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_065228207.1|1188616_1188934_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	51.5	4.8e-23
WP_001147814.1|1188942_1189281_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_065226536.1|1189277_1189727_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	8.7e-63
WP_065226537.1|1189723_1190068_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	99.1	1.6e-56
WP_065226538.1|1190127_1190832_+|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	96.2	6.7e-118
WP_063609925.1|1190846_1191218_+|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	95.1	4.4e-60
WP_065228208.1|1191241_1191520_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	2.1e-43
WP_065226539.1|1191566_1194806_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.2	0.0e+00
WP_054486529.1|1194798_1195140_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	65.5	4.6e-40
WP_065226540.1|1195139_1195838_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	2.6e-130
WP_065226541.1|1195842_1196586_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_065226542.1|1196483_1197131_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	5.0e-112
WP_047089024.1|1200454_1200826_+	hypothetical protein	NA	A0A1P8DUS1	Escherichia_phage	66.4	1.8e-45
WP_065226544.1|1200822_1201614_+	hypothetical protein	NA	A0A1P8DUT0	Escherichia_phage	75.0	1.8e-119
WP_065226545.1|1201704_1203801_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	64.3	4.2e-91
WP_065226546.1|1203815_1204400_+	DUF4376 domain-containing protein	NA	Q8W610	Enterobacteria_phage	56.0	1.1e-49
WP_001295940.1|1205053_1206172_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
1204535:1204599	attR	TTATTTGGCGGAAGCGCAGAGATTCGAACTCTGGAACCCTTTCGGGTCGCCGGTTTTCAAGACCG	NA	NA	NA	NA
WP_000107368.1|1206168_1207962_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1207980_1208688_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_001589983.1|1208684_1209272_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP015229	Escherichia coli strain 06-00048 chromosome, complete genome	5498453	1393919	1451854	5498453	integrase,tail,holin,portal,transposase,protease,tRNA,terminase	Escherichia_phage(35.19%)	70	1387712:1387726	1440585:1440599
1387712:1387726	attL	AAGTGCCGGGTATTG	NA	NA	NA	NA
WP_065226624.1|1393919_1395038_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.4	2.6e-84
WP_000003742.1|1395006_1395276_-	excisionase	NA	NA	NA	NA	NA
WP_065226625.1|1395337_1397809_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.0	1.9e-58
WP_001098307.1|1397902_1398094_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1398090_1398279_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_065226626.1|1398856_1399303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171961.1|1399392_1399608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001678562.1|1399767_1399923_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	4.0e-07
WP_000948454.1|1400241_1400718_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1400842_1401166_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693916.1|1401149_1401575_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_065228215.1|1401597_1402566_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.7	6.5e-71
WP_040091020.1|1402608_1403010_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	41.8	3.3e-21
WP_047088604.1|1403033_1403315_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	6.7e-29
WP_000699804.1|1403311_1403557_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	50.7	3.8e-12
WP_000004205.1|1403531_1404020_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.5	4.1e-66
WP_065226627.1|1404012_1404267_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	91.7	2.6e-40
WP_065226628.1|1404259_1404571_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	80.6	1.2e-47
WP_065226629.1|1404571_1404874_+	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	80.3	1.3e-22
WP_065226630.1|1404875_1405232_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	1.1e-55
WP_000063625.1|1405280_1405493_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_047671131.1|1405528_1406362_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	65.7	7.1e-26
WP_001278459.1|1406471_1406576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128520.1|1406763_1406976_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	3.1e-26
WP_001360563.1|1407143_1407422_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	2.8e-11
WP_065226631.1|1407423_1408473_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	8.8e-106
WP_065226632.1|1408485_1408845_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	4.9e-40
WP_065226633.1|1408841_1409531_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.5	1.1e-56
WP_000917767.1|1409747_1409945_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_185762095.1|1410081_1410795_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065226634.1|1411248_1411674_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	84.4	1.1e-59
WP_040091348.1|1411670_1411835_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	69.8	6.1e-06
WP_038813346.1|1412096_1412432_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	3.6e-45
WP_047085559.1|1412693_1413029_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	82.9	1.7e-47
WP_113771422.1|1413127_1413343_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	95.8	6.5e-32
WP_000282141.1|1413998_1414313_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	68.3	6.4e-36
WP_065225715.1|1414441_1414975_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	1.6e-100
WP_001208684.1|1416187_1416394_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	64.4	2.7e-11
WP_040091145.1|1416890_1417367_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	94.9	7.1e-79
WP_065226636.1|1417363_1419487_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|1419483_1419696_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_047088890.1|1419695_1421198_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	98.6	9.4e-287
WP_149003157.1|1421187_1423167_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	Q8VNN5	Enterobacteria_phage	99.1	0.0e+00
WP_047088889.1|1423253_1423580_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	87.9	6.6e-44
WP_001113015.1|1423572_1423854_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	84.9	1.6e-38
WP_047088888.1|1423856_1424480_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	96.6	3.9e-101
WP_000682716.1|1424492_1424891_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_047088887.1|1424898_1425648_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.0	2.5e-131
WP_042965925.1|1425663_1426095_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	1.5e-40
WP_042965924.1|1426121_1426526_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	76.5	1.7e-41
WP_065225932.1|1428703_1430203_+|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_040090800.1|1430199_1430955_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_047089015.1|1431471_1431801_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	4.0e-57
WP_001152612.1|1431800_1432499_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_047089014.1|1432504_1433248_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.9e-147
WP_001355446.1|1433184_1433787_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	83.7	1.5e-86
WP_001332187.1|1433859_1434198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047089024.1|1437528_1437900_+	hypothetical protein	NA	A0A1P8DUS1	Escherichia_phage	66.4	1.8e-45
WP_000017388.1|1437896_1438688_+	hypothetical protein	NA	A0A1P8DUT0	Escherichia_phage	75.0	3.1e-119
WP_065226640.1|1438778_1440869_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	61.6	7.1e-91
1440585:1440599	attR	CAATACCCGGCACTT	NA	NA	NA	NA
WP_065226641.1|1440883_1441456_+	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	55.4	5.4e-49
WP_000799405.1|1441690_1442554_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1442537_1443674_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_065226642.1|1443923_1445150_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1445198_1446320_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_001542840.1|1446395_1447856_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1447855_1448527_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|1448696_1450067_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|1450070_1450712_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_024044254.1|1450747_1451854_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP015229	Escherichia coli strain 06-00048 chromosome, complete genome	5498453	1656288	1709548	5498453	integrase,tail,holin,portal,transposase,protease,tRNA	Escherichia_phage(60.34%)	65	1646538:1646553	1698419:1698434
1646538:1646553	attL	CGCCAGCAACATCAGC	NA	NA	NA	NA
WP_024229936.1|1656288_1657521_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1657775_1658759_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_065226721.1|1659236_1660610_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	8.6e-53
WP_001157407.1|1660736_1661672_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1661723_1662959_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1662960_1663176_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001307770.1|1663275_1663464_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	95.2	7.9e-26
WP_001307771.1|1663456_1663651_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	98.4	5.8e-32
WP_021572575.1|1663683_1664364_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	95.6	1.2e-127
WP_047671032.1|1664360_1665140_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	94.3	1.5e-139
WP_000102059.1|1665145_1665442_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	81.6	6.8e-40
WP_077816938.1|1667890_1668061_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	6.1e-17
WP_000560223.1|1668060_1668282_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_065226722.1|1668675_1668909_+	hypothetical protein	NA	A0A0U2S658	Escherichia_phage	94.8	2.4e-32
WP_065226723.1|1668870_1669176_-	hypothetical protein	NA	A0A0U2S618	Escherichia_phage	95.0	4.7e-44
WP_000753628.1|1669427_1669889_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	100.0	3.4e-78
WP_001053423.1|1669996_1670272_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	100.0	3.4e-41
WP_000702028.1|1670255_1670678_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000695003.1|1670697_1671111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065228220.1|1671620_1672529_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	89.5	1.4e-96
WP_157840688.1|1672440_1672983_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	99.3	6.8e-86
WP_065226724.1|1673017_1673788_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	70.7	4.5e-91
WP_001563197.1|1673803_1674220_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.1	2.1e-58
WP_001563198.1|1674216_1674705_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.1	1.7e-67
WP_001563199.1|1674697_1674952_+	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	91.7	5.3e-41
WP_047671132.1|1674944_1675256_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	81.6	1.2e-47
WP_001217588.1|1675256_1675562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047671131.1|1675657_1676491_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	65.7	7.1e-26
WP_001278459.1|1676600_1676705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047671129.1|1676948_1677104_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	2.5e-17
WP_047671128.1|1677354_1677528_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	73.6	2.8e-17
WP_047671127.1|1677587_1678187_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.3e-106
WP_047671126.1|1678186_1678477_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	83.3	7.6e-44
WP_047671125.1|1678473_1679016_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.6	1.6e-74
WP_077783273.1|1679403_1680129_+	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	65.5	2.2e-79
WP_047671124.1|1680196_1680622_+	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
WP_001294583.1|1680679_1681072_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	89.2	5.7e-50
WP_000950565.1|1681061_1681337_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	94.5	9.8e-41
WP_047671123.1|1681339_1681717_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	95.2	7.3e-63
WP_047671122.1|1681787_1682069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001208684.1|1682503_1682710_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	64.4	2.7e-11
WP_000348567.1|1683206_1683683_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	93.7	4.6e-78
WP_000102415.1|1685799_1686012_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_065226726.1|1686011_1687514_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	98.0	1.4e-285
WP_135564167.1|1687503_1689483_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	99.2	0.0e+00
WP_065226727.1|1689570_1689897_+	DUF2190 family protein	NA	S5MQJ5	Escherichia_phage	90.7	2.0e-45
WP_065226728.1|1689889_1690171_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	92.5	2.4e-42
WP_065226729.1|1690173_1690800_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	92.8	9.9e-97
WP_065226730.1|1690809_1691208_+|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	95.5	4.0e-67
WP_047088887.1|1691215_1691965_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.0	2.5e-131
WP_042965925.1|1691980_1692412_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	1.5e-40
WP_065226731.1|1692438_1692843_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	77.5	5.9e-42
WP_065226732.1|1692832_1695445_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.8	0.0e+00
WP_000847333.1|1695441_1695771_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	3.1e-57
WP_001152536.1|1695770_1696469_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_065226733.1|1696542_1697298_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	34.3	1.9e-33
WP_065225932.1|1697294_1698794_-|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
1698419:1698434	attR	GCTGATGTTGCTGGCG	NA	NA	NA	NA
WP_065226734.1|1698890_1699634_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	4.3e-147
WP_071533105.1|1699570_1700203_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.6	1.2e-94
WP_065226735.1|1700263_1703965_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	78.7	0.0e+00
WP_001230293.1|1704031_1704631_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	3.0e-111
WP_065226736.1|1704696_1706787_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	64.0	1.3e-89
WP_047671102.1|1706801_1707380_+	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	57.8	3.4e-51
WP_001295593.1|1707839_1708274_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837924.1|1708414_1709548_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 5
NZ_CP015229	Escherichia coli strain 06-00048 chromosome, complete genome	5498453	1789352	1844590	5498453	plate,transposase,head,tail	Escherichia_phage(31.67%)	73	NA	NA
WP_063502223.1|1789352_1789877_-	hypothetical protein	NA	A0A0C4UQZ2	Shigella_phage	89.7	4.0e-83
WP_000551058.1|1790062_1790284_+	helix-turn-helix domain-containing protein	NA	A0A0C4UQU0	Shigella_phage	98.6	1.4e-34
WP_065226792.1|1790291_1792280_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	C9DGL1	Escherichia_phage	97.6	0.0e+00
WP_065226793.1|1792318_1793278_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	76.8	6.1e-130
WP_063081999.1|1793274_1793502_+	hypothetical protein	NA	C9DGL3	Escherichia_phage	84.0	9.9e-31
WP_065226794.1|1793534_1793804_+	hypothetical protein	NA	C9DGL5	Escherichia_phage	58.4	1.4e-20
WP_065226795.1|1793824_1794244_+	hypothetical protein	NA	A0A0C4UR25	Shigella_phage	87.6	1.5e-61
WP_065226796.1|1794260_1794548_+	hypothetical protein	NA	C9DGL7	Escherichia_phage	87.9	2.1e-38
WP_065226797.1|1794568_1795093_+	host-nuclease inhibitor Gam family protein	NA	A0A0C4UQY5	Shigella_phage	96.6	3.2e-88
WP_065226798.1|1795191_1795734_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	84.2	7.0e-83
WP_053272310.1|1795726_1795909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226799.1|1795901_1796228_+	hypothetical protein	NA	A0A0C4UQY6	Shigella_phage	70.7	1.7e-31
WP_065226800.1|1796494_1797046_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	81.9	1.3e-84
WP_040100375.1|1797042_1797492_+	Middle operon regulator	NA	A0A0C4UR27	Shigella_phage	62.7	4.2e-41
WP_065226801.1|1797577_1798174_+	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	41.1	5.1e-34
WP_065226802.1|1798175_1798427_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	68.9	1.8e-25
WP_047084861.1|1798401_1798812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047084862.1|1798799_1799408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226803.1|1799404_1799632_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_065226804.1|1799616_1799922_+	DUF2730 family protein	NA	M1Q558	Vibrio_phage	38.7	1.8e-11
WP_065228223.1|1799927_1800215_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	60.6	2.1e-25
WP_065226805.1|1800217_1800517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170981737.1|1800506_1800665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047084866.1|1800654_1801236_+	DUF3486 family protein	NA	M1PJ86	Vibrio_phage	55.0	1.1e-49
WP_077884272.1|1801241_1802768_+	hypothetical protein	NA	M1NVQ0	Vibrio_phage	67.9	6.0e-196
WP_065226807.1|1802764_1804336_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	57.1	1.1e-155
WP_065226808.1|1804328_1805093_+	hypothetical protein	NA	M4M9M5	Vibrio_phage	60.1	1.4e-92
WP_065226809.1|1805306_1806263_+	peptidase	NA	M1Q578	Vibrio_phage	47.2	9.2e-78
WP_065226810.1|1806270_1807176_+|head	Mu-like prophage major head subunit gpT family protein	head	M4MB71	Vibrio_phage	57.8	2.0e-98
WP_065226811.1|1807254_1807566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000540584.1|1807565_1808003_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	49.0	1.4e-33
WP_000513058.1|1808002_1808545_+	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	63.1	1.6e-58
WP_065226812.1|1808541_1809153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226813.1|1809133_1809337_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_065226814.1|1809341_1810817_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	54.9	1.9e-151
WP_001062748.1|1810826_1811183_+|tail	phage tail tube protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	35.5	2.9e-13
WP_065226815.1|1811184_1811580_+|tail	phage tail assembly protein	tail	M4MB64	Vibrio_phage	47.9	1.1e-19
WP_065226816.1|1811666_1813514_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	51.5	2.4e-122
WP_065226817.1|1813513_1814788_+	DNA circularization N-terminal domain-containing protein	NA	A0A2I7S9E8	Vibrio_phage	38.5	6.7e-76
WP_065226818.1|1814787_1815858_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	46.6	1.3e-88
WP_065226819.1|1815848_1816385_+|plate	phage baseplate assembly protein	plate	A0A2I7S9F6	Vibrio_phage	40.2	3.0e-25
WP_000206926.1|1816381_1816834_+	phage GP46 family protein	NA	A0A2I7S9F0	Vibrio_phage	41.4	3.7e-21
WP_065226820.1|1816823_1817900_+|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	51.8	4.6e-94
WP_065226821.1|1817884_1818469_+	DUF2313 domain-containing protein	NA	M1NVS6	Vibrio_phage	49.2	2.5e-49
WP_065226822.1|1818472_1819468_+|tail	phage tail protein	tail	Q71TP5	Escherichia_phage	39.1	6.7e-47
WP_065226823.1|1819482_1820013_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	69.3	9.6e-69
WP_077884162.1|1819999_1822249_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	64.5	1.1e-84
WP_065226824.1|1822263_1822839_+	DUF4376 domain-containing protein	NA	Q8W610	Enterobacteria_phage	54.4	2.3e-47
WP_047085416.1|1822961_1823147_+	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	69.4	5.4e-19
WP_047085415.1|1823097_1823793_+	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	96.5	5.8e-130
WP_024236501.1|1824356_1825391_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_001057313.1|1825465_1825942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000093550.1|1825964_1826315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001396852.1|1826674_1826794_+	ash family protein	NA	NA	NA	NA	NA
WP_000201259.1|1826812_1827034_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	97.0	4.6e-33
WP_065226825.1|1827030_1828074_+	phage antirepressor KilAC domain-containing protein	NA	Q71TN2	Escherichia_phage	93.7	1.7e-173
WP_065226826.1|1828238_1829039_+	phage antirepressor KilAC domain-containing protein	NA	Q1MVK4	Enterobacteria_phage	99.6	7.1e-148
WP_065226827.1|1829068_1829914_+	Replication protein repL	NA	Q71TB9	Escherichia_phage	97.5	1.0e-149
WP_015974255.1|1830082_1830787_+	DUF3800 domain-containing protein	NA	Q71TB8	Escherichia_phage	100.0	4.6e-135
WP_065226828.1|1830786_1831251_+	oxidoreductase	NA	Q71TB7	Escherichia_phage	98.7	3.6e-88
WP_065226829.1|1831796_1832306_-|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	99.4	3.9e-91
WP_000035251.1|1832317_1832899_-	hypothetical protein	NA	Q71TM4	Escherichia_phage	99.5	3.8e-103
WP_065226830.1|1832934_1833750_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.9	6.4e-112
WP_065226831.1|1833759_1835349_-	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.7	4.0e-304
WP_065226832.1|1835409_1837116_-	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	99.8	0.0e+00
WP_032177130.1|1837381_1838347_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	98.8	4.8e-167
WP_000817632.1|1838343_1839549_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	100.0	2.0e-226
WP_001076427.1|1839948_1840809_-	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_001281116.1|1841126_1841519_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
WP_000336812.1|1841530_1841671_-	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_000007769.1|1841696_1842119_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_001177860.1|1843407_1843692_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_000472529.1|1843684_1844590_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
>prophage 6
NZ_CP015229	Escherichia coli strain 06-00048 chromosome, complete genome	5498453	1849626	1970712	5498453	integrase,tail,holin,transposase,plate,terminase,head	Escherichia_phage(45.45%)	130	1859949:1860008	1903355:1904134
WP_000900640.1|1849626_1850052_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	100.0	1.8e-70
WP_000234829.1|1850051_1850216_+	DUF3927 family protein	NA	A0A1B0VDU8	Salmonella_phage	100.0	1.2e-17
WP_001276599.1|1850687_1852052_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	100.0	2.1e-253
WP_065226833.1|1852051_1853050_+	hypothetical protein	NA	A0A1B0VCH7	Salmonella_phage	99.1	3.7e-194
WP_000535208.1|1853095_1853728_-	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_000212018.1|1853720_1854737_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	100.0	3.5e-192
WP_000602717.1|1854738_1855524_-	hypothetical protein	NA	Q71T90	Escherichia_phage	99.6	4.6e-144
WP_000896799.1|1855510_1856239_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	99.6	1.0e-137
WP_001141901.1|1856242_1857460_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.8	1.9e-224
WP_000235786.1|1857469_1857847_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840931.1|1857993_1858239_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_065226733.1|1858330_1859086_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	34.3	1.9e-33
1859949:1860008	attL	CATTCCGTAGTGCTGACAGAGAGTAGCATAACGCTCAGTCAGCTCGCGGCGTCCATCTTC	NA	NA	NA	NA
WP_065226834.1|1860725_1861289_+	VRR-NUC domain-containing protein	NA	A0A077SLK0	Escherichia_phage	99.5	5.7e-104
WP_000095380.1|1861355_1861511_+	hypothetical protein	NA	A0A077SK20	Escherichia_phage	100.0	1.2e-19
WP_000484111.1|1862012_1862639_+	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	99.5	1.0e-122
WP_065226835.1|1862635_1863313_+	metallophosphoesterase	NA	Q71TJ1	Escherichia_phage	97.8	7.8e-132
WP_065226836.1|1863309_1864011_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	99.1	2.3e-142
WP_065226837.1|1864312_1865575_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.0	6.6e-233
WP_065226838.1|1865647_1866154_+	3'-phosphatase	NA	A0A077SK53	Escherichia_phage	97.0	3.8e-91
WP_065226839.1|1866348_1867077_+	hypothetical protein	NA	Q71T76	Escherichia_phage	97.4	5.1e-137
WP_065228224.1|1867143_1867353_+	DUF551 domain-containing protein	NA	A0A2L1IV16	Escherichia_phage	93.8	3.5e-22
WP_065226840.1|1867345_1867552_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.5	3.3e-09
WP_097463134.1|1867548_1868214_+	hypothetical protein	NA	A0A0F6TJ66	Escherichia_coli_O157_typing_phage	93.1	1.5e-23
WP_046660029.1|1869015_1869405_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	98.4	5.4e-69
WP_001190712.1|1869477_1869699_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_052957703.1|1869698_1870079_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	98.4	6.3e-62
WP_001697572.1|1870083_1870263_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	94.9	1.3e-22
WP_065226841.1|1870290_1871334_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.3	5.3e-204
WP_001326849.1|1871422_1871875_+	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
WP_065226842.1|1871960_1873154_+|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	94.2	2.1e-196
WP_000124159.1|1873153_1874638_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
WP_077884163.1|1874634_1875198_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	78.1	5.0e-23
WP_065226843.1|1875194_1876310_+	phage antirepressor KilAC domain-containing protein	NA	A0A077SLR9	Escherichia_phage	98.4	2.3e-205
WP_000611656.1|1876342_1877194_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_059222003.1|1877304_1877514_-	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	98.6	7.0e-31
WP_065226844.1|1878118_1878340_+	creatininase	NA	Q5QBN7	Enterobacteria_phage	95.9	7.1e-34
WP_065226845.1|1878359_1878755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226846.1|1878751_1879783_+|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	98.5	4.6e-192
WP_001224246.1|1879833_1880145_+	hypothetical protein	NA	Q71TG4	Escherichia_phage	100.0	1.6e-47
WP_065226847.1|1880392_1880953_+	Ref family protein	NA	Q71TG3	Escherichia_phage	99.5	5.4e-102
WP_071906124.1|1881141_1881783_+	maturation control protein	NA	A0A1B0VAG4	Salmonella_phage	88.7	2.5e-103
WP_185762102.1|1882336_1885522_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	55.6	2.0e-116
WP_077884164.1|1885626_1885971_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065226850.1|1886111_1886360_-	modulator protein	NA	Q71TG0	Escherichia_phage	98.8	6.8e-41
WP_000224043.1|1886356_1886797_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_065226851.1|1886830_1893598_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.0	0.0e+00
WP_000774702.1|1893673_1895383_+	hypothetical protein	NA	A0A1B0V850	Salmonella_phage	99.5	0.0e+00
WP_000132937.1|1895375_1896395_+|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_001345478.1|1896686_1897244_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_065226852.1|1898083_1898737_+	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	70.8	3.8e-83
WP_000432105.1|1898743_1899526_+	hypothetical protein	NA	A0A1B0VDP8	Salmonella_phage	100.0	1.9e-145
WP_000610388.1|1899518_1900613_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	36.7	6.7e-40
WP_001165936.1|1900644_1900953_-	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
WP_040090800.1|1901789_1902545_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_065225932.1|1902541_1904041_-|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_000175492.1|1906358_1906724_-	hypothetical protein	NA	Q1MVM8	Enterobacteria_phage	97.5	1.5e-44
1903355:1904134	attR	CATTCCGTAGTGCTGACAGAGAGTAGCATAACGCTCAGTCAGCTCGCGGCGTCCATCTTCGCCCTGTTGTTTCCATGCTGCCCTCAGGCTGTCCGTTTTATGTTCTACCGGCACTCCGCCCAGTTGTCCGAGGGCTTCCTGCAGGCCTTCAGCCAGAGCAGAGAAGCTCTCACCACCCAGAACAACCCGCATCCAGCTCCAGTGGCTCCATTCCAGACGGAAGTGATACAACTTATGCGCCAACAACTTACCGGCGATGGTGACAACTACACCTTTCAGTTCAGTAAAGTCCGACAGGCCTCGCAGGCCGGGCTGATGTTGCTGGCGGAACATGACCTCCTGCTCTGTACCATACTGTAGTTTCCATTCGCGAACCCGCCGTTGCATTGTTCTTCGAAGGCTGTTGGGGTACTGGCCGGGATATTTATCCTGTAGCATCTCCAGTAGAGTTGTTGGTGTCAGAGCCGGCCTCTCTTTCAACAGAGGAACAAGCATGCTGTCCCACACAGCTTCCAGAGGATCTTTGCGTGTGCGCCAGTGCCGAACACTGTTTTTTGCCCACTCTCCTTTTTCGATCCGACGACCAGAACGGACTGAGATACCAGCCTTCATGGCCGAGATATGCTGAGTTATACCTTTCTTACGCTGAGTCATATAGTAACTGACCTGAGAAGTATTGAGCGTCACGCCATTTCCTGTTGGATCATGTAAATGACACTCAGGTTACAAAACCGGCCAGAATAATCGGCGCCAGGCGGACTGAGTTATTGTCGTCTCATA	NA	NA	NA	NA
WP_065226854.1|1906720_1908640_-	hypothetical protein	NA	A0A1B0V7H1	Salmonella_phage	96.4	0.0e+00
WP_000164724.1|1908641_1909244_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	99.5	1.6e-99
WP_000580776.1|1909230_1909674_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000887652.1|1909670_1910000_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_001561138.1|1910060_1910345_-	hypothetical protein	NA	A0A077SK36	Escherichia_phage	98.9	1.0e-48
WP_001561137.1|1910466_1911027_+	recombinase family protein	NA	Q1MVM2	Enterobacteria_phage	99.5	2.1e-98
WP_065228226.1|1911695_1912676_+|tail	phage tail protein	tail	A0A0C4UQV0	Shigella_phage	89.3	1.2e-170
WP_000972092.1|1912677_1913205_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	94.9	8.9e-91
WP_065226855.1|1913233_1913767_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	98.9	1.2e-95
WP_071906130.1|1913769_1916691_-|tail	tail fiber protein	tail	A0A077SK37	Escherichia_phage	94.1	0.0e+00
WP_001286326.1|1916702_1917137_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_065226856.1|1917215_1918052_-|tail	phage tail protein	tail	A0A077SLH5	Escherichia_phage	98.9	2.9e-152
WP_065226857.1|1918051_1919485_-	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	99.6	1.1e-271
WP_000002801.1|1919481_1919838_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	99.2	5.0e-61
WP_065226858.1|1919837_1923266_-	transglycosylase SLT domain-containing protein	NA	A0A1B0VDM8	Salmonella_phage	93.5	0.0e+00
WP_000926345.1|1923347_1924229_-	hypothetical protein	NA	A0A1B0VBL3	Salmonella_phage	99.7	3.7e-174
WP_000523980.1|1924243_1924855_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_001425377.1|1924865_1925138_-	hypothetical protein	NA	Q71TN7	Escherichia_phage	98.9	5.1e-42
WP_065226859.1|1925400_1925916_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	51.2	2.0e-34
WP_001249840.1|1926107_1926359_+	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	53.0	1.4e-17
WP_065226860.1|1926360_1928457_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	48.5	5.5e-176
WP_047085335.1|1928532_1929486_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	41.0	4.4e-56
WP_000987805.1|1929498_1929726_+	hypothetical protein	NA	C9DGL3	Escherichia_phage	85.3	1.2e-31
WP_065226861.1|1929970_1930240_+	hypothetical protein	NA	C9DGL5	Escherichia_phage	58.4	4.9e-21
WP_065226862.1|1930260_1930680_+	hypothetical protein	NA	A0A0C4UR25	Shigella_phage	86.8	3.8e-60
WP_065226863.1|1930696_1930984_+	hypothetical protein	NA	C9DGL7	Escherichia_phage	87.9	4.7e-38
WP_065226797.1|1931004_1931529_+	host-nuclease inhibitor Gam family protein	NA	A0A0C4UQY5	Shigella_phage	96.6	3.2e-88
WP_065226864.1|1931627_1932170_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	83.1	9.2e-83
WP_065226865.1|1932162_1932345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226866.1|1932337_1932700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226867.1|1932677_1933013_+	hypothetical protein	NA	A0A0C4UQR5	Shigella_phage	40.4	3.4e-11
WP_065226868.1|1932990_1933542_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	80.2	1.6e-82
WP_040100375.1|1933538_1933988_+	Middle operon regulator	NA	A0A0C4UR27	Shigella_phage	62.7	4.2e-41
WP_065226801.1|1934073_1934670_+	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	41.1	5.1e-34
WP_065226802.1|1934671_1934923_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	68.9	1.8e-25
WP_047084861.1|1934897_1935308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047084862.1|1935295_1935904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226803.1|1935900_1936128_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_065226804.1|1936112_1936418_+	DUF2730 family protein	NA	M1Q558	Vibrio_phage	38.7	1.8e-11
WP_065228223.1|1936423_1936711_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	60.6	2.1e-25
WP_065226805.1|1936713_1937013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170981737.1|1937002_1937161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047084866.1|1937150_1937732_+	DUF3486 family protein	NA	M1PJ86	Vibrio_phage	55.0	1.1e-49
WP_077884272.1|1937737_1939264_+	hypothetical protein	NA	M1NVQ0	Vibrio_phage	67.9	6.0e-196
WP_065226807.1|1939260_1940832_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	57.1	1.1e-155
WP_065226808.1|1940824_1941589_+	hypothetical protein	NA	M4M9M5	Vibrio_phage	60.1	1.4e-92
WP_065226869.1|1943751_1944060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000540584.1|1944059_1944497_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	49.0	1.4e-33
WP_000513058.1|1944496_1945039_+	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	63.1	1.6e-58
WP_065226812.1|1945035_1945647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226813.1|1945627_1945831_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_065226814.1|1945835_1947311_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	54.9	1.9e-151
WP_001062748.1|1947320_1947677_+|tail	phage tail tube protein	tail	A0A2P1A4D6	Alteromonadaceae_phage	35.5	2.9e-13
WP_065226870.1|1947678_1948074_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	45.8	5.6e-13
WP_065226871.1|1948160_1950026_+|tail	phage tail tape measure protein	tail	M4MHE6	Vibrio_phage	29.1	3.5e-41
WP_065226872.1|1950025_1951300_+	DNA circularization N-terminal domain-containing protein	NA	A0A2I7S9E8	Vibrio_phage	38.8	3.6e-77
WP_065226873.1|1951299_1952370_+|tail	phage tail protein	tail	A0A2I7S9G1	Vibrio_phage	46.9	9.9e-89
WP_065226819.1|1952360_1952897_+|plate	phage baseplate assembly protein	plate	A0A2I7S9F6	Vibrio_phage	40.2	3.0e-25
WP_000206926.1|1952893_1953346_+	phage GP46 family protein	NA	A0A2I7S9F0	Vibrio_phage	41.4	3.7e-21
WP_065226874.1|1953335_1954412_+|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	51.5	6.1e-94
WP_065226821.1|1954396_1954981_+	DUF2313 domain-containing protein	NA	M1NVS6	Vibrio_phage	49.2	2.5e-49
WP_065226875.1|1954984_1955764_+|tail	phage tail protein	tail	C9DGQ8	Escherichia_phage	32.4	9.6e-17
WP_065226876.1|1955778_1956309_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	69.3	1.3e-68
WP_065226877.1|1956295_1958545_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	64.5	2.8e-85
WP_065226878.1|1958559_1959135_+	DUF4376 domain-containing protein	NA	Q8W610	Enterobacteria_phage	54.4	1.3e-47
WP_047085416.1|1959257_1959443_+	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	69.4	5.4e-19
WP_047085415.1|1959393_1960089_+	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	96.5	5.8e-130
WP_071906133.1|1960207_1960609_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_000819258.1|1960605_1960962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226880.1|1961183_1963178_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_065226881.1|1963228_1963681_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_157921687.1|1968425_1968755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226883.1|1968800_1969130_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_065226387.1|1969575_1970712_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP015229	Escherichia coli strain 06-00048 chromosome, complete genome	5498453	2106975	2172769	5498453	integrase,portal,holin,transposase,terminase,capsid,bacteriocin	Shigella_phage(46.05%)	79	2146539:2146556	2176309:2176326
WP_065226944.1|2106975_2107605_+	antA/AntB antirepressor family protein	NA	A0A088CBR4	Shigella_phage	83.8	8.7e-93
WP_065228230.1|2109433_2109625_+	TraR/DksA C4-type zinc finger protein	NA	V5USD3	Shigella_phage	88.7	1.7e-20
WP_065226945.1|2109950_2110454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226946.1|2110579_2118961_-	hypothetical protein	NA	G3CFQ0	Escherichia_phage	94.8	0.0e+00
WP_065226947.1|2119030_2120296_-	hypothetical protein	NA	A0A0P0ZD72	Stx2-converting_phage	99.8	3.8e-228
WP_065226948.1|2120306_2120558_-|bacteriocin	bacteriocin	bacteriocin	A0A0P0ZDW9	Stx2-converting_phage	97.5	6.0e-13
WP_000455652.1|2120567_2121014_-	hypothetical protein	NA	V5UT82	Shigella_phage	100.0	1.1e-76
WP_065226949.1|2121016_2121673_-	hypothetical protein	NA	G9L6L9	Escherichia_phage	95.9	2.5e-103
WP_157921663.1|2121767_2121914_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	97.9	1.3e-20
WP_065225932.1|2122028_2123528_+|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_040090800.1|2123524_2124280_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_000078907.1|2124643_2124784_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_065226950.1|2125016_2125751_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A088CE87	Shigella_phage	97.1	4.1e-134
WP_065226951.1|2125873_2126491_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	98.5	9.7e-121
WP_000455635.1|2126496_2126775_-	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_033805633.1|2126789_2128058_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.5	4.2e-219
WP_065226952.1|2128054_2129680_-	hypothetical protein	NA	A0A1U9AJB6	Stx1_converting_phage	99.6	0.0e+00
WP_000276175.1|2130019_2130247_-	hypothetical protein	NA	A0A088CBQ7	Shigella_phage	100.0	1.2e-39
WP_000537687.1|2130259_2130805_-	hypothetical protein	NA	A0A088CD67	Shigella_phage	100.0	6.8e-94
WP_065226953.1|2130887_2132933_-	carboxypeptidase regulatory-like domain-containing protein	NA	V5USF3	Shigella_phage	68.0	1.4e-78
WP_000207922.1|2132929_2133580_-	hypothetical protein	NA	A0A0P0ZG46	Escherichia_phage	100.0	4.6e-121
WP_065226954.1|2133579_2134143_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	97.9	8.6e-100
WP_001371266.1|2134126_2134588_-	hypothetical protein	NA	V5URI4	Shigella_phage	99.3	7.8e-75
WP_001140444.1|2134637_2135027_-	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_065226955.1|2135081_2136296_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	99.5	1.4e-232
WP_000345010.1|2136319_2137327_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_065226956.1|2137484_2139629_-|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	99.6	0.0e+00
WP_065226957.1|2139628_2141335_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	98.9	0.0e+00
WP_065226958.1|2141315_2142122_-|terminase	terminase	terminase	A0A0P0ZG40	Escherichia_phage	97.8	1.1e-129
WP_001208684.1|2142455_2142662_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	64.4	2.7e-11
WP_065226959.1|2142884_2143019_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	86.4	4.3e-10
WP_065226960.1|2143032_2143605_-	antirepressor	NA	A0A088CD55	Shigella_phage	88.4	8.5e-95
WP_029784839.1|2143875_2144409_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	99.4	3.9e-102
WP_065226961.1|2144413_2144629_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	98.6	7.7e-33
WP_044782523.1|2144705_2144978_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	98.9	6.3e-24
WP_065226962.1|2145003_2145186_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	96.7	8.5e-25
WP_065226963.1|2145322_2147263_-	SASA family carbohydrate esterase	NA	S5MDQ7	Escherichia_phage	87.5	0.0e+00
2146539:2146556	attL	AACAGCACATTTTTCGGG	NA	NA	NA	NA
WP_123007663.1|2147752_2147917_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	77.4	4.8e-11
WP_065226964.1|2147913_2148345_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	95.8	4.8e-66
WP_047087897.1|2148804_2148957_-	DNA methylase	NA	A0A0N7C2V5	Escherichia_phage	96.0	1.5e-19
WP_065226965.1|2149994_2150375_-	antitermination protein	NA	A0A088CD47	Shigella_phage	98.4	6.9e-69
WP_000992060.1|2150367_2150562_-	protein ninH	NA	A0A088CC23	Shigella_phage	100.0	1.4e-30
WP_001563212.1|2150561_2150924_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	99.2	2.4e-63
WP_001563211.1|2150920_2151211_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	99.0	2.2e-51
WP_001549091.1|2151203_2151416_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	98.6	1.1e-34
WP_001563210.1|2151408_2151618_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	1.4e-31
WP_000924594.1|2151577_2151979_-	hypothetical protein	NA	K7PJK0	Enterobacteria_phage	98.5	4.6e-71
WP_024196297.1|2151981_2152158_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	2.3e-27
WP_001563209.1|2152154_2152556_-	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	84.0	3.2e-48
WP_001563208.1|2152527_2153166_-	hypothetical protein	NA	A0A1B0VMI8	Pseudomonas_phage	45.0	6.4e-43
WP_001563206.1|2153353_2153986_-	hypothetical protein	NA	A0A088CBR4	Shigella_phage	68.8	1.5e-47
WP_001563205.1|2154240_2154906_-	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	77.6	4.4e-87
WP_001563204.1|2155253_2155577_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	65.8	5.7e-32
WP_001563203.1|2155672_2156029_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	2.5e-57
WP_001563202.1|2156030_2156333_-	hypothetical protein	NA	Q8VNQ2	Enterobacteria_phage	88.5	2.4e-24
WP_001563200.1|2156333_2156645_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	80.6	1.2e-47
WP_001563199.1|2156637_2156892_-	hypothetical protein	NA	A0A0U2RK51	Escherichia_phage	91.7	5.3e-41
WP_001563198.1|2156884_2157373_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.1	1.7e-67
WP_001563197.1|2157369_2157786_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.1	2.1e-58
WP_001563196.1|2157801_2158572_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	71.1	5.0e-90
WP_001563195.1|2158597_2159338_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	95.9	1.7e-132
WP_065226966.1|2159344_2160427_-	DNA-binding protein	NA	V5URT9	Shigella_phage	98.3	5.5e-204
WP_065226967.1|2160447_2160666_-	hypothetical protein	NA	A0A088CC17	Shigella_phage	97.2	1.5e-20
WP_000084293.1|2160680_2160977_-	hypothetical protein	NA	A0A088CBI6	Shigella_phage	99.0	1.2e-47
WP_001068241.1|2161120_2161348_-	hypothetical protein	NA	A0A088CE43	Shigella_phage	100.0	5.4e-37
WP_065226968.1|2161432_2162203_+	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	99.6	3.4e-147
WP_044706404.1|2162599_2162872_+	hypothetical protein	NA	A0A088CD31	Shigella_phage	97.8	8.2e-40
WP_065226969.1|2162875_2163589_+	hypothetical protein	NA	A0A088CC14	Shigella_phage	98.3	5.2e-126
WP_001005965.1|2163620_2163977_+	hypothetical protein	NA	A0A088CBI5	Shigella_phage	100.0	1.3e-56
WP_000560216.1|2164308_2164530_+	cell division protein FtsZ	NA	A0A088CE40	Shigella_phage	100.0	1.2e-36
WP_065226970.1|2164615_2165002_+	hypothetical protein	NA	V5USC5	Shigella_phage	78.9	9.5e-50
WP_065226971.1|2165109_2167179_+	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	97.1	0.0e+00
WP_000995034.1|2167175_2167472_+	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	100.0	1.5e-50
WP_000100822.1|2167477_2168263_+	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	100.0	6.3e-149
WP_065226972.1|2168259_2168940_+	YqaJ viral recombinase family protein	NA	V5UT69	Shigella_phage	99.1	7.9e-132
WP_000497813.1|2168987_2169239_+	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	100.0	1.3e-39
WP_065226973.1|2169500_2170664_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.2	1.2e-225
WP_065226974.1|2171257_2172112_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_065226975.1|2172154_2172769_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	6.6e-29
2176309:2176326	attR	AACAGCACATTTTTCGGG	NA	NA	NA	NA
>prophage 8
NZ_CP015229	Escherichia coli strain 06-00048 chromosome, complete genome	5498453	2304277	2350838	5498453	integrase,tail,portal,holin,tRNA,plate,terminase,head,capsid	Enterobacteria_phage(74.0%)	63	2306680:2306704	2343479:2343503
WP_000029466.1|2304277_2305027_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|2305026_2305578_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_065227022.1|2305640_2306621_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2306680:2306704	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_065228234.1|2306813_2307251_-	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_001247209.1|2307729_2308683_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.1	1.5e-80
WP_000021113.1|2308771_2309083_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	48.5	1.2e-18
WP_001151411.1|2309178_2309457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917790.1|2309471_2309810_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	85.3	4.9e-50
WP_021564410.1|2309820_2310099_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
WP_000357028.1|2310110_2310353_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000021659.1|2310349_2310463_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	4.0e-09
WP_000543033.1|2310556_2310967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|2310990_2311194_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_065227024.1|2311190_2311457_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	78.2	1.0e-31
WP_065227025.1|2311453_2311753_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.8	1.8e-40
WP_157921666.1|2311764_2312382_+	ash family protein	NA	S5MQL6	Escherichia_phage	40.7	8.5e-08
WP_000564227.1|2312378_2312768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065227027.1|2312764_2315605_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.3	0.0e+00
WP_065227028.1|2315681_2316641_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.9e-179
WP_000211275.1|2316645_2316957_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	2.7e-47
WP_047657269.1|2317020_2317356_+	carboxylate--amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	91.7	8.3e-50
WP_022631071.1|2317418_2317943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631072.1|2317939_2318464_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	52.0	8.4e-33
WP_001407222.1|2319041_2319566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065227029.1|2319580_2320627_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.4	1.5e-201
WP_065227030.1|2320626_2322378_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.4	0.0e+00
WP_065227031.1|2322532_2323369_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	3.0e-149
WP_065227032.1|2323391_2324444_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.1	2.8e-197
WP_023155992.1|2324489_2325290_+|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	88.7	2.9e-125
WP_065227033.1|2325392_2325887_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	1.0e-88
WP_000864901.1|2325886_2326087_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|2326089_2326413_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_065227034.1|2326409_2326802_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	2.9e-70
WP_000780553.1|2326798_2327206_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	5.9e-66
WP_021580370.1|2327343_2327811_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	5.9e-86
WP_000356339.1|2327803_2328439_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_077770670.1|2328450_2329017_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	1.1e-99
WP_001067548.1|2329034_2329364_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_065227035.1|2329367_2330264_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	2.2e-153
WP_000071724.1|2330256_2330865_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_071906145.1|2330861_2332346_+|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	67.2	1.1e-106
WP_001106830.1|2332367_2332808_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	71.0	1.5e-54
WP_065228235.1|2332779_2333373_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	64.8	1.6e-59
WP_065227036.1|2333372_2333867_-|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	92.8	8.7e-80
WP_000905081.1|2333897_2334497_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	87.4	2.3e-87
WP_000979945.1|2334523_2335012_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_065227037.1|2335024_2337832_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.6	0.0e+00
WP_000333503.1|2337818_2337974_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|2337982_2338357_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290462.1|2338412_2338925_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_032198054.1|2338924_2340109_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	1.3e-222
WP_065227038.1|2340266_2341376_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	3.7e-195
WP_065227039.1|2341502_2342261_+	alpha/beta hydrolase	NA	D3JZC6	Mycobacterium_phage	31.9	9.7e-06
WP_065227040.1|2342621_2342882_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|2343072_2343213_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|2343520_2343820_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2343479:2343503	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_065227041.1|2343824_2346212_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|2346226_2347210_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2347493_2347538_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2347660_2348017_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2348069_2348267_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2348363_2348906_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_065227042.1|2348909_2350838_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	1.2e-129
>prophage 9
NZ_CP015229	Escherichia coli strain 06-00048 chromosome, complete genome	5498453	2553050	2637212	5498453	integrase,tail,portal,holin,transposase,protease,terminase	Escherichia_phage(34.43%)	104	2589956:2590015	2655430:2657841
WP_089518920.1|2553050_2554198_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	7.8e-148
WP_065227112.1|2555014_2555812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065227113.1|2556015_2556228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065227114.1|2556342_2556591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032612247.1|2556640_2556886_+	excisionase family protein	NA	S4TND0	Salmonella_phage	70.9	7.7e-29
WP_065227115.1|2556931_2558233_+	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	68.6	4.3e-179
WP_001752729.1|2558253_2558568_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_065227116.1|2558782_2560441_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2560433_2561429_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_065227117.1|2561421_2562108_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213294.1|2562107_2563481_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2563499_2563943_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_065227118.1|2563939_2565067_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133119.1|2565171_2565636_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2565640_2566645_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282091.1|2566641_2567055_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_065227119.1|2567057_2567423_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001515470.1|2567422_2568160_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2568169_2568439_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983976.1|2568447_2569233_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_065227120.1|2569522_2570146_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867217.1|2570189_2570378_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2570540_2570768_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_065227121.1|2571065_2571881_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_077884176.1|2571877_2573572_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	36.1	2.7e-19
WP_000009306.1|2573742_2573925_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_065227123.1|2574003_2574921_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|2575093_2576014_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_065227124.1|2576002_2576473_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	2.3e-34
WP_065227125.1|2576453_2577872_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.9	3.0e-101
WP_061349812.1|2577938_2578634_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001313057.1|2578673_2579039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824399.1|2579604_2580798_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.9	1.3e-102
WP_065227127.1|2581390_2582242_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_065227128.1|2582349_2583708_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001339045.1|2583707_2584379_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920127.1|2584511_2584925_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001590257.1|2585033_2586038_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_065227129.1|2586038_2586674_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_065227130.1|2586930_2587581_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|2587923_2588454_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_065227131.1|2589467_2589971_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	59.1	1.5e-42
2589956:2590015	attL	TATGAGACGACAATAACTCAGTCCGCCTGGCGCCGATTATTCTGGCCGGTTTTGTAACCT	NA	NA	NA	NA
WP_065225932.1|2590048_2591548_+|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_040090800.1|2591544_2592300_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_065227132.1|2592480_2593068_-	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	57.2	2.0e-51
WP_065226736.1|2593082_2595173_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	64.0	1.3e-89
WP_001230293.1|2595238_2595838_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	3.0e-111
WP_065226735.1|2595904_2599606_-	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	78.7	0.0e+00
WP_071533105.1|2599666_2600299_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.6	1.2e-94
WP_065226734.1|2600235_2600979_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	4.3e-147
WP_001152536.1|2600989_2601688_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000847333.1|2601687_2602017_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	3.1e-57
WP_065227134.1|2602013_2604626_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	85.1	0.0e+00
WP_000533454.1|2604615_2605020_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	79.4	5.3e-43
WP_000479071.1|2605046_2605478_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.1	3.7e-42
WP_001007217.1|2605498_2606248_-|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	93.6	2.8e-130
WP_065227135.1|2606255_2606654_-|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	6.5e-70
WP_065227136.1|2606666_2607290_-|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	96.6	2.3e-101
WP_001113015.1|2607292_2607574_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	84.9	1.6e-38
WP_047088889.1|2607566_2607893_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	87.9	6.6e-44
WP_185762103.1|2607979_2609959_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	Q8VNN5	Enterobacteria_phage	98.8	0.0e+00
WP_065227137.1|2609948_2611451_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	98.4	6.1e-286
WP_000102415.1|2611450_2611663_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_065227138.1|2611659_2613783_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	98.4	0.0e+00
WP_040091145.1|2613779_2614256_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	94.9	7.1e-79
WP_065227139.1|2614718_2614943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|2615007_2615214_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000675931.1|2615435_2615549_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_042966549.1|2615767_2616301_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	5.1e-102
WP_000282141.1|2616429_2616744_+	hypothetical protein	NA	Q08J99	Stx2-converting_phage	68.3	6.4e-36
WP_065227141.1|2616753_2617395_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.3	9.6e-63
WP_000284517.1|2617398_2617614_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_038813346.1|2617786_2618122_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	3.6e-45
WP_040091348.1|2618383_2618548_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	69.8	6.1e-06
WP_042966258.1|2618544_2618970_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	85.1	3.8e-60
WP_038813804.1|2619180_2619723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917767.1|2621035_2621233_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_065227142.1|2621521_2622340_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000942766.1|2622494_2622866_-	Probable antitermination protein Q	NA	Q777W5	Enterobacteria_phage	83.3	4.7e-54
WP_047085386.1|2622855_2623227_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.4e-34
WP_047085387.1|2623239_2624289_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.3e-109
WP_065227143.1|2624290_2624569_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_047085389.1|2624635_2624896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047085390.1|2625148_2625361_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	2.8e-27
WP_038813042.1|2625594_2625990_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	62.0	8.6e-38
WP_000753062.1|2626013_2626190_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	1.5e-26
WP_065227144.1|2626182_2626365_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	93.3	1.3e-25
WP_065227145.1|2626509_2626983_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	74.8	2.2e-64
WP_065227146.1|2626975_2627203_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	50.7	3.5e-12
WP_077877350.1|2627199_2627454_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	67.1	1.5e-22
WP_042966818.1|2627510_2628272_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	69.4	2.1e-85
WP_157921678.1|2628306_2628849_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	4.4e-85
WP_065227147.1|2628760_2629801_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	85.1	5.7e-89
WP_065227148.1|2629772_2630324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912290.1|2630307_2630535_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787424.1|2630611_2631019_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
WP_052073903.1|2631221_2631377_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_065227150.1|2631536_2631752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047085263.1|2631841_2632288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047085602.1|2632983_2633172_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098306.1|2633168_2633360_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_065227151.1|2633453_2635925_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_000096344.1|2635983_2636187_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_047085409.1|2636186_2637212_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
2655430:2657841	attR	TATGAGACGACAATAACTCAGTCCGCCTGGCGCCGATTATTCTGGCCGGTTTTGTAACCTGAGTGTCATTTACATGATCCAACAGGAAATGGCGTGACGCTCAATACTTCTCAGGTCAGTTACTATATGACTCAGCGTAAGAAAGGTATAACTCAGCATATCTCGGCCATGAAGGCTGGTATCTCAGTCCGTTCTGGTCGTCGGATCGAAAAAGGAGAGTGGGCAAAAAACAGTGTTCGGCACTGGCGCACACGCAAAGATCCTCTGGAAGCTGTGTGGGACAGCATGCTTGTTCCTCTGTTGAAAGAGAGGCCGGCTCTGACACCAACAACTCTACTGGAGATGCTACAGGATAAATATCCCGGCCAGTACCCCAACAGCCTTCGAAGAACAATGCAACGGCGGGTTCGCGAATGGAAACTACAGTATGGTACAGAGCAGGAGGTCATGTTCCGCCAGCAACATCAGCCCGGCCTGCGAGGCCTGTCGGACTTTACTGAACTGAAAGGTGTAGTTGTCACCATCGCCGGTAAGTTGTTGGCGCATAAGTTGTATCACTTCCGTCTGGAATGGAGCCACTGGAGCTGGATGCGGGTTGTTCTGGGTGGTGAGAGCTTCTCTGCTCTGGCTGAAGGCCTGCAGGAAGCCCTCGGACAACTGGGCGGAGTGCCGGTAGAACATAAAACGGACAGCCTGAGGGCAGCATGGAAACAACAGGGCGAAGATGGACGCCGCGAGCTGACTGAGCGTTATGCTACTCTCTGTCAGCACTACGGAATGCAGGGCGTACACAATAATGCCGGTCGGGGCCACGAAAATGGCTCGGTTGAAAGTGCCCACGGACATCTGAAAAGGCGTATCTGTCAGGCGCTGATACTGCGGGGCAGTAACGACTTCAGCACCATAGAAGAATATCAGGCCTTCATCACTCAGCAGGTTATGCGGCACAACCGTAACAATCAGGATCTGGTCAAGGAAGAACGTCTTCATCTGAAACCGCTGCCGCTTCGTCGCAGTGCTGACTATGATGAGCTGACTGTGAGGGTTAGTCGCAGCAGTACCATCAATGTGAAGCACGTCGTCTACAGCGTACCTTCCCGGCTTGTAGGTCAACTGTTACGGGTCAGGTTATGGGACGATCGTCTGAGCTGTTACGTTGGCAGCAGCGAGGTCATGAGCTGCCCTCGCGTCAGACCAGAAAAAGGGAAGACGCGGGCCCGTCGTATCGACTTCCGACATGTGATCGACAGTCTGGCAAAAAAGCCCGGTGCGTTCTGCCATGCAACGCTGAGAAATGACATCCTGCCGGACGATGAATGGCGGAGGCTGTGGCGTCGCTTATGTAATCATCTGGAGCCCGATATGGCAGGAAGGCTGATGGTACATGCCCTGAAACTGGCTGCAGGATACGACGATATCTCAGTCGTGGCAAAAGGTATGGAGCAGATGCTGAATACCCCGGGAAACGTGGATCTGCACCGGCTGATGCGCTTCCTGGGTATAAAAGAAAAGGCGTTGCCGGTAGTCAATGTGATACAGCATAACCTGAGCAGTTATGAGCAACTACTGCGTGGCAAGGGAGGTTCGCAGTGAGCAATATCCATCACCTTGAACATAGCCTGCGTAAACTACGCCTGACACGAGTTGGAGCTGAATGGCACGCTCTGGAAAAACGAGCGCTGGCAGAAGGCTGGACACCATCGCGCTATCTTCTGACGCTATGCAATGAAGAACTCCTGTGGCGCGAGAGTGAAAAACTGCGTCGTTATAAAAAGGAGGCCCGGTTGCCAGTTGCCAAAACGCTGAGCGAATACGACTTCAGTCAGGTGCCGGAACTGAATGGAGCTCAGTTCCGGCAACTCTGTGAAACGACAGACTGGGTTGATGCAGGAGAAAACGTTCTGCTGTTCGGAGCCAGCGGGTTGGGGAAAAGCCATCTGGCGGCAGCGATCGTGGATGGCGTAGTAGGTCAGGGCTACCGGGCCCGGTTCTACAGCGCAGGAGAGCTGTTGCAGGAACTACGTAAAGCCAGAGCTCAGTTGAAACTGAATGAGCTGCTACTGAAACTGGATCGCTACCGGGTGATAGTGGTGGATGATCTTGGCTATGTCAAACGCGATAGTGCCGAAACGGGTGTGCTGTTCGAGTTAATAGCGCATCGCTATGAACGTGGGAGCCTGGTGATAACCAGTAACCATCCGTTCAGCATGTGGGGCAGCATCTTCGTGGATGAGACTATGGCGGTGGCTGCGGCAGACAGGCTGATCCATCACGGATATATGTTCGAACTGAAAGGGGAAAGCTACAGGAAAAAGACAGCGAAGGCAGTAACAAGCGCGACTTGATGTCGCCCTGAAGGGTGCGGCCAGTATAGTTGGCGCGAGTCGGCAAAACTAGTTGACGTCTAATAGT	NA	NA	NA	NA
>prophage 10
NZ_CP015229	Escherichia coli strain 06-00048 chromosome, complete genome	5498453	2715031	2721333	5498453		Enterobacteria_phage(50.0%)	6	NA	NA
WP_065227190.1|2715031_2715574_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	9.6e-48
WP_065227191.1|2715578_2716457_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.5e-106
WP_065227192.1|2716514_2717414_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	2.0e-29
WP_065227193.1|2717413_2718499_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	3.9e-101
WP_000183060.1|2718870_2719764_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_065227194.1|2719938_2721333_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.8	4.9e-19
>prophage 11
NZ_CP015229	Escherichia coli strain 06-00048 chromosome, complete genome	5498453	2815997	2825439	5498453		Enterobacteria_phage(85.71%)	10	NA	NA
WP_065227238.1|2815997_2817134_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.4	7.7e-164
WP_065227239.1|2817130_2819131_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001373589.1|2819255_2819717_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001295430.1|2819757_2820228_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001353101.1|2820274_2820994_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_065227240.1|2820990_2822676_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.3	9.5e-304
WP_001240401.1|2822897_2823629_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2823688_2823796_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2823776_2824508_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_065227241.1|2824512_2825439_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
>prophage 12
NZ_CP015229	Escherichia coli strain 06-00048 chromosome, complete genome	5498453	3313680	3407044	5498453	integrase,tail,portal,holin,transposase,protease,tRNA,terminase,head,capsid	Enterobacteria_phage(51.67%)	103	3358200:3358219	3407177:3407196
WP_024211753.1|3313680_3314418_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3314549_3315884_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_065227435.1|3315916_3316798_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189223.1|3316900_3317488_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|3317542_3317926_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_065227436.1|3318230_3318920_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	3.5e-55
WP_000997403.1|3318967_3320005_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3320211_3320631_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_065228255.1|3320699_3321398_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_065227437.1|3321429_3324090_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3324203_3325559_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_071906186.1|3325604_3325928_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_065227439.1|3325924_3327223_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.4	2.5e-46
WP_001235102.1|3333162_3335736_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_065227440.1|3335865_3336597_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079112.1|3336593_3337574_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3337708_3338446_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_065227441.1|3338716_3339058_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|3339161_3339209_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_024229260.1|3339308_3340469_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225222.1|3340511_3341633_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|3341643_3342714_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|3342923_3343289_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001520332.1|3343438_3343957_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969046.1|3343946_3345173_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_065227442.1|3345188_3345671_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|3345747_3346095_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3346136_3346904_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3346934_3347483_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3347501_3347750_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3347998_3349360_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|3349526_3350318_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3350338_3351625_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_065227443.1|3351745_3352351_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_001300112.1|3352385_3352976_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|3353098_3353977_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_065227444.1|3354062_3355724_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3355872_3356214_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|3356278_3356569_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600189.1|3356558_3357035_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3357166_3357649_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
3358200:3358219	attL	CGGGTTCAACTCCCGCCAGC	NA	NA	NA	NA
WP_000701866.1|3358424_3358997_-	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	55.1	2.4e-49
WP_065226736.1|3359011_3361102_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	64.0	1.3e-89
WP_001230293.1|3361167_3361767_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	3.0e-111
WP_065226735.1|3361833_3365535_-	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	78.7	0.0e+00
WP_065226733.1|3365653_3366409_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	34.3	1.9e-33
WP_065225932.1|3366405_3367905_-|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_071533105.1|3368011_3368644_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.6	1.2e-94
WP_065227445.1|3368580_3369324_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	1.5e-144
WP_065227446.1|3369329_3370028_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	1.5e-130
WP_065227447.1|3370027_3370357_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.5e-56
WP_065227448.1|3370353_3372915_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.8	0.0e+00
WP_065227449.1|3372907_3373342_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	6.5e-63
WP_000479163.1|3373323_3373746_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.4e-70
WP_001401350.1|3373761_3374502_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	5.0e-132
WP_065227450.1|3374509_3374905_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_065227451.1|3374901_3375480_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	7.8e-80
WP_000752994.1|3375491_3375845_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_000158868.1|3375856_3376252_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000063218.1|3376293_3377319_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_001513196.1|3377374_3377707_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_065227452.1|3377716_3379036_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.5	3.2e-230
WP_065227453.1|3379016_3380618_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	4.2e-309
WP_000198149.1|3380614_3380821_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027310.1|3380817_3382743_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|3382717_3383263_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000095729.1|3383651_3383864_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	80.0	1.9e-23
WP_000735650.1|3384899_3385124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123000865.1|3385209_3385395_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	95.1	1.5e-16
WP_052834940.1|3385755_3385938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065227454.1|3386093_3386627_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	2.6e-98
WP_000282141.1|3386755_3387070_+	hypothetical protein	NA	Q08J99	Stx2-converting_phage	68.3	6.4e-36
WP_001015166.1|3387079_3387721_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.0	9.6e-63
WP_000284517.1|3387724_3387940_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000738083.1|3388510_3388780_-	Shiga toxin Stx2g subunit B	NA	Q6DWN4	Enterobacteria_phage	95.5	1.1e-41
WP_065227455.1|3388792_3389752_-	Shiga toxin Stx2g subunit A	NA	Q6DWN9	Enterobacteria_phage	96.2	3.0e-169
WP_065227456.1|3390136_3391123_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	80.1	1.1e-163
WP_047088382.1|3391273_3391471_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	8.0e-29
WP_000646552.1|3391731_3392784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001041173.1|3392784_3393177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000969103.1|3393173_3393839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065227457.1|3393869_3394217_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.0	7.2e-57
WP_001064805.1|3394216_3394474_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	98.8	1.3e-34
WP_065227458.1|3394470_3395862_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	95.2	6.8e-255
WP_065227459.1|3395858_3396737_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	96.0	1.0e-139
WP_001247834.1|3396747_3397656_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	98.3	6.7e-62
WP_000621231.1|3397642_3397876_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	48.6	1.9e-13
WP_077884280.1|3397872_3398805_-	ash family protein	NA	Q8W643	Enterobacteria_phage	70.0	2.2e-76
WP_065275704.1|3398989_3399163_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	87.7	6.2e-25
WP_065228258.1|3399170_3399386_-	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_077884195.1|3399385_3400240_-	ORF6N domain-containing protein	NA	Q8W644	Enterobacteria_phage	55.6	1.9e-45
WP_065227460.1|3400316_3400583_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033813155.1|3400678_3401065_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	59.2	1.1e-34
WP_065227461.1|3401209_3401668_+	helix-turn-helix transcriptional regulator	NA	Q8W649	Enterobacteria_phage	59.6	2.1e-35
WP_032082696.1|3401836_3402064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141089.1|3402403_3402610_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	98.5	2.4e-31
WP_047085105.1|3402806_3402995_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	95.2	1.9e-27
WP_065227462.1|3402991_3403573_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	94.3	2.5e-110
WP_024235203.1|3403575_3403854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065227464.1|3404035_3404863_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	98.9	1.8e-130
WP_065227465.1|3404903_3405275_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	94.3	4.0e-61
WP_065227466.1|3405306_3405549_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	95.0	1.9e-35
WP_065227467.1|3405871_3407044_+|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	87.1	7.1e-197
3407177:3407196	attR	CGGGTTCAACTCCCGCCAGC	NA	NA	NA	NA
>prophage 13
NZ_CP015229	Escherichia coli strain 06-00048 chromosome, complete genome	5498453	3489382	3496522	5498453		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|3489382_3491944_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_065227495.1|3492049_3492706_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	3.0e-51
WP_001295181.1|3492756_3493524_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_065227496.1|3493719_3494628_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	6.6e-118
WP_065227497.1|3494624_3495887_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	2.6e-136
WP_057688064.1|3495883_3496522_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	5.4e-82
>prophage 14
NZ_CP015229	Escherichia coli strain 06-00048 chromosome, complete genome	5498453	5411427	5465179	5498453	integrase,tail,holin,portal,transposase,terminase,head,capsid	Enterobacteria_phage(49.06%)	65	5404018:5404033	5472089:5472104
5404018:5404033	attL	GCGGCGAAAGCGGTGA	NA	NA	NA	NA
WP_001218291.1|5411427_5412663_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.5	2.6e-234
WP_001105426.1|5412821_5413955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000008196.1|5414393_5414930_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	97.2	1.3e-97
WP_000081280.1|5415057_5415882_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_000135680.1|5415947_5416310_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_032140105.1|5417032_5417725_-	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	97.0	2.2e-121
WP_001557924.1|5417822_5418083_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	97.7	2.7e-40
WP_000515860.1|5418075_5418627_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_021499524.1|5418623_5419775_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	96.9	4.6e-209
WP_000620700.1|5419771_5419996_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	97.3	6.3e-38
WP_000061487.1|5419992_5420811_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	87.8	6.2e-123
WP_021539742.1|5420813_5421302_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	2.1e-86
WP_001557928.1|5421301_5421955_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	98.2	4.7e-126
WP_000767113.1|5421951_5422341_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061427.1|5422360_5423203_+	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.5	1.1e-138
WP_001519507.1|5423210_5424200_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.8e-194
WP_001557930.1|5424213_5424966_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	97.2	2.4e-134
WP_000203370.1|5426126_5426312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122993159.1|5426937_5427027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001557932.1|5427081_5427294_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066482.1|5427594_5427810_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	2.6e-25
WP_000839581.1|5428562_5428778_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	90.1	7.9e-30
WP_000189900.1|5428782_5429334_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	51.1	1.0e-36
WP_001557934.1|5429281_5429542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101173.1|5429655_5430189_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001071778.1|5430185_5430683_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|5431045_5431258_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071528545.1|5431268_5431457_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|5431604_5431760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|5431932_5432106_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548594.1|5432401_5432608_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	80.9	2.6e-22
WP_032154345.1|5432858_5433053_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.2	3.7e-26
WP_001519435.1|5433480_5433987_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	48.5	3.3e-34
WP_065228158.1|5433958_5435887_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.6	5.3e-258
WP_000259002.1|5435870_5436077_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_065228159.1|5436073_5437666_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	4.2e-184
WP_065228160.1|5437655_5439161_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	52.9	1.6e-100
WP_065228161.1|5439197_5439545_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	3.4e-22
WP_065228162.1|5439602_5440631_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	4.5e-115
WP_000201526.1|5440682_5441057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204538.1|5441049_5441403_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	66.7	3.1e-39
WP_065228163.1|5441414_5441993_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	3.5e-80
WP_000683107.1|5441989_5442385_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.9e-70
WP_065228292.1|5442392_5443133_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	1.8e-129
WP_065228164.1|5443148_5443571_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	93.6	8.5e-68
WP_000459458.1|5443552_5443987_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_065228165.1|5443979_5446541_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.5	0.0e+00
WP_000847379.1|5446537_5446867_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152619.1|5446866_5447565_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_065228166.1|5447570_5448314_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	3.8e-148
WP_000090891.1|5448250_5448883_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_065225932.1|5450463_5451963_+|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_040090800.1|5451959_5452715_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_077884254.1|5452793_5454773_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.5	0.0e+00
WP_065228167.1|5454842_5455442_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	7.5e-110
WP_071906301.1|5455506_5458446_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	57.4	4.2e-73
WP_000631342.1|5458442_5459345_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	64.3	1.4e-99
WP_060616939.1|5459353_5459929_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	5.5e-102
WP_060616940.1|5460026_5460617_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	4.7e-24
WP_000836769.1|5460996_5461230_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	6.4e-33
WP_001372053.1|5461298_5461412_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	77.8	1.4e-06
WP_001217539.1|5461838_5462087_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_000202563.1|5462306_5463893_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|5464285_5464891_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|5465017_5465179_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
5472089:5472104	attR	GCGGCGAAAGCGGTGA	NA	NA	NA	NA
>prophage 1
NZ_CP012498	Escherichia coli strain 06-00048 isolate CFSAN004178 plasmid pCFSAN004178P_02, complete sequence	213847	22352	75556	213847	transposase	Bacillus_phage(55.56%)	39	NA	NA
WP_065225932.1|22352_23852_+|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_040090800.1|23848_24604_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_065225933.1|24663_25032_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000024632.1|28863_29790_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054484978.1|29912_31271_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_000132382.1|31282_32311_+	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_065225934.1|32326_33028_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_062904986.1|33036_33681_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_065225935.1|33695_34889_+	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_085950990.1|35116_36473_+|transposase	IS3-like element ISEcB1 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.2	8.5e-77
WP_024221770.1|36583_36772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065225936.1|37214_37484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065225937.1|37480_37762_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_185762086.1|37916_38255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097463183.1|40373_41551_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	56.1	1.7e-97
WP_001261037.1|42124_42346_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071905981.1|43242_43461_-	heat-stable enterotoxin ST-I group a	NA	NA	NA	NA	NA
WP_065225943.1|44139_44505_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001355426.1|44539_44737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065225944.1|45696_46212_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_065225945.1|46213_49207_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_077884093.1|49256_51377_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	1.2e-45
WP_065225947.1|51380_52820_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_097463187.1|53784_55124_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.1	1.2e-70
WP_065225949.1|55503_55722_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159871.1|55723_56029_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_001144034.1|57014_57659_+	ParA family protein	NA	NA	NA	NA	NA
WP_065225950.1|57745_58054_+	molecular chaperone GroEL	NA	NA	NA	NA	NA
WP_000688515.1|58467_59448_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
WP_001278817.1|59440_59857_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_089518920.1|62497_63644_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	7.8e-148
WP_001261037.1|68494_68716_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024221844.1|69105_69390_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_024221843.1|69389_69665_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_065226038.1|69770_70052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_185762087.1|70298_71817_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.3	6.9e-43
WP_097463187.1|71900_73239_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.1	1.2e-70
WP_065225954.1|73761_74592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065225956.1|75049_75556_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP012498	Escherichia coli strain 06-00048 isolate CFSAN004178 plasmid pCFSAN004178P_02, complete sequence	213847	128416	189199	213847	plate,integrase,transposase,tRNA	Escherichia_phage(30.0%)	42	141269:141290	187826:187847
WP_065225985.1|128416_128815_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_000450526.1|128814_129042_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_065225986.1|129123_134394_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000447371.1|134442_134874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065225987.1|134895_135633_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	31.2	4.1e-09
WP_065225988.1|135687_136248_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_065225989.1|136776_137238_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	34.4	5.7e-17
WP_065225990.1|137283_137493_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001312851.1|138744_138894_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083838.1|139177_139426_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001364037.1|139669_139744_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_065225992.1|139736_140594_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
141269:141290	attL	CACTCCGACCGCGCACAGAAGC	NA	NA	NA	NA
WP_065225993.1|141735_142008_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	91.6	7.7e-38
WP_175583264.1|142021_142309_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	88.4	3.9e-40
WP_042965827.1|148957_149179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042965825.1|149716_150193_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_042965824.1|150195_151674_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_123000873.1|151680_152190_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_065225996.1|152200_152623_+	lysozyme family protein	NA	NA	NA	NA	NA
WP_065225997.1|152615_154418_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_065225998.1|154408_155341_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_065225999.1|155353_157336_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.4	8.2e-12
WP_000132334.1|157346_157808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032194046.1|157823_158123_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_065226000.1|158126_159203_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_065226001.1|159210_159762_+	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_065226002.1|159780_161133_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_032287317.1|163175_163778_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_065226003.1|163784_167189_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_065226004.1|167192_169724_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	33.2	9.2e-93
WP_065226006.1|171792_172878_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_065226007.1|173187_173784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226008.1|173855_174464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097463193.1|175847_176957_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.0	3.5e-44
WP_157921677.1|177067_177436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077884108.1|177706_178246_+	cytotoxin Mcf	NA	NA	NA	NA	NA
WP_065226012.1|179636_179855_-	ST-I family heat-stable enterotoxin	NA	NA	NA	NA	NA
WP_065226014.1|181023_181764_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_065226015.1|182048_183026_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.5	2.3e-100
WP_065226016.1|184619_185252_+	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.6	1.1e-29
WP_065226017.1|185251_185614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065226018.1|188167_189199_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
187826:187847	attR	CACTCCGACCGCGCACAGAAGC	NA	NA	NA	NA
>prophage 3
NZ_CP012498	Escherichia coli strain 06-00048 isolate CFSAN004178 plasmid pCFSAN004178P_02, complete sequence	213847	203827	212095	213847	transposase	Stx2-converting_phage(42.86%)	8	NA	NA
WP_000080223.1|203827_205420_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.4	6.7e-174
WP_000624677.1|205450_205801_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	1.8e-39
WP_000422696.1|205797_206217_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	89.7	2.2e-44
WP_065226031.1|207409_207760_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_097463145.1|207756_208119_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	77.6	1.6e-27
WP_089518920.1|208400_209548_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	7.8e-148
WP_040090798.1|209843_211343_+|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_040090800.1|211339_212095_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
