The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013662	Escherichia coli strain 08-00022 chromosome, complete genome	5213998	248139	325241	5213998	integrase,transposase,holin,capsid,head,terminase,protease,portal,tail	Enterobacteria_phage(36.67%)	88	312662:312681	325384:325403
WP_000006260.1|248139_248637_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001338275.1|248954_250694_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001226164.1|251494_252550_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_071940900.1|252546_252999_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295204.1|253729_253870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040091284.1|253926_255384_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|255644_256103_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189541.1|256194_257439_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|257496_257898_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_047088869.1|257936_258992_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.3e-117
WP_001285288.1|259279_260383_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893266.1|260394_261648_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_000051890.1|261852_263016_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.2	4.5e-228
WP_000206811.1|263242_263548_-	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	4.9e-49
WP_001242715.1|263547_263910_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	7.5e-65
WP_040091282.1|263900_264437_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.3	4.1e-99
WP_000081301.1|264565_265390_-	YfdQ family protein	NA	A5LH63	Enterobacteria_phage	100.0	2.7e-150
WP_000135680.1|265455_265818_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000981537.1|266275_266929_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_001231957.1|267024_267222_+	Cro/Cl family transcriptional regulator	NA	K7PHB1	Enterobacterial_phage	55.4	4.3e-14
WP_000514171.1|267249_267834_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.3	1.2e-56
WP_065225000.1|267830_268982_+	Rha family phage regulatory protein	NA	K7PLX4	Enterobacteria_phage	96.1	2.0e-204
WP_000620689.1|268978_269203_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	3.7e-38
WP_000061516.1|269199_270018_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.3	1.4e-122
WP_072097190.1|270014_270509_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	95.7	3.4e-84
WP_000210186.1|270508_270835_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	4.5e-53
WP_000767110.1|270831_271227_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_047085128.1|271378_272194_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	98.9	4.2e-148
WP_001223333.1|272209_272725_+	hypothetical protein	NA	V5URU3	Shigella_phage	29.1	2.7e-15
WP_047088880.1|272734_273724_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	6.8e-193
WP_001204859.1|273741_274176_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000691354.1|274681_275629_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|275638_275908_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_000284518.1|276500_276716_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001015167.1|276719_277361_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.0	5.6e-63
WP_001005227.1|277370_277643_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	70.0	7.7e-30
WP_085948397.1|277684_278379_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.4	2.3e-131
WP_001092886.1|278587_279121_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	95.5	2.4e-99
WP_052834940.1|279276_279459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123000865.1|279819_280005_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	95.1	1.5e-16
WP_000735650.1|280090_280315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095729.1|281350_281563_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	80.0	1.9e-23
WP_000235436.1|281956_282466_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001360690.1|282437_284366_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	7.9e-262
WP_000259002.1|284349_284556_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001360691.1|284552_286145_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_040090915.1|286134_287640_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.0	1.8e-99
WP_000256809.1|287676_288024_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_000522660.1|288081_289110_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.3e-113
WP_001355131.1|289161_289545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021499114.1|289537_289891_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.1e-41
WP_000975024.1|289905_290439_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
WP_000683087.1|290435_290831_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	2.0e-58
WP_000235024.1|290838_291591_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	3.2e-126
WP_000479079.1|291604_292036_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	2.4e-41
WP_047085479.1|292062_292476_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.8	8.6e-41
WP_065225001.1|292456_295036_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	88.6	0.0e+00
WP_000847269.1|295032_295362_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	97.2	6.8e-57
WP_024212310.1|295361_296060_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	5.8e-130
WP_040091516.1|296070_296814_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	93.5	4.9e-143
WP_136754818.1|296759_297356_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	72.9	2.8e-80
WP_065225002.1|297599_301292_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	79.9	0.0e+00
WP_047085483.1|301359_301959_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	90.5	3.1e-100
WP_052934087.1|302023_304114_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	61.8	2.2e-92
WP_065225003.1|304128_304707_+	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	56.7	4.4e-51
WP_113771426.1|304987_305224_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	85.1	3.0e-14
WP_040091579.1|305407_306892_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_040091580.1|307078_308032_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361111.1|308529_309114_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000381395.1|309546_311118_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|311137_311485_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|311484_312162_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
312662:312681	attL	ACTCCTATTATCGGCACCAT	NA	NA	NA	NA
WP_000788776.1|313285_313438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032227721.1|313988_314540_-	recombinase family protein	NA	Q2A092	Sodalis_phage	43.3	9.2e-30
WP_000873435.1|315934_316117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005054.1|316138_316306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040090991.1|316357_316984_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_040090993.1|316993_317263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040090995.1|317359_317740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580785.1|317797_318001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390658.1|318000_318309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000806869.1|319301_319511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000996198.1|319510_319885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040090997.1|319901_320930_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_001531083.1|321084_321282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040090999.1|321316_323158_+	hypothetical protein	NA	A0A140G5Z0	Enterobacteria_phage	27.0	1.7e-16
WP_001240676.1|323205_323883_+	hypothetical protein	NA	A0A1D7XFF4	Escherichia_phage	51.8	3.0e-46
WP_001269627.1|323963_325241_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
325384:325403	attR	ACTCCTATTATCGGCACCAT	NA	NA	NA	NA
>prophage 2
NZ_CP013662	Escherichia coli strain 08-00022 chromosome, complete genome	5213998	901663	975862	5213998	integrase,plate,capsid,head,terminase,protease,lysis,portal,tail	Salmonella_phage(64.71%)	82	904060:904076	976561:976577
WP_001372563.1|901663_902716_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
WP_001678408.1|902807_903752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680871.1|903763_904642_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
904060:904076	attL	CATCAATTATTTTATGA	NA	NA	NA	NA
WP_000188448.1|904787_905009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032236495.1|905041_905551_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	7.5e-87
WP_023150404.1|905558_905759_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	3.5e-32
WP_065225009.1|905722_906064_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	5.1e-55
WP_001244165.1|906131_906365_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000752613.1|906364_906592_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_040090766.1|906588_907446_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.5	5.1e-160
WP_040090765.1|907442_909857_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
WP_001154431.1|910010_910199_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|910209_910443_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000756244.1|910538_911222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001085272.1|911208_912288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508501.1|912287_913289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000849765.1|913705_913999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520377.1|914044_915070_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	90.9	3.7e-173
WP_001098406.1|915069_916836_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216237.1|916978_917812_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_040091389.1|917828_918887_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	3.8e-181
WP_000059191.1|918890_919541_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673523.1|919635_920100_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000868175.1|920099_920303_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|920306_920522_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_040091390.1|920502_921015_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.1	1.5e-87
WP_000727851.1|921016_921394_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_001080918.1|921390_921819_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	1.4e-46
WP_001039935.1|921914_922346_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_000829141.1|922338_922785_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
WP_000993775.1|922853_923432_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	4.2e-94
WP_000177580.1|923428_923788_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_000268285.1|923774_924683_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.2e-143
WP_001086836.1|924675_925281_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_065225010.1|925277_926786_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	73.3	9.4e-202
WP_040091495.1|926785_927388_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	91.8	3.3e-97
WP_047089009.1|927359_927803_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	7.3e-54
WP_000905033.1|928232_928799_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_040091140.1|928941_930114_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.5e-202
WP_047088709.1|930692_930995_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	3.1e-40
WP_000763311.1|931009_931129_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_047088710.1|931121_934199_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.0	0.0e+00
WP_040091136.1|934195_934681_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	2.2e-67
WP_020218821.1|934677_935778_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	3.8e-176
WP_000972391.1|935868_936087_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|936322_938008_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|938277_938655_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001195225.1|938684_938942_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	3.0e-23
WP_001201560.1|939101_939389_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189162.1|939372_940095_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_040091135.1|940155_941058_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	3.3e-37
WP_000203025.1|941145_941622_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126095.1|941972_943085_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996007.1|943179_944313_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105430.1|944322_945276_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|945272_946118_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|946177_946666_+	YbjO family protein	NA	NA	NA	NA	NA
WP_040091134.1|946706_947834_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_001295905.1|948032_948764_-	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_000464491.1|949054_949723_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001697.1|949722_950439_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|950445_951177_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|951194_951923_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|952140_952656_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|952781_953105_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255167.1|953101_953932_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001338420.1|953928_954942_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|955040_956471_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|956481_957483_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815362.1|957519_959238_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000178677.1|959370_960339_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458809.1|960350_962003_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|962146_963046_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|963540_964236_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|964661_966320_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001355621.1|966316_967273_-	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000746460.1|967423_968539_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188180.1|968535_970482_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|970554_970779_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|971101_971422_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|971452_973729_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000279869.1|974659_975862_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
976561:976577	attR	TCATAAAATAATTGATG	NA	NA	NA	NA
>prophage 3
NZ_CP013662	Escherichia coli strain 08-00022 chromosome, complete genome	5213998	1328223	1381492	5213998	integrase,holin,tRNA,terminase,protease,portal,tail	Escherichia_phage(38.0%)	66	1319708:1319723	1352449:1352464
1319708:1319723	attL	GCCTCGCGTCTGATGC	NA	NA	NA	NA
WP_040091012.1|1328223_1329342_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.4	3.5e-84
WP_040091014.1|1329310_1329580_-	excisionase	NA	NA	NA	NA	NA
WP_047662544.1|1329641_1332116_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	60.8	3.5e-60
WP_040091017.1|1332195_1332399_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449182.1|1332401_1332584_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000373329.1|1333154_1333601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171961.1|1333690_1333906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001678562.1|1334065_1334221_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	4.0e-07
WP_000948454.1|1334539_1335016_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|1335140_1335464_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693916.1|1335447_1335873_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_040091029.1|1335895_1336864_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	52.3	4.5e-72
WP_040091020.1|1336906_1337308_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	41.8	3.3e-21
WP_047088604.1|1337331_1337613_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	72.5	6.7e-29
WP_000699804.1|1337609_1337855_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	50.7	3.8e-12
WP_000004205.1|1337829_1338318_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.5	4.1e-66
WP_040091023.1|1338557_1338869_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	81.6	2.1e-47
WP_001217588.1|1338869_1339175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040091024.1|1339270_1340104_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	34.9	4.2e-26
WP_001278459.1|1340213_1340318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000128520.1|1340505_1340718_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	3.1e-26
WP_001360563.1|1340885_1341164_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	2.8e-11
WP_040091342.1|1341165_1342215_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	2.7e-107
WP_040091343.1|1342227_1342587_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.1	4.1e-39
WP_000640038.1|1342595_1343132_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	2.0e-66
WP_001405091.1|1343372_1344116_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_040091346.1|1344301_1344727_+	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	85.1	2.9e-60
WP_040091348.1|1344723_1344888_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	69.8	6.1e-06
WP_038813346.1|1345148_1345484_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	3.6e-45
WP_047085559.1|1345745_1346081_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	82.9	1.7e-47
WP_113771422.1|1346179_1346395_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	95.8	6.5e-32
WP_047670989.1|1346398_1347040_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.0	9.6e-63
WP_000282141.1|1347049_1347364_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	68.3	6.4e-36
WP_052934352.1|1347492_1348026_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	94.4	2.6e-98
WP_001208684.1|1348242_1348449_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	64.4	2.7e-11
WP_040091145.1|1348945_1349422_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	94.9	7.1e-79
WP_040091147.1|1349418_1351542_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	98.4	0.0e+00
WP_000102415.1|1351538_1351751_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_047088890.1|1351750_1353253_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	98.6	9.4e-287
1352449:1352464	attR	GCATCAGACGCGAGGC	NA	NA	NA	NA
WP_149003157.1|1353242_1355222_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	Q8VNN5	Enterobacteria_phage	99.1	0.0e+00
WP_047088889.1|1355308_1355635_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	87.9	6.6e-44
WP_001113015.1|1355627_1355909_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	84.9	1.6e-38
WP_047088888.1|1355911_1356535_+|tail	phage tail protein	tail	Q8VNN3	Enterobacteria_phage	96.6	3.9e-101
WP_000682716.1|1356547_1356946_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_047088887.1|1356953_1357703_+|tail	phage tail protein	tail	S5M7Q5	Escherichia_phage	94.0	2.5e-131
WP_042965925.1|1357718_1358150_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	1.5e-40
WP_042965924.1|1358176_1358581_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	76.5	1.7e-41
WP_052934433.1|1358570_1361114_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	78.9	0.0e+00
WP_047089015.1|1361110_1361440_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	4.0e-57
WP_001152612.1|1361439_1362138_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_047089014.1|1362143_1362887_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.9e-147
WP_001355446.1|1362823_1363426_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	83.7	1.5e-86
WP_001332187.1|1363498_1363837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047089024.1|1367167_1367539_+	hypothetical protein	NA	A0A1P8DUS1	Escherichia_phage	66.4	1.8e-45
WP_000017388.1|1367535_1368327_+	hypothetical protein	NA	A0A1P8DUT0	Escherichia_phage	75.0	3.1e-119
WP_065225015.1|1368417_1370508_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	62.5	1.4e-91
WP_047662523.1|1370522_1371095_+	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	56.0	1.1e-49
WP_040091402.1|1371329_1372193_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1372176_1373313_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000359441.1|1373562_1374789_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1374837_1375959_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|1376034_1377495_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265471.1|1377494_1378166_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|1378334_1379705_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|1379708_1380350_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1380385_1381492_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP013662	Escherichia coli strain 08-00022 chromosome, complete genome	5213998	1484043	1546744	5213998	integrase,transposase,holin,plate,capsid,head,terminase,protease,lysis,portal,tail	Escherichia_phage(42.0%)	83	1477008:1477022	1489866:1489880
1477008:1477022	attL	TAATGCCTGGTGAAT	NA	NA	NA	NA
WP_042966250.1|1484043_1485174_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.7	8.8e-104
WP_000113182.1|1485151_1485400_-	excisionase	NA	NA	NA	NA	NA
WP_042966249.1|1485464_1487936_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_042966247.1|1488016_1488220_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449183.1|1488216_1488405_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001353256.1|1488619_1488883_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_042966246.1|1488823_1489045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042966244.1|1489409_1489619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042966243.1|1489619_1490258_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	38.6	2.2e-06
1489866:1489880	attR	TAATGCCTGGTGAAT	NA	NA	NA	NA
WP_052318772.1|1490399_1490555_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	4.0e-07
WP_042966241.1|1490821_1491112_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_042966240.1|1491111_1491303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033812093.1|1491320_1491821_-	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.4e-16
WP_042966239.1|1491928_1492204_+	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	51.2	3.2e-15
WP_047088917.1|1492187_1492613_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_047088918.1|1492684_1493719_+	pyocin large subunit	NA	A0A0U2RT81	Escherichia_phage	89.7	9.9e-102
WP_157845346.1|1493711_1494173_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	6.4e-85
WP_047088919.1|1494207_1494984_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	70.2	6.7e-87
WP_047088920.1|1494999_1495422_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.8	2.1e-66
WP_187231401.1|1495445_1495907_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.7	3.9e-66
WP_047088930.1|1495960_1496317_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	95.8	1.3e-56
WP_047088922.1|1496366_1496579_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	90.0	2.9e-32
WP_047088923.1|1496614_1497004_+	hypothetical protein	NA	A0A222YWE8	Escherichia_phage	48.1	2.2e-22
WP_047088924.1|1497238_1497451_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	71.4	6.2e-19
WP_047088925.1|1497617_1497896_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	8.2e-11
WP_047088926.1|1497897_1498947_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.2	4.5e-110
WP_047088927.1|1498959_1499334_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.6	1.8e-37
WP_047088928.1|1499330_1500152_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.8	2.6e-81
WP_065225086.1|1500397_1501111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077782118.1|1501209_1501650_+	site-specific DNA-methyltransferase	NA	A0A0U2QW97	Escherichia_phage	85.8	1.5e-54
WP_047088987.1|1502260_1502803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833650.1|1503436_1503589_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000839574.1|1503701_1503917_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	100.0	2.4e-34
WP_047088988.1|1503916_1504414_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.9e-90
WP_040091475.1|1504502_1504940_+|lysis	lysis protein	lysis	K7P7F7	Enterobacteria_phage	97.2	1.9e-70
WP_040091473.1|1505012_1505594_-	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	83.3	1.8e-39
WP_040091471.1|1505988_1506285_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	96.9	9.5e-50
WP_042966179.1|1506589_1507138_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	97.8	4.5e-69
WP_042966181.1|1509027_1509237_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	47.6	3.0e-10
WP_052510525.1|1509281_1510805_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.2	7.6e-183
WP_042966183.1|1510794_1512411_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.1	2.2e-103
WP_042966184.1|1512449_1512785_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.3	7.3e-22
WP_042966185.1|1512853_1513882_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	59.0	8.3e-109
WP_000159745.1|1513932_1514298_+	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_042966186.1|1514300_1514702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042966187.1|1514682_1515405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047088972.1|1515416_1515968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040091456.1|1515951_1516575_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	29.5	1.4e-10
WP_040091455.1|1516608_1516965_+	GPW/gp25 family protein	NA	V5YTB2	Pseudomonas_phage	46.8	2.8e-19
WP_047088968.1|1516939_1517854_+|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	43.9	6.8e-62
WP_040091453.1|1517846_1518437_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.2	6.2e-24
WP_064754567.1|1518433_1519693_+|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	73.9	1.3e-100
WP_040091481.1|1519719_1520247_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	47.4	1.1e-40
WP_040091452.1|1520301_1521777_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	38.5	1.3e-75
WP_000988219.1|1521773_1522292_+|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_001291421.1|1522351_1522654_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_157839838.1|1522653_1522791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047088967.1|1522771_1524424_+	hypothetical protein	NA	R9TRP8	Vibrio_phage	33.9	3.5e-48
WP_042966833.1|1524426_1524915_+|tail	phage tail protein	tail	R9TMP6	Vibrio_phage	42.6	5.6e-23
WP_040091449.1|1524889_1525108_+|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	47.8	1.6e-09
WP_042966830.1|1525098_1526187_+	phage late control protein	NA	R9TNM7	Vibrio_phage	29.2	1.1e-31
WP_065225016.1|1526211_1528485_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	62.4	1.0e-111
WP_042970650.1|1528499_1529087_+	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	59.4	9.7e-54
WP_000877738.1|1529496_1529640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040091524.1|1529653_1531237_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	36.2	3.4e-77
WP_000957246.1|1531279_1531660_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001137792.1|1531646_1531976_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001307761.1|1532485_1532599_-	hypothetical protein	NA	A0A291AWU3	Escherichia_phage	68.4	2.7e-05
WP_001079499.1|1533113_1533620_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|1533665_1534166_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1534251_1534431_-	general stress protein	NA	NA	NA	NA	NA
WP_000443055.1|1534811_1535618_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_001409243.1|1535617_1536811_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983912.1|1536822_1538184_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_065225017.1|1538184_1539780_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194590.1|1539779_1541342_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1541433_1541478_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1541615_1542497_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1542493_1543114_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291217.1|1543214_1544090_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278907.1|1544129_1544720_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559280.1|1544716_1545475_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422045.1|1545694_1546744_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NZ_CP013662	Escherichia coli strain 08-00022 chromosome, complete genome	5213998	1835801	1851256	5213998	tail	Enterobacteria_phage(66.67%)	12	NA	NA
WP_000527780.1|1835801_1837262_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_120795384.1|1839237_1839351_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1839419_1839653_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078178.1|1839969_1840560_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_047088897.1|1840657_1841233_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	1.1e-99
WP_071940916.1|1841232_1844628_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001230388.1|1844692_1845292_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.5e-110
WP_065225022.1|1845358_1848841_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.6	0.0e+00
WP_000090892.1|1848900_1849533_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	98.1	2.7e-94
WP_040091420.1|1849469_1850213_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	7.7e-149
WP_001152409.1|1850218_1850917_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	2.3e-134
WP_000447253.1|1850926_1851256_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
>prophage 6
NZ_CP013662	Escherichia coli strain 08-00022 chromosome, complete genome	5213998	1854291	1895532	5213998	integrase,transposase,terminase,lysis,portal,tail	Enterobacteria_phage(36.84%)	59	1854403:1854418	1895623:1895638
WP_001161009.1|1854291_1854621_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
1854403:1854418	attL	AAGGCTGAAATCAGCC	NA	NA	NA	NA
WP_001370402.1|1854629_1855016_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
WP_038355904.1|1855076_1855820_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.6	6.2e-130
WP_040090850.1|1855830_1856232_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.7e-71
WP_001506976.1|1856228_1856807_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	1.0e-100
WP_001283153.1|1856818_1857094_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_040090846.1|1857086_1857410_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	98.1	7.2e-51
WP_011478361.1|1859467_1861048_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001072975.1|1860975_1861188_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001774468.1|1861184_1863284_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.4	0.0e+00
WP_000421825.1|1863292_1863832_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000381395.1|1863916_1865488_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|1865507_1865855_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|1865854_1866532_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001031431.1|1867099_1867306_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000035576.1|1867606_1868038_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	90.6	6.6e-60
WP_001019139.1|1868189_1868363_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1868534_1868690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1868769_1868835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|1868837_1869026_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1869036_1869249_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_040090187.1|1869611_1870109_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.2	1.9e-05
WP_001092971.1|1870105_1870639_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1870635_1870947_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1870951_1871167_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1871920_1872136_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1872436_1872649_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1872703_1872793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047135.1|1873070_1873823_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1873836_1874886_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1874887_1875166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1875232_1875484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1875700_1875856_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1875927_1876215_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1876214_1876454_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_071527819.1|1876478_1876784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|1876986_1877319_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_000589012.1|1877755_1879096_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001151196.1|1879129_1879549_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.6e-55
WP_000054504.1|1879589_1880555_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.2e-55
WP_000705349.1|1880535_1881057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|1881040_1881268_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|1881345_1881753_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379589.1|1881945_1882101_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000344954.1|1882102_1882678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1883164_1883353_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083280.1|1883349_1883541_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048324.1|1883634_1886106_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|1886178_1886430_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_021533434.1|1886464_1887745_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001360138.1|1887764_1887875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021553635.1|1887932_1888952_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1888963_1890178_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1890383_1890710_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_040090190.1|1890844_1891186_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1891220_1891781_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1891783_1892494_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|1892601_1892907_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_040090191.1|1893105_1895532_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	2.9e-213
1895623:1895638	attR	AAGGCTGAAATCAGCC	NA	NA	NA	NA
>prophage 7
NZ_CP013662	Escherichia coli strain 08-00022 chromosome, complete genome	5213998	2148225	2243892	5213998	integrase,tRNA,holin,capsid,head,terminase,protease,portal,tail	Enterobacteria_phage(42.62%)	106	2168098:2168113	2239583:2239598
WP_047088885.1|2148225_2149107_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_021553686.1|2149298_2151347_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|2151366_2152065_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|2152161_2152659_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207283.1|2152788_2154072_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001297532.1|2154040_2156674_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001400472.1|2156753_2158193_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001338166.1|2158310_2158547_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001338167.1|2158651_2158843_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812733.1|2158843_2159500_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	3.6e-57
WP_000976472.1|2159895_2160237_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879298.1|2160249_2161122_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000255065.1|2161125_2161500_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2161638_2161869_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011660.1|2161970_2162627_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2162650_2163313_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_001410181.1|2163309_2165370_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024745.1|2165578_2166238_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|2166564_2166921_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|2166987_2167278_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_040090538.1|2167411_2168590_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
2168098:2168113	attL	CTACCGTGAATCCTGG	NA	NA	NA	NA
WP_000800512.1|2168645_2169287_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001687627.1|2169323_2171135_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301727.1|2171369_2172845_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056694.1|2173182_2174052_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091148.1|2174179_2175622_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448381.1|2175752_2176724_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|2176843_2178166_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001300644.1|2178181_2179114_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202990.1|2179192_2179948_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571480.1|2179944_2180730_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568518.1|2181070_2182081_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2182089_2182701_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072094247.1|2182839_2182905_-	stress response small protein YobI	NA	NA	NA	NA	NA
WP_001024907.1|2182975_2183578_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2183579_2184101_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|2184135_2184876_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001300367.1|2184904_2185357_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258677.1|2185474_2187247_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891620.1|2187556_2188123_+	hydrolase	NA	NA	NA	NA	NA
WP_047662417.1|2188473_2189046_-	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	54.6	7.0e-49
WP_065225024.1|2189059_2191150_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	63.3	4.6e-90
WP_047662479.1|2191215_2191815_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	4.4e-102
WP_047662477.1|2191881_2195574_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	80.7	0.0e+00
WP_042966578.1|2195817_2196462_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	77.4	6.8e-93
WP_042966576.1|2196359_2197103_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	93.9	5.7e-144
WP_024212310.1|2197113_2197812_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.0	5.8e-130
WP_000847269.1|2197811_2198141_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	97.2	6.8e-57
WP_065225001.1|2198137_2200717_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	88.6	0.0e+00
WP_000479079.1|2201136_2201568_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	2.4e-41
WP_000683087.1|2202340_2202736_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	2.0e-58
WP_000975024.1|2202732_2203266_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
WP_021499114.1|2203280_2203634_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.1e-41
WP_001355131.1|2203626_2204010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522660.1|2204061_2205090_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.3e-113
WP_000256809.1|2205147_2205495_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_040090915.1|2205531_2207037_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.0	1.8e-99
WP_001360691.1|2207026_2208619_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_000259002.1|2208615_2208822_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001360690.1|2208805_2210734_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	7.9e-262
WP_000235436.1|2210705_2211215_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000095729.1|2211608_2211821_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	80.0	1.9e-23
WP_000735650.1|2212856_2213081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123000865.1|2213166_2213352_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	95.1	1.5e-16
WP_052834940.1|2213712_2213895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092886.1|2214050_2214584_-	lysozyme	NA	A0A2R2Z343	Escherichia_phage	95.5	2.4e-99
WP_000282141.1|2214712_2215027_+	hypothetical protein	NA	Q08J99	Stx2-converting_phage	68.3	6.4e-36
WP_047670989.1|2215036_2215678_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.0	9.6e-63
WP_000284517.1|2215681_2215897_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_038813346.1|2216069_2216405_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	3.6e-45
WP_040091348.1|2216666_2216831_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	69.8	6.1e-06
WP_042966258.1|2216827_2217253_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	85.1	3.8e-60
WP_096095937.1|2218056_2218770_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917767.1|2218906_2219104_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000058540.1|2219442_2220630_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001204818.1|2220797_2221163_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	3.9e-53
WP_072097140.1|2221162_2221420_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	3.7e-34
WP_000211316.1|2221416_2222808_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	94.6	1.6e-251
WP_047085111.1|2222804_2223683_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	97.6	9.8e-143
WP_047085110.1|2223693_2224602_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	98.3	1.8e-62
WP_047085109.1|2224588_2224822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047085108.1|2224818_2225052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047085107.1|2225044_2225707_-	ash family protein	NA	Q8W643	Enterobacteria_phage	87.2	8.8e-104
WP_001193680.1|2225724_2225934_-	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_021558726.1|2225933_2226788_-	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	41.8	1.6e-52
WP_064732963.1|2226864_2227164_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	90.9	2.3e-35
WP_000800136.1|2227297_2227987_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.2	6.1e-116
WP_021558724.1|2228132_2228594_+	helix-turn-helix transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	71.9	8.7e-42
WP_000141090.1|2228749_2228956_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	100.0	1.1e-31
WP_000391589.1|2229152_2229341_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	100.0	4.5e-29
WP_021558722.1|2229337_2229919_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	90.7	7.0e-105
WP_021558721.1|2230280_2231108_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	98.5	5.3e-130
WP_032082693.1|2231148_2231520_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	97.6	1.5e-63
WP_047088910.1|2231551_2231794_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	96.2	4.9e-36
WP_001030139.1|2231797_2231944_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	3.1e-22
WP_000528717.1|2231952_2232189_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	9.9e-42
WP_000361999.1|2232244_2233558_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	99.8	1.3e-255
WP_047088911.1|2233539_2234310_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	3.0e-71
WP_000252980.1|2234362_2234758_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019585.1|2234798_2235542_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
WP_000564750.1|2235538_2236510_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_040090533.1|2236674_2239104_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214316.1|2239128_2240229_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
2239583:2239598	attR	CCAGGATTCACGGTAG	NA	NA	NA	NA
WP_001185727.1|2240616_2241363_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001295504.1|2241376_2241943_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|2242158_2243892_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 8
NZ_CP013662	Escherichia coli strain 08-00022 chromosome, complete genome	5213998	2330241	2413532	5213998	integrase,transposase,plate,holin,capsid,head,terminase,portal,tail	Escherichia_phage(37.5%)	104	2331046:2331061	2422019:2422034
WP_065225025.1|2330241_2331405_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.0	1.1e-197
2331046:2331061	attL	GAGCTTAACGCCCTGC	NA	NA	NA	NA
WP_000879835.1|2332758_2333556_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734031.1|2333565_2334117_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2334285_2334618_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|2334951_2335266_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994427.1|2335480_2337139_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2337131_2338127_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282709.1|2338119_2338806_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213294.1|2338805_2340179_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2340197_2340641_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620097.1|2340637_2341765_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|2341869_2342334_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2342338_2343343_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|2343339_2343753_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001302429.1|2343755_2344121_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253453.1|2344120_2344858_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2344867_2345137_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983982.1|2345145_2345931_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103987.1|2346220_2346844_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867217.1|2346887_2347076_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2347238_2347466_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491495.1|2347763_2348579_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_077628108.1|2348575_2350270_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2350440_2350623_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_040090567.1|2350701_2351619_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|2351791_2352712_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786003.1|2352700_2353171_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.6e-33
WP_001157247.1|2353151_2354570_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.6	1.4e-101
WP_040090568.1|2354636_2355224_-	phosphohydrolase	NA	NA	NA	NA	NA
WP_000824345.1|2356192_2357251_+	porin	NA	Q1MVN1	Enterobacteria_phage	49.3	6.6e-93
WP_000218222.1|2357842_2358694_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826783.1|2358801_2360160_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
WP_001340597.1|2360159_2360831_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
WP_000920132.1|2360963_2361377_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740111.1|2361485_2362490_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240090.1|2362490_2363126_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007767.1|2363382_2364033_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_000134810.1|2365557_2365740_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|2365818_2366319_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|2366355_2366862_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_065225026.1|2366880_2367735_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_065225027.1|2368018_2368594_-	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	55.7	4.9e-50
WP_065225028.1|2368608_2370882_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	62.0	2.8e-109
WP_065225029.1|2370906_2371995_-	late control protein	NA	R9TNM7	Vibrio_phage	29.2	1.1e-31
WP_040091449.1|2371985_2372204_-|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	47.8	1.6e-09
WP_065225030.1|2372178_2372667_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	34.1	1.8e-13
WP_065225031.1|2372669_2374322_-	hypothetical protein	NA	R9TRP8	Vibrio_phage	38.0	3.8e-47
WP_186269268.1|2374302_2374440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065225032.1|2374439_2374742_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_065225033.1|2374802_2375321_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_047662537.1|2375317_2376793_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	38.1	5.1e-75
WP_047662540.1|2376847_2377375_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	47.4	6.5e-41
WP_065225034.1|2377401_2378661_-|tail	phage tail protein	tail	Q8W613	Enterobacteria_phage	75.1	7.1e-102
WP_042970777.1|2378657_2379248_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.5	1.8e-23
WP_042970779.1|2379240_2380155_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	44.9	1.6e-63
WP_021562190.1|2380129_2380486_-	GPW/gp25 family protein	NA	V5YTB2	Pseudomonas_phage	47.7	5.5e-20
WP_042970780.1|2380517_2381141_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	29.3	1.1e-10
WP_042970786.1|2381124_2381676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040091458.1|2381687_2382410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001585665.1|2382390_2382792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000159745.1|2382794_2383160_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_042966185.1|2383210_2384239_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	59.0	8.3e-109
WP_040091463.1|2384307_2384643_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.3	1.6e-21
WP_040091464.1|2384681_2386289_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.6	4.3e-104
WP_052319583.1|2386278_2387802_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.5	6.8e-184
WP_040091466.1|2387846_2388056_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	44.4	4.4e-09
WP_047088989.1|2388059_2389976_-|terminase	phage terminase large subunit family protein	terminase	O64317	Escherichia_phage	64.5	3.3e-252
WP_042966179.1|2389947_2390496_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	97.8	4.5e-69
WP_065225036.1|2390799_2391096_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	94.9	1.8e-48
WP_179799882.1|2391270_2391426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040079722.1|2391537_2391735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065225038.1|2391816_2392194_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.8	6.6e-64
WP_001471414.1|2392196_2392472_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	94.5	5.7e-41
WP_001294583.1|2392461_2392854_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	89.2	5.7e-50
WP_065225039.1|2392945_2393152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187703274.1|2393344_2393833_+	DUF4145 domain-containing protein	NA	A4JX50	Burkholderia_virus	38.8	2.5e-07
WP_065225041.1|2393867_2394026_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	62.5	1.0e-05
WP_065225042.1|2394022_2394448_-	tellurite resistance TerB family protein	NA	Q71TK7	Escherichia_phage	85.1	5.5e-59
WP_001405091.1|2394633_2395377_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000640038.1|2395617_2396154_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	2.0e-66
WP_065225043.1|2396162_2396528_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.6	4.6e-38
WP_040090493.1|2396528_2397584_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	1.7e-88
WP_077784652.1|2397585_2397864_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000687436.1|2397930_2398191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040090495.1|2398411_2398567_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	2.5e-17
WP_001449026.1|2398904_2399663_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_122368318.1|2400361_2400526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040090499.1|2400522_2401278_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.5	1.5e-86
WP_157840688.1|2401310_2401853_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	99.3	6.8e-86
WP_040090501.1|2401764_2402805_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	2.1e-91
WP_040090503.1|2402776_2403328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040090504.1|2403311_2403539_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2403615_2404023_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_040090506.1|2404227_2404380_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.9e-07
WP_040090524.1|2404391_2405030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040090507.1|2405030_2405240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040090509.1|2405809_2406661_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	58.0	1.5e-55
WP_040090510.1|2406671_2406860_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_040090511.1|2406856_2407060_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_040090512.1|2407140_2409612_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_000096344.1|2409670_2409874_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_040090514.1|2409873_2410899_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.3	3.7e-101
WP_001300801.1|2411134_2411932_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000480163.1|2412269_2413532_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	1.2e-72
2422019:2422034	attR	GAGCTTAACGCCCTGC	NA	NA	NA	NA
>prophage 9
NZ_CP013662	Escherichia coli strain 08-00022 chromosome, complete genome	5213998	2621504	2630949	5213998		Enterobacteria_phage(85.71%)	10	NA	NA
WP_016243711.1|2621504_2622641_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	98.0	3.8e-163
WP_040090013.1|2622637_2624641_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001373589.1|2624765_2625227_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001295430.1|2625267_2625738_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2625784_2626504_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2626500_2628186_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2628407_2629139_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2629198_2629306_+	protein YohO	NA	NA	NA	NA	NA
WP_040090014.1|2629286_2630018_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569357.1|2630022_2630949_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 10
NZ_CP013662	Escherichia coli strain 08-00022 chromosome, complete genome	5213998	3238477	3251577	5213998		Escherichia_phage(50.0%)	12	NA	NA
WP_001272924.1|3238477_3241039_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141341.1|3241144_3241801_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	45.3	5.2e-48
WP_001300386.1|3241851_3242619_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847974.1|3242814_3243723_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.9e-118
WP_021553822.1|3243719_3244982_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	1.1e-134
WP_001278994.1|3244978_3245617_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136925.1|3245621_3246398_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_065225049.1|3246485_3247850_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3247861_3248854_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3248916_3250056_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3250195_3250822_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3250815_3251577_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 11
NZ_CP013662	Escherichia coli strain 08-00022 chromosome, complete genome	5213998	3395205	3401590	5213998		Escherichia_phage(66.67%)	9	NA	NA
WP_001271171.1|3395205_3396243_-	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	73.7	7.3e-145
WP_001091307.1|3396242_3396509_-	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	78.2	3.3e-33
WP_040090377.1|3396585_3397257_-	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	53.4	3.4e-63
WP_040090378.1|3397321_3397900_-	hypothetical protein	NA	A0A0U2QW61	Escherichia_phage	63.2	1.4e-33
WP_001224090.1|3397938_3398112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000581049.1|3398313_3398601_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_040090379.1|3398597_3399128_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	34.0	2.8e-07
WP_040090380.1|3399108_3399468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040090382.1|3399817_3401590_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	45.0	1.6e-96
>prophage 12
NZ_CP013662	Escherichia coli strain 08-00022 chromosome, complete genome	5213998	3504563	3548103	5213998	protease,integrase,transposase,tRNA	Stx2-converting_phage(50.0%)	42	3493942:3493957	3557752:3557767
3493942:3493957	attL	TTGCATGTGCTGCGTC	NA	NA	NA	NA
WP_001295379.1|3504563_3505322_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|3505527_3506448_-	agmatinase	NA	NA	NA	NA	NA
WP_001411115.1|3506583_3507315_-	lipoprotein	NA	NA	NA	NA	NA
WP_001295380.1|3507460_3509437_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001338822.1|3509445_3509577_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|3509712_3509928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3510231_3511386_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_021553858.1|3511821_3513216_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|3513292_3513790_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286510.1|3513884_3514592_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001488326.1|3514671_3515403_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3515415_3516366_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3516474_3517038_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|3517037_3517454_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_040090412.1|3517637_3518618_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_040090414.1|3518635_3519340_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3519357_3519924_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3519920_3520211_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174735.1|3520218_3520812_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001411121.1|3520804_3521941_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745244.1|3522009_3523017_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_040090415.1|3523133_3524180_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3524355_3525075_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|3525258_3525585_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3525584_3526304_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001297399.1|3526464_3527517_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3527544_3527820_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|3527884_3528964_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|3529165_3530422_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_001326492.1|3530471_3532607_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234502.1|3533004_3533712_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_044311188.1|3534069_3535251_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	2.2e-121
WP_000422740.1|3535844_3536270_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624723.1|3536266_3536617_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.8e-40
WP_065225061.1|3536647_3538261_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.0	1.1e-171
WP_044311189.1|3538387_3538690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044311210.1|3538929_3540618_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_044311190.1|3540617_3541841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001585276.1|3541842_3543027_-	site-specific DNA-methyltransferase	NA	A0A1S6UAA7	Serratia_phage	27.2	3.5e-18
WP_044311192.1|3543310_3543985_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	4.7e-12
WP_000878026.1|3544294_3545314_+|transposase	IS110-like element ISEc11 family transposase	transposase	NA	NA	NA	NA
WP_000381395.1|3546531_3548103_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
3557752:3557767	attR	TTGCATGTGCTGCGTC	NA	NA	NA	NA
>prophage 13
NZ_CP013662	Escherichia coli strain 08-00022 chromosome, complete genome	5213998	4337477	4347489	5213998	integrase	Enterobacteria_phage(87.5%)	10	4332694:4332707	4347419:4347432
4332694:4332707	attL	CCAACCTGACGCTG	NA	NA	NA	NA
WP_001218969.1|4337477_4338650_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.2	3.6e-209
WP_032211572.1|4338702_4340388_-	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	54.2	5.1e-180
WP_000446136.1|4340675_4341248_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_000638631.1|4341321_4341822_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001149160.1|4343103_4343370_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980222.1|4343366_4343957_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	4.1e-60
WP_001244665.1|4343949_4344237_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459294.1|4344229_4344685_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4344820_4345141_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_065225069.1|4345155_4347489_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
4347419:4347432	attR	CCAACCTGACGCTG	NA	NA	NA	NA
>prophage 14
NZ_CP013662	Escherichia coli strain 08-00022 chromosome, complete genome	5213998	5046708	5183829	5213998	integrase,transposase,plate,holin,capsid,head,terminase,protease,tail	Enterobacteria_phage(22.68%)	153	5058835:5058852	5145845:5145862
WP_001300563.1|5046708_5047821_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001151855.1|5048474_5049029_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
WP_001141195.1|5049041_5050220_-	MFS transporter	NA	NA	NA	NA	NA
WP_024195369.1|5050287_5051148_-	YjiK family protein	NA	NA	NA	NA	NA
WP_000222496.1|5051465_5052233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299707.1|5052242_5053394_-	2-hydroxyacyl-CoA dehydratase subunit D	NA	NA	NA	NA	NA
WP_001137019.1|5054829_5056062_-	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_001380871.1|5056319_5056532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181173.1|5056528_5057473_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	5.9e-61
WP_000199311.1|5057715_5059128_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
5058835:5058852	attL	CAGCATATCCAGCACCTG	NA	NA	NA	NA
WP_000394278.1|5059304_5059469_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_064760779.1|5059566_5060439_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001300563.1|5060549_5061662_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_071940936.1|5061845_5063009_+	DUF1524 domain-containing protein	NA	NA	NA	NA	NA
WP_000132623.1|5063055_5063397_-	endoribonuclease SymE	NA	NA	NA	NA	NA
WP_000058876.1|5063611_5066875_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.3	9.5e-50
WP_000535016.1|5066969_5068367_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_001029742.1|5068356_5069976_-	type I restriction-modification system subunit M	NA	A0A2H4UVW8	Bodo_saltans_virus	21.9	1.1e-06
WP_000800829.1|5070039_5071206_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_000063156.1|5071518_5071821_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_001297640.1|5071854_5072811_-	GTPase	NA	NA	NA	NA	NA
WP_000467859.1|5072821_5073025_-	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_001295524.1|5073074_5075225_-	pyruvate/proton symporter BtsT	NA	NA	NA	NA	NA
WP_000919537.1|5075601_5077266_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_065225077.1|5077314_5078676_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|5078889_5079804_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106029.1|5079942_5080965_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.6	9.4e-12
WP_001292659.1|5081103_5083395_-	phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase	NA	NA	NA	NA	NA
WP_001308243.1|5083648_5084143_-	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_000799911.1|5084191_5084929_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|5084931_5085471_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000538188.1|5085578_5086052_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_001295409.1|5086042_5086813_-	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_001301727.1|5088114_5088792_+	DNA-binding transcriptional activator BglJ	NA	NA	NA	NA	NA
WP_000331578.1|5088829_5089618_-	siderophore-iron reductase FhuF	NA	NA	NA	NA	NA
WP_016236446.1|5089758_5089995_+	DUF1435 domain-containing protein	NA	NA	NA	NA	NA
WP_001272323.1|5090655_5091687_-	16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC	NA	NA	NA	NA	NA
WP_000204018.1|5091789_5092203_+	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_001092459.1|5092171_5092618_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000870700.1|5092632_5093310_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_040091220.1|5093694_5094933_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	97.3	1.6e-231
WP_047088681.1|5095085_5096648_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_040091656.1|5096690_5096876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040091321.1|5098187_5098535_-	hypothetical protein	NA	U5P0J0	Shigella_phage	70.4	2.1e-24
WP_040091320.1|5098531_5099410_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	92.8	3.1e-165
WP_001401560.1|5099400_5099937_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_047088872.1|5100064_5100889_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
WP_021559686.1|5102161_5102371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000859465.1|5102566_5103241_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	99.6	3.5e-132
WP_000649477.1|5103331_5103532_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_040091608.1|5103575_5104127_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	98.9	1.3e-100
WP_001087304.1|5104123_5105275_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	95.8	5.9e-204
WP_000620689.1|5105271_5105496_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	3.7e-38
WP_050937700.1|5105813_5106392_-	DUF4376 domain-containing protein	NA	A0A0U2RK60	Escherichia_phage	56.1	9.9e-51
WP_065225079.1|5106406_5108686_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	60.7	5.7e-102
WP_042966142.1|5108734_5109259_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	70.1	7.3e-69
WP_047088845.1|5109273_5110077_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	83.6	2.7e-30
WP_042966140.1|5110076_5110649_-	DUF2313 domain-containing protein	NA	A0A2H4J9D6	uncultured_Caudovirales_phage	32.6	1.7e-18
WP_042966139.1|5110653_5111733_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	44.6	7.0e-74
WP_000372931.1|5111732_5112083_-	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	63.8	4.8e-32
WP_042966138.1|5112136_5112790_-|plate	phage baseplate assembly protein	plate	F6MIL4	Haemophilus_phage	47.6	1.6e-41
WP_047088844.1|5112789_5114001_-|tail	tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	38.0	1.1e-70
WP_047088843.1|5113984_5115334_-	DNA circularization N-terminal domain-containing protein	NA	F6MIL2	Haemophilus_phage	26.7	1.2e-38
WP_001339397.1|5115655_5116333_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|5116332_5116680_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|5116699_5118271_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000178828.1|5120270_5120429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172649.1|5120443_5120827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000023097.1|5120823_5121198_-	hypothetical protein	NA	F6MIK8	Haemophilus_phage	58.5	1.1e-31
WP_047088858.1|5121210_5122632_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B7SDP8	Haemophilus_phage	44.5	2.7e-97
WP_001371970.1|5122624_5122834_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_077788439.1|5122847_5123501_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_000119402.1|5123497_5123929_-	DUF1320 family protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	28.1	4.1e-09
WP_047088856.1|5123932_5124274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047088855.1|5124277_5125186_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A2H4J778	uncultured_Caudovirales_phage	59.3	6.2e-100
WP_042966128.1|5125196_5125592_-	hypothetical protein	NA	A0A2H4IZH5	uncultured_Caudovirales_phage	37.8	2.9e-17
WP_047088860.1|5125592_5126708_-|protease	phage protease	protease	A0A0M5N0Q6	Ralstonia_phage	37.5	1.7e-51
WP_050937630.1|5126917_5127469_-	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	30.1	3.1e-09
WP_042966127.1|5127465_5128632_-|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	46.1	1.5e-61
WP_047088854.1|5128618_5130214_-	DUF935 domain-containing protein	NA	A0A0U5KSI0	unidentified_phage	46.1	1.2e-122
WP_047088853.1|5130217_5131858_-|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	63.5	1.3e-193
WP_042966124.1|5131859_5132600_-	DNA methylase	NA	Q775B4	Bordetella_phage	53.2	1.9e-67
WP_000312574.1|5132646_5133147_-	DUF1804 family protein	NA	A0A0M3VI86	Ralstonia_phage	47.2	4.9e-38
WP_162838175.1|5133146_5133299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157839881.1|5133285_5133435_-	SPASM domain-containing protein	NA	NA	NA	NA	NA
WP_042966123.1|5133373_5133556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042966122.1|5133569_5133947_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	90.3	5.8e-60
WP_000445984.1|5133949_5134228_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	2.6e-17
WP_001372993.1|5134217_5134610_-|holin	phage holin family protein	holin	Q9MBZ5	Enterobacteria_phage	55.7	1.6e-28
WP_042971158.1|5134793_5135072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047087262.1|5135097_5135565_-	mor transcription activator family protein	NA	A0A2D1GNW5	Pseudomonas_phage	39.6	6.8e-18
WP_042970930.1|5135659_5136139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047087260.1|5136135_5136534_-	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	63.6	2.7e-39
WP_021564522.1|5136505_5136784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042970913.1|5137038_5137347_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	73.5	1.8e-06
WP_042970909.1|5137343_5137634_-	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	61.7	7.4e-23
WP_042966114.1|5137623_5137854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047087259.1|5137850_5138078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047087257.1|5138067_5138796_-	DUF2786 domain-containing protein	NA	A0A0S4L2R2	Pseudomonas_phage	33.2	3.0e-20
WP_047087255.1|5138876_5139068_-	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	53.3	3.1e-09
WP_012904653.1|5139048_5139282_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047088852.1|5139283_5139928_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	66.4	2.0e-76
WP_047088851.1|5139957_5140173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361028.1|5140185_5140410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047088850.1|5140424_5141318_-	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	57.3	1.8e-91
WP_047088849.1|5141336_5143379_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	49.7	4.1e-176
WP_000989761.1|5143378_5143615_-	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	57.4	1.8e-14
WP_047088848.1|5143783_5144431_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072097190.1|5145323_5145818_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	95.7	3.4e-84
WP_000210186.1|5145817_5146144_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	4.5e-53
5145845:5145862	attR	CAGGTGCTGGATATGCTG	NA	NA	NA	NA
WP_000767110.1|5146140_5146536_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_047085128.1|5146687_5147503_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	98.9	4.2e-148
WP_001223333.1|5147518_5148034_+	hypothetical protein	NA	V5URU3	Shigella_phage	29.1	2.7e-15
WP_047662617.1|5148043_5149033_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	93.6	7.6e-184
WP_040091368.1|5149045_5149420_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	3.4e-36
WP_040091370.1|5149416_5150238_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.5	7.6e-81
WP_024166254.1|5150483_5151197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917767.1|5151371_5151569_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_040091372.1|5151719_5152778_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	95.2	2.3e-199
WP_001299895.1|5153245_5153677_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	95.8	2.1e-66
WP_000216624.1|5153673_5153838_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	81.1	7.4e-12
WP_000284518.1|5154398_5154614_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001015166.1|5154617_5155259_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	81.0	9.6e-63
WP_000282141.1|5155268_5155583_-	hypothetical protein	NA	Q08J99	Stx2-converting_phage	68.3	6.4e-36
WP_001092886.1|5155711_5156245_+	lysozyme	NA	A0A2R2Z343	Escherichia_phage	95.5	2.4e-99
WP_052834940.1|5156400_5156583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123000865.1|5156943_5157129_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	95.1	1.5e-16
WP_000735650.1|5157214_5157439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095729.1|5158474_5158687_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	80.0	1.9e-23
WP_000235436.1|5159080_5159590_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001360690.1|5159561_5161490_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	7.9e-262
WP_000259002.1|5161473_5161680_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_040090915.1|5163257_5164763_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.0	1.8e-99
WP_065225080.1|5164799_5165147_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	1.5e-22
WP_000522660.1|5165204_5166233_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.3e-113
WP_001355131.1|5166284_5166668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021499114.1|5166660_5167014_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.1e-41
WP_000975024.1|5167028_5167562_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
WP_000683087.1|5167558_5167954_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	2.0e-58
WP_000235024.1|5167961_5168714_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	3.2e-126
WP_000479079.1|5168727_5169159_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	65.7	2.4e-41
WP_047085479.1|5169185_5169599_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.8	8.6e-41
WP_065225081.1|5169579_5172159_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000847379.1|5172155_5172485_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|5172484_5173183_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194783.1|5173188_5173932_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_000090891.1|5173868_5174501_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_065225082.1|5174561_5178041_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.6	0.0e+00
WP_047085483.1|5178108_5178708_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	90.5	3.1e-100
WP_052934087.1|5178772_5180863_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	61.8	2.2e-92
WP_047662566.1|5180877_5181450_+	DUF4376 domain-containing protein	NA	Q8W610	Enterobacteria_phage	74.5	4.8e-74
WP_001217550.1|5181774_5182023_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	5.4e-38
WP_000202560.1|5182242_5183829_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
>prophage 1
NZ_CP012501	Escherichia coli strain 08-00022 plasmid pCFSAN004179G, complete sequence	242187	7543	128525	242187	plate,transposase,integrase	Escherichia_phage(23.81%)	91	31216:31247	137983:138014
WP_040091195.1|7543_8716_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.2	2.0e-228
WP_040091197.1|9985_10351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047088605.1|10420_10927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948397.1|12723_13417_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.4	2.3e-131
WP_000766066.1|13909_14185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040091166.1|14679_16335_+	L-lactate permease	NA	NA	NA	NA	NA
WP_000217412.1|16334_17111_+	transcriptional regulator LldR	NA	NA	NA	NA	NA
WP_000074142.1|18919_19075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024166187.1|20596_20878_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	44.1	1.3e-19
WP_001081196.1|20886_21168_+	HigA family addiction module antidote protein	NA	I6ZVM3	Aeromonas_phage	44.7	1.3e-08
WP_001179712.1|23231_24236_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_085948397.1|25115_25810_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.4	2.3e-131
WP_001364036.1|26047_27535_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_136752748.1|28588_28798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000704517.1|29051_29912_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	24.1	2.8e-09
WP_000557618.1|30571_30829_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_148713600.1|30761_31163_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
31216:31247	attL	ACCGCTGCTGGTCCCTCATTCAGTGACTGCCC	NA	NA	NA	NA
WP_000348341.1|31794_32304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000269721.1|32960_33581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170992551.1|34785_35999_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	2.3e-166
WP_024166190.1|37576_38596_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000121742.1|38870_39122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000220565.1|39111_39393_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	2.9e-24
WP_032287374.1|43283_43505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000072548.1|44042_44519_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000156834.1|44521_46000_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_024166215.1|46009_46522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000555551.1|46531_46954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001037841.1|46946_48749_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001173972.1|48739_49675_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000361984.1|49682_51665_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.9	2.8e-12
WP_000132334.1|51675_52137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032194046.1|52152_52452_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_040091076.1|52455_53532_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000202244.1|53539_54091_+	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_040091079.1|54109_55462_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_032287317.1|58820_59423_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_001363971.1|59429_62834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000029852.1|62837_65369_+	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	33.4	1.9e-93
WP_024166170.1|67183_68215_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000359998.1|68594_69680_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_024212275.1|69990_70587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000870679.1|70658_71267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050545185.1|72675_73029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050545184.1|73275_73839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000733530.1|75229_75448_-	ST-I family heat-stable enterotoxin	NA	NA	NA	NA	NA
WP_001066958.1|76622_77363_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_021517434.1|77647_78625_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	7.9e-101
WP_000312332.1|80166_80799_+	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.6	1.1e-29
WP_000752648.1|80798_81161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948766.1|81826_83165_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.1	1.2e-70
WP_000435659.1|83213_83639_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	9.5e-35
WP_000624701.1|83635_83986_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_047088941.1|84016_85630_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.6	3.5e-178
WP_040091502.1|86082_86718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948397.1|87550_88245_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	97.4	2.3e-131
WP_040091006.1|88772_90344_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.8	7.1e-168
WP_000056792.1|90606_91572_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_047088947.1|94667_95033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040091217.1|95298_96144_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000919911.1|96671_97496_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024211958.1|97682_98219_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_047088708.1|98259_100674_+	F4 (K88) fimbrial usher FaeD	NA	NA	NA	NA	NA
WP_000044495.1|100666_101458_+	F4 (K88) fimbrial chaperone FaeE	NA	NA	NA	NA	NA
WP_000753471.1|101492_101984_+	F4 (K88) fimbria minor subunit FaeF	NA	NA	NA	NA	NA
WP_040091216.1|102221_103055_+	fimbrial adhesin F41 protein Fim41a	NA	NA	NA	NA	NA
WP_000859341.1|103150_103948_+	F4 (K88) fimbria minor subunit FaeH	NA	NA	NA	NA	NA
WP_000738847.1|103977_104742_+	F4 (K88) fimbria minor subunit FaeI	NA	NA	NA	NA	NA
WP_024211960.1|104758_105532_+	F4 (K88) fimbria accessory protein FaeJ	NA	NA	NA	NA	NA
WP_024211961.1|105598_106234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024211962.1|106647_109305_+	peptidase M66	NA	NA	NA	NA	NA
WP_024211963.1|109457_110264_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_000253903.1|110264_112235_+	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_000043378.1|112231_113725_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173147.1|113738_114962_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231935.1|114988_115423_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082930.1|115419_115965_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000173399.1|115985_116333_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000003574.1|116329_116929_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000868202.1|116925_117903_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_072097069.1|117941_119099_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004185.1|119091_119571_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_001008986.1|119657_120491_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_024211966.1|120588_120969_+	type II secretion system pilot lipoprotein GspS	NA	NA	NA	NA	NA
WP_065224993.1|121124_122156_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_040091563.1|122375_122921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278817.1|124696_125113_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000688520.1|125105_126086_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	51.1	3.8e-79
WP_000030205.1|126499_126808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144033.1|126897_127539_-	ParA family protein	NA	NA	NA	NA	NA
WP_000016974.1|127718_128525_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	6.0e-54
137983:138014	attR	GGGCAGTCACTGAATGAGGGACCAGCAGCGGT	NA	NA	NA	NA
