The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016182	Escherichia coli strain EC590 chromosome, complete genome	4617703	1404388	1417570	4617703		Escherichia_phage(40.0%)	12	NA	NA
WP_001295182.1|1404388_1405150_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1405143_1405770_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1405909_1407049_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1407111_1408104_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_049254918.1|1408197_1409562_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1409649_1410426_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1410430_1411069_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590405.1|1411065_1412328_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	8.3e-135
WP_000847985.1|1412324_1413233_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272546.1|1413398_1414196_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.5e-70
WP_001141323.1|1414246_1414903_-	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.8	3.3e-50
WP_001272928.1|1415008_1417570_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP016182	Escherichia coli strain EC590 chromosome, complete genome	4617703	2011797	2021238	4617703		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569315.1|2011797_2012724_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|2012728_2013460_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|2013440_2013548_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|2013607_2014339_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|2014560_2016246_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|2016242_2016962_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|2017008_2017479_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|2017518_2017980_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_065344868.1|2018104_2020105_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001333512.1|2020101_2021238_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 3
NZ_CP016182	Escherichia coli strain EC590 chromosome, complete genome	4617703	2116706	2127369	4617703	transposase	Enterobacteria_phage(22.22%)	10	NA	NA
WP_000043543.1|2116706_2118113_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_049290679.1|2118339_2119755_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	1.8e-53
WP_049290677.1|2119778_2121149_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.0	1.4e-31
WP_044650165.1|2121307_2122372_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.0e-105
WP_000676431.1|2122398_2123268_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	9.8e-111
WP_044650166.1|2123299_2124190_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.9	5.3e-27
WP_023297948.1|2124204_2124759_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	5.0e-52
WP_000704907.1|2124939_2126106_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_065344871.1|2126206_2126506_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_049290938.1|2126502_2127369_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 4
NZ_CP016182	Escherichia coli strain EC590 chromosome, complete genome	4617703	2172756	2242256	4617703	transposase	Shigella_phage(18.18%)	56	NA	NA
WP_085949152.1|2172756_2174029_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000973176.1|2178344_2178890_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001297350.1|2178886_2179630_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193786.1|2179641_2180721_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001310930.1|2180782_2181718_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011447.1|2182175_2183093_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_049290662.1|2183194_2184145_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122985555.1|2184262_2185906_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532923.1|2186538_2187255_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060231.1|2187597_2189052_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_001413461.1|2189153_2190470_-	shikimate transporter	NA	NA	NA	NA	NA
WP_047669044.1|2190784_2191837_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_097754374.1|2192070_2193217_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	95.9	7.0e-173
WP_049290589.1|2193351_2200728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302302.1|2201217_2202015_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001079084.1|2202767_2203298_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_001007759.1|2203640_2204291_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240088.1|2204547_2205183_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740078.1|2205183_2206188_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920132.1|2206295_2206709_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001340597.1|2206841_2207513_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
WP_000826783.1|2207512_2208871_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
WP_001581832.1|2208978_2209830_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_077248818.1|2210421_2210535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072258860.1|2211979_2212135_+	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_065344873.1|2212301_2213414_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_072146742.1|2216919_2217285_+	permease	NA	NA	NA	NA	NA
WP_000365560.1|2217324_2218020_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.4	1.4e-06
WP_012478345.1|2218288_2219263_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_000786003.1|2220557_2221028_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.6e-33
WP_001212247.1|2221016_2221937_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|2222109_2223027_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|2223105_2223288_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001581829.1|2223458_2225114_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	39.2	2.7e-16
WP_000949118.1|2225149_2225965_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|2226262_2226490_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_071527558.1|2226598_2226841_+	protein DsrB	NA	NA	NA	NA	NA
WP_000019473.1|2227468_2228449_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_000983975.1|2228494_2229178_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|2229186_2229456_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253441.1|2229465_2230203_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001059114.1|2230202_2230568_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282098.1|2230570_2230984_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|2230980_2231985_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133106.1|2231989_2232454_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_049290898.1|2232558_2233686_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_049290899.1|2233682_2234126_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000213294.1|2234144_2235518_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282706.1|2235517_2236204_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067950.1|2236196_2237192_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000994473.1|2237184_2238843_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_001301376.1|2239057_2239372_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070440.1|2239715_2240048_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001310919.1|2240216_2240768_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000879825.1|2240777_2241575_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015674555.1|2241731_2242256_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
>prophage 5
NZ_CP016182	Escherichia coli strain EC590 chromosome, complete genome	4617703	2590901	2639023	4617703	tail,transposase,lysis,integrase,protease	Escherichia_phage(26.47%)	61	2585252:2585267	2615483:2615498
2585252:2585267	attL	TTCATAAAAATAATCC	NA	NA	NA	NA
WP_001260865.1|2590901_2591723_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2591822_2591906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743957.1|2591998_2592334_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2592730_2593984_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2594090_2594984_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2595118_2596339_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2596463_2597159_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2597111_2598404_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2598562_2599177_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_049254808.1|2599219_2600074_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2600075_2600693_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|2600703_2603127_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041675.1|2603187_2605614_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001300836.1|2605812_2606118_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2606225_2606936_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2606938_2607499_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2607533_2607875_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2608009_2608336_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2608541_2609756_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|2609767_2610787_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2610844_2610955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876958.1|2610974_2612255_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_001296941.1|2612289_2612526_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001151262.1|2614608_2615031_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_001310834.1|2615027_2615384_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001333339.1|2615903_2617439_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
2615483:2615498	attR	GGATTATTTTTATGAA	NA	NA	NA	NA
WP_001341330.1|2617487_2617721_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	7.8e-39
WP_072096395.1|2618591_2618810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000955178.1|2618784_2618967_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_000589005.1|2619144_2620458_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001301033.1|2620894_2621227_-	protein FlxA	NA	NA	NA	NA	NA
WP_001326990.1|2621429_2621735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2621759_2621999_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2621998_2622286_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2622357_2622513_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2622729_2622981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2623047_2623326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265199.1|2623327_2624377_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_001047135.1|2624390_2625143_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2625420_2625510_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2625564_2625777_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2626077_2626293_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2627046_2627262_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2627266_2627578_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2627574_2628108_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2628104_2628602_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2628964_2629177_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2629187_2629376_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2629378_2629444_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2629523_2629679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2629850_2630024_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2630175_2630586_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2630643_2630877_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453611.1|2631265_2631811_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_049254577.1|2631785_2633591_+	hypothetical protein	NA	A0A0K2FJ14	Enterobacteria_phage	99.1	1.3e-213
WP_000885611.1|2633590_2634166_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078177.1|2634263_2634854_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2635170_2635404_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2635472_2635586_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2636190_2637474_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527809.1|2637562_2639023_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
>prophage 6
NZ_CP016182	Escherichia coli strain EC590 chromosome, complete genome	4617703	2967156	3022227	4617703	tRNA,transposase,integrase	Escherichia_phage(40.0%)	55	3010456:3010515	3026455:3026558
WP_000152933.1|2967156_2967741_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|2967857_2968949_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001334788.1|2969717_2972585_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001205410.1|2972684_2974613_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733715.1|2974831_2975902_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_000059411.1|2975912_2976545_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_032258394.1|2976555_2977974_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_000841714.1|2978293_2979991_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_000615070.1|2980069_2980510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310727.1|2980687_2980942_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000020169.1|2981142_2981877_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_001301104.1|2981878_2982490_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051560.1|2982589_2983504_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340194.1|2983598_2985335_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197881.1|2985720_2986791_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|2986800_2988099_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190854.1|2988428_2989961_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|2990012_2990732_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|2990952_2992494_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|2992639_2993170_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457616.1|2993215_2994484_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
WP_000897378.1|2994483_2994903_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001336523.1|2995275_2996187_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|2996393_2996855_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284280.1|2996931_2997591_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|2997662_2997956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695215.1|2998197_2998599_+	inhibitor of g-type lysozyme	NA	NA	NA	NA	NA
WP_001056840.1|2998701_2999070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301105.1|2999589_3000285_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3000308_3001121_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3001124_3001391_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001131446.1|3002140_3002260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001325005.1|3002220_3002406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122462.1|3002506_3002680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304448.1|3002741_3003026_+	glycine zipper family protein	NA	NA	NA	NA	NA
WP_000429836.1|3005855_3006290_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|3006361_3006712_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|3006725_3007001_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|3007036_3007459_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|3007510_3009205_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|3009222_3009585_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|3009581_3009818_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|3009853_3010522_+	EAL domain-containing protein	NA	NA	NA	NA	NA
3010456:3010515	attL	TGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAG	NA	NA	NA	NA
WP_000935452.1|3010560_3011865_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|3011911_3012616_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|3013190_3014042_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|3014349_3015165_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|3015225_3016029_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|3016028_3016865_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|3016925_3017630_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|3017780_3018596_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|3018785_3019490_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|3020074_3020935_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_023150081.1|3021084_3021486_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|3021522_3022227_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
3026455:3026558	attR	CTGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACAATCCAGTTAGGGTATAGCTCAACCTGACATAGAAGCAAAAACTC	NA	NA	NA	NA
>prophage 7
NZ_CP016182	Escherichia coli strain EC590 chromosome, complete genome	4617703	3291121	3378032	4617703	tRNA,tail,terminase,lysis,portal,protease,integrase,plate,capsid,head	Salmonella_phage(62.07%)	92	3284084:3284099	3380977:3380992
3284084:3284099	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|3291121_3292414_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3292504_3293848_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3293858_3294470_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077038.1|3294628_3298618_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3298752_3299247_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3299791_3300757_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043592.1|3300879_3302646_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	1.8e-23
WP_001202175.1|3302646_3304368_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001241678.1|3304409_3305114_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3305398_3305617_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3306300_3308577_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3308607_3308928_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3309250_3309475_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188144.1|3309547_3311494_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746443.1|3311490_3312606_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001380339.1|3312756_3313713_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599825.1|3313709_3315368_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|3315793_3316489_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|3316982_3317882_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458809.1|3318025_3319678_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178676.1|3319689_3320658_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815337.1|3320790_3322509_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
WP_000566376.1|3322545_3323547_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|3323557_3324988_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|3325086_3326100_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001252135.1|3326096_3326927_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160739.1|3326923_3327247_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|3327372_3327888_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3328105_3328834_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3328851_3329583_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3329589_3330306_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3330305_3330974_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001352074.1|3331264_3331996_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149682.1|3332194_3333322_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.0e-27
WP_000389260.1|3333362_3333851_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061658.1|3333910_3334756_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105430.1|3334752_3335706_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996005.1|3335715_3336849_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126072.1|3336943_3338056_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3338406_3338883_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3338970_3339873_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|3339933_3340656_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3340639_3340927_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3341086_3341344_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|3341373_3341751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|3342020_3343706_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3343941_3344160_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011797.1|3344250_3345351_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	1.7e-176
WP_000980413.1|3345347_3345833_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_058655992.1|3345829_3348907_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.7	0.0e+00
WP_000763311.1|3348899_3349019_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3349033_3349336_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001504081.1|3349390_3349906_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_000046120.1|3349915_3351088_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_058655991.1|3351230_3351797_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	1.9e-86
WP_001340317.1|3352303_3352537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032316.1|3352517_3352928_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.3	2.2e-20
WP_001086833.1|3354444_3355050_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	4.4e-110
WP_001552638.1|3355042_3355951_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.6e-143
WP_000177581.1|3355937_3356297_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	2.8e-51
WP_001552634.1|3356293_3356872_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.5	1.1e-94
WP_047340712.1|3356940_3357387_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	1.3e-61
WP_001039926.1|3357379_3357811_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	2.9e-71
WP_001080918.1|3357906_3358335_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	1.4e-46
WP_049028117.1|3358331_3358709_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.0e-16
WP_001069905.1|3358710_3359223_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000171568.1|3359203_3359419_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3359422_3359626_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673530.1|3359625_3360090_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_000059191.1|3360185_3360836_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000742511.1|3360839_3361898_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000216238.1|3361914_3362748_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.3	2.2e-123
WP_058655988.1|3362890_3364657_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_040075594.1|3364656_3365688_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.2	3.8e-170
WP_149866257.1|3365739_3366054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065344884.1|3366071_3366485_-	hypothetical protein	NA	S5W9H2	Leptospira_phage	39.1	2.0e-05
WP_040075599.1|3366486_3367305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021556032.1|3367544_3368387_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.1	1.1e-58
WP_000094764.1|3368386_3368602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3368872_3369106_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3369117_3369306_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_065344885.1|3369458_3371873_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.0	0.0e+00
WP_023150402.1|3371869_3372727_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	1.7e-160
WP_065344886.1|3372723_3372951_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	4.6e-36
WP_001244165.1|3372950_3373184_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000963472.1|3373251_3373593_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_023150404.1|3373556_3373757_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	3.5e-32
WP_000460901.1|3373764_3374274_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.7e-86
WP_000188448.1|3374306_3374528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000107902.1|3374623_3375220_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.4	1.1e-39
WP_023150405.1|3375240_3376917_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	67.0	5.7e-83
WP_065344887.1|3377000_3378032_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.0	8.6e-106
3380977:3380992	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 8
NZ_CP016182	Escherichia coli strain EC590 chromosome, complete genome	4617703	4361362	4392720	4617703	transposase,integrase	Staphylococcus_phage(20.0%)	29	4391398:4391413	4395892:4395907
WP_001254928.1|4361362_4362514_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.2e-41
WP_160370960.1|4362562_4363417_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.7e-68
WP_032215506.1|4363570_4365568_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	5.7e-21
WP_001375347.1|4365630_4366908_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000145475.1|4367155_4367812_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001390362.1|4367869_4367974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126123275.1|4367992_4368103_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001387298.1|4369219_4369318_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_001295538.1|4369319_4370102_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|4370407_4371328_+	ribokinase	NA	NA	NA	NA	NA
WP_000998347.1|4371355_4372672_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107480.1|4372683_4373697_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_089516276.1|4373841_4375114_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.6e-176
WP_001446914.1|4375500_4375740_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.0	1.5e-13
WP_000345346.1|4375950_4377207_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000705931.1|4377219_4377507_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000916805.1|4377522_4377966_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000416153.1|4378236_4379268_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
WP_073978005.1|4379992_4380601_-	maturase	NA	NA	NA	NA	NA
WP_001375333.1|4380618_4381053_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_001352291.1|4381961_4382288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049254365.1|4382497_4382851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|4383098_4384121_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001323403.1|4384120_4384900_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001254928.1|4386090_4387242_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	2.2e-41
WP_001352287.1|4387834_4388737_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_001352286.1|4388854_4391035_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_001446910.1|4391037_4391412_+	hypothetical protein	NA	NA	NA	NA	NA
4391398:4391413	attL	CTGAAAAATAATTAAA	NA	NA	NA	NA
WP_000772679.1|4391454_4392720_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.5	4.8e-74
WP_000772679.1|4391454_4392720_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.5	4.8e-74
4395892:4395907	attR	TTTAATTATTTTTCAG	NA	NA	NA	NA
