The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP004046	[Brevibacterium] flavum ZL-1, complete genome	3340941	452033	491104	3340941	transposase	Catovirus(18.18%)	24	NA	NA
WP_065366598.1|452033_453299_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	97.6	7.8e-234
WP_065366599.1|454602_457254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146144398.1|457293_458160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065366601.1|458197_459574_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_065366602.1|459792_460677_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_077311031.1|460804_461527_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_060563812.1|463470_463893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107111901.1|464280_468810_-	glycosyltransferase	NA	A0A1V0SAE6	Catovirus	31.6	2.3e-33
WP_065366603.1|469140_470394_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	25.0	4.0e-20
WP_081299818.1|473713_475903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060563823.1|475945_476854_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065366605.1|477132_478320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065366606.1|478354_478570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065366607.1|478588_481582_+	glycosyltransferase	NA	A0A1V0SAE6	Catovirus	30.0	3.4e-25
WP_081299819.1|481840_482125_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_034983522.1|482148_483459_-|transposase	ISL3-like element IS31831 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	42.2	1.0e-82
WP_060563542.1|483633_484944_-|transposase	ISL3-like element IS13869 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	44.2	2.5e-86
WP_089158485.1|485453_485792_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_107111903.1|485605_486388_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	28.6	5.9e-14
WP_107111904.1|486365_487567_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.1	2.7e-26
WP_075348078.1|487625_487805_-|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	49.1	2.4e-08
WP_065366609.1|487944_488424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075348475.1|488624_490034_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.2	1.1e-45
WP_075348476.1|490225_491104_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	39.9	9.4e-45
>prophage 2
NZ_CP004046	[Brevibacterium] flavum ZL-1, complete genome	3340941	1489759	1568369	3340941	integrase,transposase	Mycobacterium_phage(14.29%)	59	1501032:1501047	1571935:1571950
WP_034983522.1|1489759_1491070_-|transposase	ISL3-like element IS31831 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	42.2	1.0e-82
WP_146144406.1|1491731_1492952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060564443.1|1493726_1494350_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	30.1	9.1e-18
WP_065366843.1|1494405_1496439_+	site-specific DNA-methyltransferase	NA	H6W8D6	Escherichia_phage	38.1	1.8e-67
WP_146144407.1|1499182_1499581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065367237.1|1499585_1501043_-	hypothetical protein	NA	NA	NA	NA	NA
1501032:1501047	attL	GCAAGCATGGATTAAT	NA	NA	NA	NA
WP_060564448.1|1501658_1503461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081299842.1|1503457_1504876_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_060564449.1|1506813_1508049_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_065366844.1|1508045_1511132_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	29.3	1.8e-58
WP_081299843.1|1511115_1511862_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_060564451.1|1511903_1513535_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_065366845.1|1513531_1514629_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_060564454.1|1515523_1516489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060564455.1|1516489_1516771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107111914.1|1517639_1518479_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.5	1.5e-07
WP_060564456.1|1518559_1519483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065366846.1|1519616_1521029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060564458.1|1521123_1522350_+	leucine-rich repeat protein	NA	NA	NA	NA	NA
WP_081299844.1|1524313_1524565_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060564459.1|1524672_1525827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011014272.1|1525823_1526150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065366847.1|1526146_1527910_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_107111918.1|1528248_1528539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065367239.1|1529078_1529408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011014272.1|1531793_1532120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065366847.1|1532116_1533880_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_107111918.1|1534218_1534509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065367239.1|1535048_1535378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034983522.1|1535656_1536967_+|transposase	ISL3-like element IS31831 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	42.2	1.0e-82
WP_065366848.1|1537052_1539440_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	47.7	6.4e-19
WP_003861489.1|1539635_1539794_-	hypothetical protein	NA	A0A1V0SKJ6	Klosneuvirus	60.0	8.2e-08
WP_065366849.1|1539851_1541261_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_060564463.1|1542169_1542649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060564464.1|1542709_1543276_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	36.8	1.6e-08
WP_003861499.1|1543258_1543966_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060564466.1|1545683_1546277_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_081299845.1|1546623_1547703_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003858852.1|1547711_1547870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858849.1|1547911_1548910_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_060564468.1|1548934_1550017_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_060564469.1|1550073_1551054_-	DUF3515 domain-containing protein	NA	NA	NA	NA	NA
WP_060564470.1|1551121_1552111_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_060564471.1|1552110_1552860_+	uracil-DNA glycosylase	NA	S4VZ65	Pandoravirus	35.7	1.2e-29
WP_075861336.1|1552991_1554575_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_065366851.1|1554579_1556703_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_003858832.1|1556722_1556938_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003858829.1|1556937_1557522_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_060564475.1|1557525_1558008_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	30.8	1.9e-15
WP_065366852.1|1558579_1559344_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	1.2e-27
WP_060564477.1|1559347_1560298_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003858822.1|1560340_1561345_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060564478.1|1561444_1562254_+	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
WP_003858816.1|1562336_1563317_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_081299846.1|1563964_1564723_-|integrase	site-specific integrase	integrase	G9FH48	Rhodococcus_phage	32.1	1.8e-15
WP_011014294.1|1564708_1565119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003861519.1|1565115_1565862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003858809.1|1566054_1566489_+	metallopeptidase	NA	NA	NA	NA	NA
WP_089158527.1|1567167_1568369_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	34.2	2.5e-27
1571935:1571950	attR	ATTAATCCATGCTTGC	NA	NA	NA	NA
>prophage 3
NZ_CP004046	[Brevibacterium] flavum ZL-1, complete genome	3340941	1812240	1817651	3340941	integrase	Corynephage(33.33%)	7	1806446:1806459	1817109:1817122
1806446:1806459	attL	TCGCCGCCACCAAC	NA	NA	NA	NA
WP_081299849.1|1812240_1812552_+	TM2 domain-containing protein	NA	A0A1B0T6B3	Bacillus_phage	42.7	4.4e-05
WP_065366910.1|1812590_1813181_+	hypothetical protein	NA	A0A1P8D5Q9	Corynebacterium_phage	53.3	2.6e-22
WP_060564602.1|1813913_1814672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060564603.1|1814776_1815109_+	hypothetical protein	NA	Q9ZWV7	Corynephage	45.0	2.8e-18
WP_060564604.1|1815139_1815682_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9ZWV7	Corynephage	31.0	2.7e-10
WP_060564605.1|1815785_1816016_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1L6BZH2	Pasteurella_phage	43.1	1.3e-06
WP_065366912.1|1816019_1817651_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	26.9	6.0e-37
1817109:1817122	attR	GTTGGTGGCGGCGA	NA	NA	NA	NA
>prophage 4
NZ_CP004046	[Brevibacterium] flavum ZL-1, complete genome	3340941	2612516	2656758	3340941	protease,transposase	Mycobacterium_phage(50.0%)	36	NA	NA
WP_065367286.1|2612516_2613827_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	42.5	2.0e-83
WP_155268194.1|2614347_2614491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065367069.1|2615973_2616438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003857996.1|2616518_2616875_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_003860315.1|2616949_2617570_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	26.9	2.3e-05
WP_060564964.1|2617596_2618334_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_040967553.1|2618519_2619554_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081299906.1|2619607_2619901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060564966.1|2622189_2622900_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	59.0	1.5e-77
WP_081299862.1|2622892_2623750_+	arsenic resistance protein	NA	NA	NA	NA	NA
WP_065367255.1|2623746_2624568_-	M23 family metallopeptidase	NA	W8ED04	Mycobacterium_phage	48.0	6.8e-21
WP_060564970.1|2625310_2625589_-	amino acid acetyltransferase	NA	NA	NA	NA	NA
WP_060564974.1|2628274_2629315_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_034983522.1|2630068_2631379_+|transposase	ISL3-like element IS31831 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	42.2	1.0e-82
WP_011896442.1|2632805_2633171_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060564975.1|2633347_2633932_-	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_018297431.1|2636693_2637485_+	M23 family metallopeptidase	NA	O03937	Lactobacillus_phage	44.8	3.3e-20
WP_060564978.1|2637628_2637961_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_035123040.1|2638062_2638770_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_035123041.1|2638779_2639430_+	vitamin K epoxide reductase family protein	NA	NA	NA	NA	NA
WP_075348333.1|2639476_2639800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060564980.1|2641554_2642463_+	cation transporter	NA	NA	NA	NA	NA
WP_075348335.1|2642488_2643160_-	NADPH-dependent F420 reductase	NA	NA	NA	NA	NA
WP_107111930.1|2643360_2643894_+	DinB family protein	NA	NA	NA	NA	NA
WP_060564983.1|2645438_2645834_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_060564985.1|2645970_2646945_+	arsenic resistance protein	NA	NA	NA	NA	NA
WP_156768163.1|2646941_2647091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040968218.1|2648369_2649698_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_040967800.1|2651236_2652004_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_060564990.1|2652106_2652961_-	glutamate racemase	NA	NA	NA	NA	NA
WP_040967802.1|2653011_2653638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011015181.1|2653647_2654142_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060564992.1|2654171_2654921_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_065367288.1|2654917_2655832_-	P1 family peptidase	NA	NA	NA	NA	NA
WP_060564997.1|2655831_2656371_-	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_074493708.1|2656383_2656758_-|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
>prophage 5
NZ_CP004046	[Brevibacterium] flavum ZL-1, complete genome	3340941	3191734	3244517	3340941	integrase,transposase	Streptococcus_phage(13.33%)	53	3190453:3190472	3244560:3244579
3190453:3190472	attL	GTCCACCAAACAGGGGTCAG	NA	NA	NA	NA
WP_040968032.1|3191734_3192025_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_040968033.1|3192568_3192775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065367186.1|3193050_3194613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003860174.1|3195397_3196024_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	36.4	1.9e-23
WP_011013963.1|3196373_3196733_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065367187.1|3196732_3197329_+	cadmium transporter	NA	NA	NA	NA	NA
WP_003859023.1|3197587_3199009_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	30.0	1.2e-44
WP_003859021.1|3199107_3199497_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_065367188.1|3199987_3200698_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	59.4	1.4e-78
WP_003862073.1|3200801_3201113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040968043.1|3201109_3201352_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_065367189.1|3201588_3202890_-	APC family permease	NA	NA	NA	NA	NA
WP_065367190.1|3202955_3204437_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_003862069.1|3204433_3204700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081299874.1|3205368_3205917_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	53.6	2.2e-39
WP_075348430.1|3205877_3206162_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_081299875.1|3206247_3206988_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_011015535.1|3207143_3207380_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_011015536.1|3207585_3207903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060565379.1|3208546_3210424_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.2	6.0e-105
WP_003861174.1|3211631_3212006_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	38.7	4.5e-12
WP_060565381.1|3212191_3212398_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_011015541.1|3212570_3213917_+	MFS transporter	NA	NA	NA	NA	NA
WP_003861180.1|3213876_3214059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081299876.1|3214069_3214672_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065367192.1|3214878_3216411_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	42.0	9.2e-88
WP_003855068.1|3217018_3217471_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_060565383.1|3217527_3218205_-	single-stranded DNA-binding protein	NA	A0A1P8D5R5	Corynebacterium_phage	52.7	2.9e-49
WP_003855074.1|3218241_3218529_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003861194.1|3218888_3219080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011015546.1|3219076_3220537_-	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_060565384.1|3220582_3222745_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_065367193.1|3222836_3223229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003855083.1|3223420_3223894_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081299877.1|3223921_3224866_+	universal stress protein	NA	NA	NA	NA	NA
WP_003861203.1|3224897_3225395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038586445.1|3225462_3225786_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_060565387.1|3225806_3226745_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_065367195.1|3226792_3228058_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003855103.1|3228054_3228747_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	43.1	1.0e-38
WP_060565535.1|3228750_3230589_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003855107.1|3230955_3232047_+	inositol-3-phosphate synthase	NA	A0A0H4IPK5	Stenotrophomonas_phage	42.4	8.6e-72
WP_075348539.1|3232122_3232677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060565390.1|3232742_3234230_-	DUF1846 domain-containing protein	NA	NA	NA	NA	NA
WP_006285365.1|3234598_3235012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006285366.1|3235188_3236094_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	27.5	3.4e-13
WP_081299886.1|3236407_3237613_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	32.7	2.1e-31
WP_060565391.1|3238121_3238619_-	DNA starvation/stationary phase protection protein Dps	NA	NA	NA	NA	NA
WP_075348438.1|3238764_3239580_+	Fpg/Nei family DNA glycosylase	NA	NA	NA	NA	NA
WP_060565393.1|3239816_3240968_+	RtcB family protein	NA	A0A0M5M6X2	Mycobacterium_phage	63.2	1.4e-136
WP_003855120.1|3240974_3241451_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	42.7	5.0e-16
WP_075348439.1|3241465_3242479_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_107111897.1|3243330_3244517_-|transposase	IS3-like element IS1206 family transposase	transposase	U5P429	Shigella_phage	33.7	5.4e-27
3244560:3244579	attR	GTCCACCAAACAGGGGTCAG	NA	NA	NA	NA
