The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016358	Escherichia coli strain K-15KW01 chromosome, complete genome	5154641	2530796	2542358	5154641	integrase	Enterobacteria_phage(88.89%)	13	2530614:2530636	2541248:2541270
2530614:2530636	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001218974.1|2530796_2531984_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	91.2	1.5e-207
WP_000281857.1|2532030_2532558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001335488.1|2532564_2533650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000446153.1|2533946_2534519_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
WP_000638629.1|2534592_2535093_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001279711.1|2535089_2535824_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	96.3	1.1e-126
WP_001149160.1|2536376_2536643_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980256.1|2536639_2537230_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	89.6	2.0e-59
WP_001244665.1|2537222_2537510_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_065377593.1|2537502_2537958_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|2538093_2538414_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783690.1|2538428_2540762_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
WP_001280586.1|2541320_2542358_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	43.6	7.4e-73
2541248:2541270	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP016358	Escherichia coli strain K-15KW01 chromosome, complete genome	5154641	2991020	3032458	5154641	holin,integrase,head,protease,portal,terminase,plate,capsid,tail,tRNA	Shigella_phage(41.82%)	62	2985813:2985828	3040394:3040409
2985813:2985828	attL	CGCAACGTCAGCAAGT	NA	NA	NA	NA
WP_021538831.1|2991020_2991194_+	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	96.5	1.7e-22
WP_001093916.1|2991241_2991523_-	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_023145273.1|2991559_2992132_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	99.5	5.5e-110
WP_023145274.1|2992131_2992872_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	77.6	1.3e-76
WP_000212745.1|2992875_2993163_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	98.9	3.5e-49
WP_021529121.1|2993164_2993950_-	ead/Ea22-like family protein	NA	A0A2R2Z312	Escherichia_phage	76.1	8.0e-104
WP_000476209.1|2993936_2994185_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	94.8	5.5e-35
WP_000111289.1|2994177_2994381_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_001242718.1|2994377_2994740_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.2	3.6e-67
WP_000008177.1|2994730_2995267_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.3	9.0e-99
WP_049081175.1|2995395_2996220_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	98.9	1.1e-148
WP_000135680.1|2996285_2996648_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000159356.1|2997089_2997281_+	hypothetical protein	NA	S5FM78	Shigella_phage	100.0	3.3e-27
WP_033545897.1|2997508_2997712_-	ClpX C4-type zinc finger	NA	A0A1C9II97	Salmonella_phage	73.5	1.7e-13
WP_000853321.1|2998045_2998732_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	41.6	2.3e-38
WP_000187186.1|2998869_2999118_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000515871.1|2999140_2999698_+	hypothetical protein	NA	U5P4K1	Shigella_phage	93.0	7.7e-93
WP_001250270.1|2999873_3000086_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	5.4e-15
WP_044075265.1|3000042_3001035_+	hypothetical protein	NA	U5P0A0	Shigella_phage	97.6	7.3e-94
WP_000066917.1|3001129_3001783_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210180.1|3001779_3002106_+	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	99.1	2.0e-53
WP_000767113.1|3002102_3002492_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061422.1|3002511_3003354_+	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.8	5.7e-140
WP_032301653.1|3003361_3004351_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	5.6e-195
WP_001047102.1|3004364_3005117_+	antitermination protein	NA	Q8SBE4	Shigella_phage	99.2	3.1e-137
WP_001542448.1|3005267_3005525_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	94.1	7.2e-38
WP_001283169.1|3005604_3005991_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|3005977_3006259_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001075793.1|3006258_3006873_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	99.0	8.2e-112
WP_001337094.1|3006869_3007262_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	90.6	2.1e-57
WP_000651450.1|3007508_3007829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135203.1|3007921_3008272_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	97.4	1.4e-63
WP_000929181.1|3008397_3008892_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_096859749.1|3009125_3010622_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.8	1.1e-290
WP_000838376.1|3010618_3010780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000923138.1|3010769_3011996_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	99.5	1.7e-241
WP_000999804.1|3011988_3012591_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	99.5	2.0e-110
WP_000766100.1|3012601_3013831_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000924829.1|3013909_3014233_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	99.1	1.7e-52
WP_000702395.1|3014229_3014640_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000224835.1|3014614_3015121_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_000779294.1|3015117_3015678_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	99.5	1.8e-105
WP_000497750.1|3015686_3015857_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_000178796.1|3015840_3017337_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.8	2.9e-272
WP_000090998.1|3017336_3017693_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661046.1|3017692_3017962_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	98.9	1.0e-42
WP_000807191.1|3018103_3019936_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.7	5.1e-303
WP_001337097.1|3020017_3020530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000219913.1|3020620_3021949_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_000999510.1|3021945_3023025_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
WP_001259088.1|3023024_3023573_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.4	3.3e-96
WP_000424732.1|3023572_3023998_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785315.1|3023984_3025043_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	2.3e-199
WP_000383572.1|3025033_3025618_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	2.4e-113
WP_033546544.1|3025621_3026302_+	hypothetical protein	NA	U5P0I1	Shigella_phage	59.7	7.5e-58
WP_077784164.1|3026349_3026787_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	57.0	9.8e-43
WP_001217558.1|3026902_3027151_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	97.6	9.1e-38
WP_000332276.1|3027212_3028310_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.8e-211
WP_000543828.1|3028398_3029436_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891396.1|3029569_3029812_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235524.1|3029976_3030960_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918363.1|3031042_3032458_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
3040394:3040409	attR	ACTTGCTGACGTTGCG	NA	NA	NA	NA
>prophage 3
NZ_CP016358	Escherichia coli strain K-15KW01 chromosome, complete genome	5154641	3481272	3557416	5154641	integrase,holin,protease,portal,terminase,lysis,tail,tRNA	Enterobacteria_phage(43.4%)	85	3481023:3481042	3526147:3526166
3481023:3481042	attL	TTTGCCATTATTTCTCACCC	NA	NA	NA	NA
WP_001218287.1|3481272_3482487_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
WP_000653746.1|3482862_3483858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206728.1|3484425_3485046_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	95.6	1.2e-118
WP_001242728.1|3485045_3485408_-	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.3e-64
WP_000008232.1|3485398_3485935_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_000081256.1|3486062_3486887_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
WP_000135680.1|3486952_3487315_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000500990.1|3487783_3488296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298691.1|3488611_3489304_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	99.1	7.3e-125
WP_001191672.1|3489401_3489662_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	98.8	9.3e-41
WP_000515840.1|3489654_3490206_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	97.8	1.1e-99
WP_001087311.1|3490202_3491039_+	ash family protein	NA	Q8SBF3	Shigella_phage	92.4	1.1e-138
WP_000933943.1|3491031_3491268_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	98.7	2.7e-39
WP_000061519.1|3491264_3492083_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_001315196.1|3492079_3492574_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	8.1e-86
WP_000066917.1|3492573_3493227_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210180.1|3493223_3493550_+	LexA family transcriptional regulator	NA	K7PLX6	Enterobacteria_phage	99.1	2.0e-53
WP_000767113.1|3493546_3493936_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061422.1|3493955_3494798_+	KilA-N domain-containing protein	NA	S5MC03	Escherichia_phage	91.8	5.7e-140
WP_001540821.1|3494805_3495795_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	8.1e-194
WP_001205460.1|3495812_3496154_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_001131905.1|3496166_3496715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868396.1|3496701_3497628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917727.1|3497892_3498096_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	3.0e-31
WP_000799673.1|3498246_3499299_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.9	2.6e-206
WP_001120490.1|3499375_3499702_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	98.1	2.6e-56
WP_001197768.1|3499705_3500182_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	2.5e-84
WP_001298489.1|3500178_3500622_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	93.9	1.5e-70
WP_000084843.1|3500660_3501035_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	87.9	2.5e-55
WP_001205132.1|3501133_3501316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373423.1|3501673_3502168_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
WP_000934116.1|3502167_3504270_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.6	0.0e+00
WP_001072975.1|3504266_3504479_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_072134767.1|3504406_3505987_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	2.1e-289
WP_001136583.1|3505931_3507959_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001097050.1|3508045_3508369_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|3508361_3508637_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677099.1|3508648_3509227_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	2.1e-101
WP_001298485.1|3509223_3509625_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	1.6e-71
WP_000211128.1|3509635_3510379_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.0	1.6e-130
WP_001298500.1|3510439_3510826_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|3510834_3511164_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372054.1|3511135_3514201_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.8	0.0e+00
WP_000447254.1|3514200_3514530_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	5.1e-60
WP_001152410.1|3514539_3515238_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	1.9e-133
WP_000194752.1|3515243_3515987_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	2.2e-151
WP_032143682.1|3515884_3516532_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	3.0e-112
WP_021518114.1|3516592_3520075_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.5	0.0e+00
WP_021518115.1|3520133_3522194_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	54.9	5.7e-125
WP_000355361.1|3522481_3522775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000050924.1|3523250_3525134_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000415965.1|3525351_3525579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217549.1|3525636_3525885_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	4.1e-38
WP_000202563.1|3526104_3527691_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
3526147:3526166	attR	TTTGCCATTATTTCTCACCC	NA	NA	NA	NA
WP_001295748.1|3528083_3528689_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3528815_3528977_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001298490.1|3529098_3530172_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563047.1|3530168_3530948_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088372.1|3531164_3532028_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_001143234.1|3531999_3533550_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001298497.1|3533807_3534587_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477849.1|3534664_3535987_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_000816460.1|3536038_3537262_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224879.1|3537318_3538038_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000566144.1|3538219_3538462_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000105872.1|3538493_3539510_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124608.1|3539537_3540182_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132964.1|3540287_3541256_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001298501.1|3541304_3542687_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093832.1|3542707_3543940_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.3	2.7e-82
WP_001298496.1|3544031_3544364_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000007436.1|3544365_3544650_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000046754.1|3544705_3546373_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.7	1.0e-39
WP_000409429.1|3546579_3548517_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000068677.1|3548606_3548933_+	trp operon repressor	NA	NA	NA	NA	NA
WP_001350367.1|3549005_3549533_-	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_000942350.1|3549584_3550232_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371658.1|3550228_3551098_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|3551308_3551782_+	protein CreA	NA	NA	NA	NA	NA
WP_001188687.1|3551794_3552484_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219582.1|3552483_3553908_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	3.2e-10
WP_000920364.1|3553965_3555318_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|3555377_3556094_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001295754.1|3556189_3556330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223137.1|3556729_3557416_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP016358	Escherichia coli strain K-15KW01 chromosome, complete genome	5154641	3811421	3860761	5154641	transposase,plate	Streptococcus_phage(22.22%)	46	NA	NA
WP_000224521.1|3811421_3812768_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001013428.1|3812770_3813295_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000433567.1|3813291_3814584_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000896716.1|3814588_3815638_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000863399.1|3815601_3817443_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001189667.1|3817448_3817874_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000111582.1|3817878_3819363_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000041480.1|3819385_3819889_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142963.1|3820594_3821113_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_065377601.1|3821333_3823316_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.3	1.2e-23
WP_077883579.1|3823422_3824469_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_000528851.1|3824461_3825901_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_000513317.1|3825875_3826166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000227712.1|3827416_3827920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298174.1|3828013_3828502_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001118042.1|3828772_3829543_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532690.1|3829696_3830170_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973131.1|3830212_3832657_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|3832896_3833475_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001298195.1|3833679_3834447_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|3834417_3835158_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093934.1|3835469_3836219_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_000006241.1|3836394_3836892_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_071778446.1|3836974_3837184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298188.1|3837211_3838951_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000207578.1|3838895_3839681_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226168.1|3839751_3840807_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|3840858_3841152_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263500.1|3841154_3841553_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059895.1|3841562_3842015_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000521561.1|3842204_3843344_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	7.7e-31
WP_000602124.1|3843340_3843955_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292999.1|3844011_3845469_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291991.1|3845729_3846188_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189578.1|3846279_3847524_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174703.1|3847581_3847983_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749900.1|3848021_3849077_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.0e-117
WP_001285288.1|3849365_3850469_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893298.1|3850480_3851734_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
WP_001335540.1|3852234_3852831_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	88.4	1.7e-98
WP_000258743.1|3852917_3854555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000266639.1|3855246_3855474_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000120393.1|3855579_3855807_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000335706.1|3856055_3857489_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000282079.1|3858458_3859022_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_089644009.1|3859229_3860761_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.0	2.8e-44
>prophage 5
NZ_CP016358	Escherichia coli strain K-15KW01 chromosome, complete genome	5154641	4500810	4508533	5154641	integrase	uncultured_Caudovirales_phage(50.0%)	10	4494797:4494811	4507137:4507151
4494797:4494811	attL	GCTCACGGGCCAGAT	NA	NA	NA	NA
WP_000188148.1|4500810_4502757_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4502829_4503054_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000085201.1|4503458_4504697_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.2	2.0e-125
WP_001206970.1|4505106_4505316_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.2e-16
WP_000103622.1|4505454_4505634_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	58.6	1.2e-10
WP_021527564.1|4505767_4505965_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609226.1|4505957_4506269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543626.1|4506261_4506489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791981.1|4506494_4506782_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761778.1|4506778_4508533_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.8	2.2e-93
4507137:4507151	attR	ATCTGGCCCGTGAGC	NA	NA	NA	NA
>prophage 6
NZ_CP016358	Escherichia coli strain K-15KW01 chromosome, complete genome	5154641	4759682	4804785	5154641	integrase,head,portal,terminase,lysis,capsid,tail,tRNA	Enterobacteria_phage(55.77%)	60	4752317:4752332	4811962:4811977
4752317:4752332	attL	TAGCTTTGGAAAACAG	NA	NA	NA	NA
WP_001298466.1|4759682_4760789_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|4760842_4761304_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248675.1|4761313_4761967_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|4762138_4763389_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741330.1|4763502_4764645_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	99.4	3.1e-205
WP_000088653.1|4764634_4764871_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|4765010_4765250_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000763364.1|4765297_4765516_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000188880.1|4765614_4765830_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000548537.1|4765906_4766098_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000682300.1|4766070_4766253_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000186833.1|4766249_4766930_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|4766926_4767712_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995491.1|4767717_4768014_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000233576.1|4768088_4768295_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|4768770_4769148_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|4769125_4770187_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_001337214.1|4770267_4770960_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000184665.1|4771070_4771298_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182882.1|4771328_4771868_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_000147913.1|4771864_4772884_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	6.1e-112
WP_000788796.1|4772880_4773594_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	83.4	9.8e-109
WP_000608370.1|4773672_4774101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182282.1|4774097_4774475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001053041.1|4774742_4775198_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	7.0e-60
WP_000224917.1|4775197_4775368_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	2.0e-12
WP_000774485.1|4775360_4775651_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	9.6e-47
WP_001099712.1|4775647_4776010_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971056.1|4776006_4776147_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204776.1|4776232_4776616_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|4776804_4777887_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|4778475_4778691_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135283.1|4778690_4779188_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	2.1e-89
WP_001228695.1|4779404_4779587_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|4779677_4779971_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|4780451_4780778_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881607.1|4780984_4781167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867568.1|4781730_4782279_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001304453.1|4782250_4784179_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_023151962.1|4784162_4784369_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831760.1|4784365_4785958_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	6.5e-185
WP_001253894.1|4785947_4787453_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.2	1.3e-99
WP_000256813.1|4787489_4787837_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
WP_000522651.1|4787894_4788923_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000201530.1|4788974_4789349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|4789341_4789695_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_001007375.1|4789706_4790285_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.2	1.7e-79
WP_000683149.1|4790281_4790677_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	5.0e-70
WP_001577918.1|4790684_4791425_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
WP_000479163.1|4791440_4791863_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.4e-70
WP_000459487.1|4791844_4792279_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	6.5e-63
WP_023151960.1|4792271_4794833_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.0	0.0e+00
WP_000847349.1|4794829_4795159_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	2.8e-58
WP_016230622.1|4795158_4795857_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	6.2e-132
WP_044869897.1|4795861_4796605_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	7.7e-149
WP_000090917.1|4796541_4797174_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_052991286.1|4797234_4800633_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.8	0.0e+00
WP_023152091.1|4800699_4801299_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	2.3e-111
WP_024179053.1|4801363_4804204_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	92.3	2.5e-54
WP_023152094.1|4804203_4804785_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	1.6e-101
4811962:4811977	attR	TAGCTTTGGAAAACAG	NA	NA	NA	NA
