The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	0	25796	3597394	tRNA	Bodo_saltans_virus(100.0%)	19	NA	NA
WP_066634653.1|631_1426_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_066634656.1|1452_2307_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_066634658.1|2377_3916_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_191090928.1|3964_4699_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_066634661.1|4748_6512_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_066634664.1|6656_7511_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_066634669.1|7523_9584_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_157621904.1|9738_11313_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_066634679.1|11467_12679_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_066642397.1|12882_14658_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_066634681.1|14654_15449_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_066634684.1|15438_16746_-	CapA family protein	NA	NA	NA	NA	NA
WP_066634687.1|16742_17882_-	LCP family protein	NA	NA	NA	NA	NA
WP_066634688.1|17920_19864_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_066634691.1|19888_20857_-	DUF4439 domain-containing protein	NA	NA	NA	NA	NA
WP_066642403.1|20992_21478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066634692.1|21477_22509_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_083190380.1|22510_22828_+	YlxR family protein	NA	NA	NA	NA	NA
WP_066634693.1|23027_25796_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	3.5e-21
>prophage 2
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	29374	31249	3597394		Catovirus(100.0%)	1	NA	NA
WP_066634709.1|29374_31249_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.0	7.9e-41
>prophage 3
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	39462	41746	3597394		Streptococcus_phage(100.0%)	2	NA	NA
WP_066634724.1|39462_40653_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	44.9	2.9e-89
WP_066634725.1|40666_41746_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.7	3.9e-85
>prophage 4
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	48976	51310	3597394		Streptococcus_phage(50.0%)	3	NA	NA
WP_083190384.1|48976_50470_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.6	2.3e-99
WP_157621677.1|50507_50723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083190385.1|50722_51310_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	30.8	5.8e-14
>prophage 5
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	64947	66930	3597394		Tupanvirus(100.0%)	1	NA	NA
WP_083190386.1|64947_66930_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	36.4	9.0e-19
>prophage 6
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	75634	79962	3597394		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_066634805.1|75634_76759_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	28.3	4.8e-25
WP_066634808.1|76762_77494_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_157621906.1|77610_78906_+	MFS transporter	NA	NA	NA	NA	NA
WP_066634811.1|78918_79962_+	PhoH family protein	NA	A0A1L2C8V4	Pseudomonas_phage	44.9	1.6e-46
>prophage 7
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	86994	89248	3597394		Pacmanvirus(50.0%)	3	NA	NA
WP_157621907.1|86994_87633_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A1X6WG33	Pacmanvirus	28.5	1.0e-08
WP_066634827.1|87721_88453_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_066634829.1|88453_89248_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	45.5	1.1e-18
>prophage 8
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	92251	97144	3597394	tRNA	Brazilian_cedratvirus(50.0%)	5	NA	NA
WP_066634836.1|92251_92992_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.6	1.1e-14
WP_066634838.1|92988_93978_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_066634842.1|94215_95151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066634844.1|95316_95595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066634845.1|95746_97144_+|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	30.3	8.8e-45
>prophage 9
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	113202	115137	3597394		Abalone_shriveling_syndrome-associated_virus(100.0%)	1	NA	NA
WP_066634892.1|113202_115137_+	DNA primase	NA	B8Q5B5	Abalone_shriveling_syndrome-associated_virus	31.8	1.0e-30
>prophage 10
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	118502	119231	3597394		Planktothrix_phage(100.0%)	1	NA	NA
WP_157621908.1|118502_119231_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	41.0	9.6e-35
>prophage 11
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	148241	149699	3597394		Klosneuvirus(100.0%)	1	NA	NA
WP_066634963.1|148241_149699_+	GuaB1 family IMP dehydrogenase-related protein	NA	A0A1V0SHK8	Klosneuvirus	30.8	2.7e-44
>prophage 12
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	161198	173509	3597394	tRNA	Tupanvirus(25.0%)	10	NA	NA
WP_066635000.1|161198_162758_-	catalase	NA	A0A2K9L572	Tupanvirus	42.3	3.9e-86
WP_066635002.1|162754_163222_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_157621685.1|163431_163974_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066635012.1|164169_168546_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	33.6	3.2e-16
WP_157621909.1|168869_169466_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	33.9	6.5e-13
WP_022925542.1|169552_169747_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_066635018.1|169796_170183_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_066635021.1|170224_171040_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_083190398.1|171198_172113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066635023.1|172405_173509_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	37.6	1.2e-25
>prophage 13
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	180549	181812	3597394	tRNA	Serratia_phage(100.0%)	1	NA	NA
WP_066635039.1|180549_181812_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	39.8	2.2e-71
>prophage 14
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	199174	200875	3597394		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_066635064.1|199174_200875_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	47.4	2.5e-134
>prophage 15
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	206845	211001	3597394	tRNA	Bacillus_virus(50.0%)	2	NA	NA
WP_066635078.1|206845_208246_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	45.1	4.3e-84
WP_066635080.1|208310_211001_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	32.5	2.2e-52
>prophage 16
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	220333	223751	3597394		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_066635120.1|220333_221266_+	aspartate carbamoyltransferase catalytic subunit	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	30.6	5.0e-28
WP_066635123.1|221262_222597_+	dihydroorotase	NA	NA	NA	NA	NA
WP_066635126.1|222593_223751_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.2	2.3e-43
>prophage 17
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	230099	233537	3597394		Abalone_herpesvirus(33.33%)	4	NA	NA
WP_066635144.1|230099_230672_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	30.7	1.4e-17
WP_022924097.1|230679_230949_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_066635147.1|230990_232238_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	36.8	1.6e-45
WP_066635149.1|232322_233537_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	54.8	2.3e-118
>prophage 18
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	240618	242460	3597394		Planktothrix_phage(100.0%)	1	NA	NA
WP_066635164.1|240618_242460_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.1	3.5e-25
>prophage 19
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	248711	253911	3597394		Bacillus_phage(66.67%)	5	NA	NA
WP_066635189.1|248711_250553_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	4.7e-30
WP_066635190.1|250549_252367_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	1.7e-32
WP_066635191.1|252369_252798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066635193.1|252815_253028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066635195.1|253077_253911_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	44.3	1.9e-31
>prophage 20
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	260090	266960	3597394		Bacillus_phage(33.33%)	5	NA	NA
WP_066635216.1|260090_262796_+	DNA polymerase I	NA	A0A068EMS7	Bacillus_phage	27.5	1.3e-39
WP_083190405.1|262932_264252_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_066635218.1|264263_265253_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_157621688.1|265242_266175_+	ABC transporter ATP-binding protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	28.6	2.4e-06
WP_083190791.1|266210_266960_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	3.0e-15
>prophage 21
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	271100	272948	3597394		Vibrio_phage(100.0%)	1	NA	NA
WP_083190406.1|271100_272948_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.1	4.0e-21
>prophage 22
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	277242	277929	3597394		Mycobacterium_phage(100.0%)	1	NA	NA
WP_066635244.1|277242_277929_-	MBL fold metallo-hydrolase	NA	A0A0C5AMT2	Mycobacterium_phage	74.4	3.1e-11
>prophage 23
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	284203	291524	3597394		uncultured_Mediterranean_phage(33.33%)	5	NA	NA
WP_066635250.1|284203_287170_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	51.2	1.1e-289
WP_083190409.1|287166_287673_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_066635253.1|287665_289585_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_083190410.1|289641_290565_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.0	2.3e-09
WP_066635256.1|290561_291524_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	33.1	5.0e-31
>prophage 24
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	297691	299245	3597394		Cyanophage(100.0%)	1	NA	NA
WP_066635279.1|297691_299245_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	35.5	3.8e-73
>prophage 25
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	306431	307163	3597394		Staphylococcus_phage(100.0%)	1	NA	NA
WP_066635296.1|306431_307163_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	5.3e-17
>prophage 26
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	312675	323950	3597394		environmental_halophage(16.67%)	12	NA	NA
WP_066635318.1|312675_314010_+	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.4	5.0e-90
WP_066635320.1|314026_314521_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A1B1PCH2	Mycobacterium_phage	41.5	6.8e-16
WP_022924030.1|314546_314870_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_066635324.1|314883_315642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066635327.1|315717_317061_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_066635330.1|317210_318098_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	44.5	2.0e-50
WP_066635333.1|318263_319862_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	26.4	2.3e-36
WP_066635336.1|319883_321743_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.8	1.1e-45
WP_066635339.1|321750_322554_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_066635342.1|322555_322780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157621911.1|322776_323088_-	DUF3099 domain-containing protein	NA	NA	NA	NA	NA
WP_191090932.1|323212_323950_+	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.2	5.5e-14
>prophage 27
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	329687	330521	3597394		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_066635368.1|329687_330521_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.8	4.6e-09
>prophage 28
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	361599	369105	3597394	tRNA	Tupanvirus(33.33%)	7	NA	NA
WP_066635460.1|361599_362877_+	cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase	NA	A0A2K9L6B7	Tupanvirus	32.2	3.3e-30
WP_191090972.1|362826_363504_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_066635465.1|363623_364481_+	PAC2 family protein	NA	NA	NA	NA	NA
WP_083190421.1|364466_365315_-	PD-(D/E)XK nuclease family protein	NA	S5XWM5	Mycobacterium_phage	30.0	6.6e-11
WP_066635467.1|365338_366439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066642595.1|366472_367471_+|tRNA	tRNA (adenine-N1)-methyltransferase	tRNA	NA	NA	NA	NA
WP_066635469.1|367467_369105_+	proteasome ATPase	NA	A0A1B2RW50	Lymphocystis_disease_virus	42.2	4.1e-33
>prophage 29
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	382956	389889	3597394		Catovirus(33.33%)	5	NA	NA
WP_066635511.1|382956_383844_+	hypothetical protein	NA	A0A1V0SBJ0	Catovirus	22.3	6.0e-07
WP_066635513.1|383859_386784_+	DEAD/DEAH box helicase	NA	M1HV25	Acanthocystis_turfacea_Chlorella_virus	31.9	7.2e-65
WP_066642597.1|387037_388243_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_066635516.1|388235_388880_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_066635517.1|388929_389889_-	5'-3' exonuclease	NA	A0A2H4IAS6	Erwinia_phage	27.5	1.5e-19
>prophage 30
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	394715	395516	3597394		Sulfolobus_monocaudavirus(100.0%)	1	NA	NA
WP_066635527.1|394715_395516_+	polyprenol monophosphomannose synthase	NA	A0A0N7A8R9	Sulfolobus_monocaudavirus	40.0	2.0e-25
>prophage 31
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	402472	403297	3597394		Staphylococcus_phage(100.0%)	1	NA	NA
WP_066635540.1|402472_403297_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	35.6	9.8e-44
>prophage 32
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	411931	415031	3597394		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_066635566.1|411931_413116_+	methyltransferase domain-containing protein	NA	A0A2K5B251	Erysipelothrix_phage	27.1	2.3e-25
WP_066635568.1|413160_413502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066635570.1|413524_414145_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_066635573.1|414209_415031_-	alpha/beta fold hydrolase	NA	A0A023W7H4	Mycobacterium_phage	36.0	3.6e-06
>prophage 33
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	419648	422534	3597394		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_066635587.1|419648_422534_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	46.5	6.5e-236
>prophage 34
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	431056	432070	3597394		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_066635619.1|431056_432070_-	D-2-hydroxyacid dehydrogenase	NA	M1HI29	Paramecium_bursaria_Chlorella_virus	26.6	1.8e-07
>prophage 35
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	444214	449407	3597394	holin	Vibrio_phage(66.67%)	3	NA	NA
WP_066635631.1|444214_445861_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	29.2	5.2e-20
WP_066635633.1|445932_447498_-|holin	choline-sulfatase	holin	A0A2K9L727	Tupanvirus	24.0	1.1e-16
WP_066635634.1|447484_449407_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.5	6.3e-17
>prophage 36
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	456205	459761	3597394		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_066635642.1|456205_456841_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.8	5.8e-12
WP_066635645.1|456824_457721_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.8	1.4e-06
WP_066635648.1|457732_458617_-	ParA family protein	NA	H7BUL8	unidentified_phage	29.4	3.3e-21
WP_066635650.1|458795_459761_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	32.1	3.1e-33
>prophage 37
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	469255	470656	3597394	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_066635689.1|469255_470656_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.7	4.5e-41
>prophage 38
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	475457	479635	3597394		Rhodococcus_phage(33.33%)	3	NA	NA
WP_066635695.1|475457_477794_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1I9SAA0	Rhodococcus_phage	33.3	1.8e-05
WP_066635697.1|477860_478397_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	37.5	3.4e-21
WP_066635699.1|478414_479635_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	28.3	5.9e-21
>prophage 39
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	496020	498006	3597394	tRNA	Hokovirus(100.0%)	1	NA	NA
WP_066635743.1|496020_498006_-|tRNA	threonine--tRNA ligase	tRNA	A0A1V0SFU2	Hokovirus	29.5	9.6e-53
>prophage 40
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	517018	518107	3597394		Bacillus_virus(100.0%)	1	NA	NA
WP_066635779.1|517018_518107_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	40.6	3.2e-26
>prophage 41
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	524725	526280	3597394		Indivirus(50.0%)	2	NA	NA
WP_083190437.1|524725_525538_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.0	1.2e-12
WP_066635796.1|525527_526280_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.8	8.4e-18
>prophage 42
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	536066	537416	3597394		Staphylococcus_phage(100.0%)	1	NA	NA
WP_066635814.1|536066_537416_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	41.6	1.2e-30
>prophage 43
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	565820	566609	3597394		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_083190445.1|565820_566609_+	glycerophosphodiester phosphodiesterase	NA	M1HE48	Acanthocystis_turfacea_Chlorella_virus	28.2	3.2e-12
>prophage 44
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	573837	577498	3597394		Pseudomonas_phage(50.0%)	2	NA	NA
WP_066635907.1|573837_576444_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	36.2	1.6e-127
WP_066635910.1|576481_577498_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1W6DWY8	Sphingobium_phage	30.9	6.0e-35
>prophage 45
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	581394	582339	3597394		Cowpox_virus(100.0%)	1	NA	NA
WP_066635920.1|581394_582339_+	alpha/beta hydrolase	NA	A0A212PT49	Cowpox_virus	27.3	5.8e-16
>prophage 46
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	585799	586867	3597394		Klosneuvirus(100.0%)	1	NA	NA
WP_066635935.1|585799_586867_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	33.8	1.3e-40
>prophage 47
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	590392	592168	3597394		Bacillus_phage(100.0%)	1	NA	NA
WP_066635937.1|590392_592168_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.2	2.6e-17
>prophage 48
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	596235	597360	3597394		Moumouvirus(100.0%)	1	NA	NA
WP_066635950.1|596235_597360_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	31.2	2.1e-33
>prophage 49
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	607814	610655	3597394		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_083190450.1|607814_608846_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	38.6	5.1e-58
WP_083190802.1|608958_609903_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_066636007.1|609899_610655_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.5	9.7e-14
>prophage 50
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	626228	627125	3597394		Staphylococcus_phage(100.0%)	1	NA	NA
WP_066636050.1|626228_627125_-	M23 family metallopeptidase	NA	A0A2I6PEB6	Staphylococcus_phage	31.9	8.8e-06
>prophage 51
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	635022	635523	3597394		Streptomyces_phage(100.0%)	1	NA	NA
WP_066636068.1|635022_635523_-	dUTP diphosphatase	NA	A0A2L1IVN2	Streptomyces_phage	54.0	1.6e-33
>prophage 52
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	640469	641234	3597394		Escherichia_phage(100.0%)	1	NA	NA
WP_066636076.1|640469_641234_-	thymidine kinase	NA	A0A0A7HFX2	Escherichia_phage	37.1	5.9e-27
>prophage 53
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	652212	653211	3597394		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_191090974.1|652212_653211_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.3	5.7e-22
>prophage 54
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	660652	663133	3597394		Bacillus_virus(100.0%)	1	NA	NA
WP_066636108.1|660652_663133_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.9	1.1e-93
>prophage 55
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	673706	675788	3597394		Moumouvirus(50.0%)	2	NA	NA
WP_066636168.1|673706_674753_+	NAD(P)-dependent alcohol dehydrogenase	NA	M1PHA2	Moumouvirus	33.3	4.3e-12
WP_066636170.1|674840_675788_+	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	53.2	1.2e-08
>prophage 56
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	711088	712308	3597394	protease	Mycobacterium_phage(50.0%)	2	NA	NA
WP_066636300.1|711088_711709_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A2D2W3D8	Mycobacterium_phage	30.6	5.3e-10
WP_066636303.1|711705_712308_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	41.1	2.7e-35
>prophage 57
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	719005	721922	3597394	integrase	Gordonia_phage(100.0%)	4	710413:710428	727775:727790
710413:710428	attL	GACCAAGACGGGGTGC	NA	NA	NA	NA
WP_083190468.1|719005_719581_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2P1A0S4	Gordonia_phage	40.7	9.6e-22
WP_157621717.1|719562_719721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157621718.1|720228_720837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066636343.1|720833_721922_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	27.9	2.9e-19
727775:727790	attR	GACCAAGACGGGGTGC	NA	NA	NA	NA
>prophage 58
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	727630	731017	3597394		Antheraea_pernyi_nuclear_polyhedrosis_virus(100.0%)	1	NA	NA
WP_083190472.1|727630_731017_+	DEAD/DEAH box helicase	NA	Q1HGZ3	Antheraea_pernyi_nuclear_polyhedrosis_virus	31.8	5.3e-43
>prophage 59
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	736658	739232	3597394		Gordonia_phage(100.0%)	1	NA	NA
WP_157621918.1|736658_739232_-	ATP-dependent helicase	NA	A0A160DDV1	Gordonia_phage	25.6	1.6e-23
>prophage 60
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	753451	754648	3597394		Brochothrix_phage(100.0%)	1	NA	NA
WP_066636409.1|753451_754648_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	24.3	1.1e-06
>prophage 61
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	776786	777875	3597394		Oenococcus_phage(100.0%)	1	NA	NA
WP_191090976.1|776786_777875_-	mandelate racemase	NA	Q6A202	Oenococcus_phage	21.6	1.5e-07
>prophage 62
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	783123	786202	3597394		Lactobacillus_phage(50.0%)	2	NA	NA
WP_066636497.1|783123_784038_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.7	2.9e-12
WP_066636501.1|784195_786202_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	25.4	3.6e-07
>prophage 63
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	789825	791556	3597394		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_066636513.1|789825_791556_-	thiamine pyrophosphate-binding protein	NA	E5ERI2	Ostreococcus_lucimarinus_virus	21.1	1.2e-11
>prophage 64
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	797393	798884	3597394		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_066636528.1|797393_798884_-	cryptochrome/photolyase family protein	NA	E3T4R9	Cafeteria_roenbergensis_virus	31.2	5.1e-75
>prophage 65
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	802678	808527	3597394		Acinetobacter_phage(50.0%)	3	NA	NA
WP_191090942.1|802678_805222_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	24.7	5.2e-35
WP_066636544.1|805111_806287_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_083190477.1|806277_808527_-	acyltransferase	NA	A0A166XZF2	Gordonia_phage	32.0	1.6e-72
>prophage 66
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	814613	825012	3597394	holin	Yellowstone_lake_phycodnavirus(20.0%)	6	NA	NA
WP_066636557.1|814613_817922_-	DEAD/DEAH box helicase	NA	A0A0P0YMN2	Yellowstone_lake_phycodnavirus	30.3	4.2e-45
WP_157621730.1|817991_818858_-	alpha/beta fold hydrolase	NA	W0LNE9	Mycobacterium_phage	28.0	8.5e-06
WP_066636563.1|819008_820526_+	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	25.8	8.4e-33
WP_083190479.1|820569_821157_+	TIGR03086 family protein	NA	NA	NA	NA	NA
WP_157621922.1|821224_823252_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	24.3	3.9e-17
WP_066636572.1|823257_825012_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.8	9.0e-55
>prophage 67
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	834690	839317	3597394		Klosneuvirus(50.0%)	4	NA	NA
WP_083190480.1|834690_836037_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A1V0SLA1	Klosneuvirus	37.3	3.6e-51
WP_066636590.1|836033_836870_+	cobalamin-binding protein	NA	NA	NA	NA	NA
WP_083190481.1|836825_837890_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_066636592.1|837904_839317_-	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	36.9	8.0e-70
>prophage 68
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	854982	859572	3597394		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	2	NA	NA
WP_066636618.1|854982_857283_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	27.9	1.3e-37
WP_191090943.1|857463_859572_-	type IIA DNA topoisomerase subunit B	NA	G3M9Z3	Bacillus_virus	37.5	1.8e-105
>prophage 69
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	864371	869590	3597394		Cronobacter_phage(50.0%)	2	NA	NA
WP_066642723.1|864371_865517_-	DNA polymerase IV	NA	F1C5A5	Cronobacter_phage	27.9	1.0e-22
WP_157621925.1|865531_869590_-	DNA polymerase III subunit alpha	NA	A0A1C9LWS4	Streptomyces_phage	34.9	3.5e-78
>prophage 70
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	873773	875042	3597394		Lactobacillus_phage(100.0%)	1	NA	NA
WP_191090945.1|873773_875042_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	34.7	3.6e-21
>prophage 71
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	884418	888542	3597394		Catovirus(50.0%)	3	NA	NA
WP_066636667.1|884418_886221_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	22.3	1.1e-42
WP_066636670.1|886237_886597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083190486.1|886745_888542_+	DEDD exonuclease domain-containing protein	NA	A0A0N9SJX9	Paenibacillus_phage	32.4	7.7e-09
>prophage 72
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	894295	896374	3597394		Acinetobacter_phage(50.0%)	2	NA	NA
WP_066636691.1|894295_895378_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.8	6.8e-45
WP_066636694.1|895402_896374_+	quinone oxidoreductase	NA	A0A0K0KVL7	Prochlorococcus_phage	25.9	8.1e-05
>prophage 73
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	909574	911095	3597394		Mycoplasma_phage(100.0%)	1	NA	NA
WP_083190488.1|909574_911095_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.5	7.1e-40
>prophage 74
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	914573	918122	3597394		Chelonid_alphaherpesvirus(50.0%)	3	NA	NA
WP_066636732.1|914573_916250_-	serine/threonine protein kinase	NA	V5NWT4	Chelonid_alphaherpesvirus	31.1	1.8e-07
WP_066636735.1|916332_917025_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_066636737.1|917090_918122_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.0	4.8e-32
>prophage 75
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	930491	931853	3597394		Klosneuvirus(100.0%)	1	NA	NA
WP_083190490.1|930491_931853_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	29.0	3.4e-33
>prophage 76
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	938999	943112	3597394		Saccharomonospora_phage(100.0%)	1	NA	NA
WP_066636777.1|938999_943112_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	45.5	0.0e+00
>prophage 77
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	971695	974956	3597394		Cyanophage(50.0%)	2	NA	NA
WP_066636854.1|971695_973132_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.5	1.2e-76
WP_066636857.1|973246_974956_-	RNA polymerase sigma factor	NA	A0A2I7SAT0	Vibrio_phage	40.7	1.7e-42
>prophage 78
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	986359	987085	3597394		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_191090948.1|986359_987085_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	4.5e-16
>prophage 79
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	990196	999959	3597394	transposase	Planktothrix_phage(33.33%)	6	NA	NA
WP_083190495.1|990196_991039_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.7	8.5e-19
WP_083190497.1|991424_992960_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_066636906.1|992956_993757_+	ATP-binding protein	NA	A0A1B1IWL7	uncultured_Mediterranean_phage	31.1	2.7e-06
WP_066636908.1|993716_994493_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_066636911.1|995656_995902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_191090949.1|995918_999959_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.4	1.1e-44
>prophage 80
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1003834	1005568	3597394		Indivirus(100.0%)	1	NA	NA
WP_066636922.1|1003834_1005568_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1V0SDD5	Indivirus	30.5	1.3e-53
>prophage 81
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1008607	1009831	3597394		Bacillus_virus(100.0%)	1	NA	NA
WP_157621929.1|1008607_1009831_+	AAA family ATPase	NA	G3MAX6	Bacillus_virus	42.2	6.1e-50
>prophage 82
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1022530	1023004	3597394		Bacillus_phage(100.0%)	1	NA	NA
WP_066636951.1|1022530_1023004_-	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	52.6	3.1e-34
>prophage 83
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1029190	1031238	3597394		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_066636961.1|1029190_1030093_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	47.5	2.7e-63
WP_066636963.1|1030179_1031238_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	39.6	2.1e-59
>prophage 84
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1037886	1048684	3597394		Staphylococcus_phage(33.33%)	5	NA	NA
WP_083190503.1|1037886_1039494_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	6.0e-13
WP_066636980.1|1039523_1040681_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_066636981.1|1040711_1042115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066636988.1|1042227_1045293_-	DEAD/DEAH box helicase	NA	U3PFS7	Lactobacillus_phage	31.0	4.0e-34
WP_066636990.1|1045795_1048684_-	vitamin B12-dependent ribonucleotide reductase	NA	A0A0H3UYX6	Geobacillus_virus	37.5	3.1e-169
>prophage 85
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1062313	1064467	3597394		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_066637028.1|1062313_1064467_-	RecQ family ATP-dependent DNA helicase	NA	Q9DSV4	Diadromus_pulchellus_ascovirus	33.6	1.4e-41
>prophage 86
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1069081	1073387	3597394		Bacillus_phage(100.0%)	5	NA	NA
WP_066642781.1|1069081_1069801_+	transcriptional repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	47.8	1.2e-10
WP_066637041.1|1069904_1070237_-	PRC-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_066637043.1|1070281_1071172_-	NAD-dependent protein deacetylase 1	NA	NA	NA	NA	NA
WP_066637045.1|1071168_1072656_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.1e-24
WP_066637047.1|1072658_1073387_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.3	2.5e-35
>prophage 87
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1081059	1091081	3597394	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_066637051.1|1081059_1083987_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.5	2.4e-209
WP_066637053.1|1084211_1084478_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_066637061.1|1084709_1085987_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	28.9	5.1e-31
WP_066637063.1|1085983_1087402_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_066637065.1|1087424_1088402_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_066637067.1|1088398_1088839_-	DUF952 domain-containing protein	NA	NA	NA	NA	NA
WP_066637069.1|1088879_1091081_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	29.5	1.6e-61
>prophage 88
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1102574	1107876	3597394		Vibrio_phage(50.0%)	4	NA	NA
WP_066637102.1|1102574_1105265_+	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	39.5	1.6e-82
WP_066637105.1|1105277_1106072_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_191090950.1|1106100_1107303_-	amidohydrolase	NA	NA	NA	NA	NA
WP_010148753.1|1107627_1107876_+	WhiB family transcriptional regulator	NA	A0A2P1CGA4	Mycobacterium_phage	46.8	8.6e-12
>prophage 89
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1120744	1121479	3597394		Bacillus_phage(100.0%)	1	NA	NA
WP_083190512.1|1120744_1121479_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0N7ACL7	Bacillus_phage	35.5	6.1e-05
>prophage 90
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1131313	1136544	3597394		Bacillus_phage(66.67%)	4	NA	NA
WP_066637149.1|1131313_1132882_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.2	3.7e-23
WP_083190515.1|1132928_1133606_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.0	8.0e-44
WP_157621932.1|1133639_1135091_-	adenosylhomocysteinase	NA	NA	NA	NA	NA
WP_066642832.1|1135113_1136544_-	mycothione reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.4	6.3e-38
>prophage 91
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1149576	1149846	3597394		Mycobacterium_phage(100.0%)	1	NA	NA
WP_066637184.1|1149576_1149846_-	WhiB family transcriptional regulator	NA	A0A2P1CGA4	Mycobacterium_phage	76.4	5.5e-28
>prophage 92
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1156379	1160994	3597394		Streptococcus_phage(33.33%)	4	NA	NA
WP_066637206.1|1156379_1157615_+	LCP family protein	NA	A0A1X9I5X1	Streptococcus_phage	30.2	2.2e-15
WP_066637209.1|1157652_1159299_+	serine/threonine protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.8	3.5e-16
WP_066637212.1|1159288_1160449_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_083190813.1|1160505_1160994_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.3	9.3e-18
>prophage 93
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1187618	1188455	3597394		Kaumoebavirus(100.0%)	1	NA	NA
WP_066637277.1|1187618_1188455_-	Fpg/Nei family DNA glycosylase	NA	A0A1V0CNR6	Kaumoebavirus	28.4	4.7e-09
>prophage 94
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1204181	1204625	3597394		Anguillid_herpesvirus(100.0%)	1	NA	NA
WP_066637302.1|1204181_1204625_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	48.9	3.7e-29
>prophage 95
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1211607	1214964	3597394	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_066637317.1|1211607_1214964_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	32.6	1.2e-145
>prophage 96
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1221284	1223978	3597394	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_066637336.1|1221284_1223978_+|tRNA	valine--tRNA ligase	tRNA	A0A2K9KZB8	Tupanvirus	36.0	6.3e-156
>prophage 97
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1228986	1231796	3597394	protease	Agrobacterium_phage(66.67%)	3	NA	NA
WP_191090977.1|1228986_1230255_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.3	9.5e-147
WP_066642866.1|1230445_1231114_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	47.2	4.8e-41
WP_066637365.1|1231193_1231796_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.2	5.0e-45
>prophage 98
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1235960	1237004	3597394		Cronobacter_phage(100.0%)	1	NA	NA
WP_083190815.1|1235960_1237004_-	DNA polymerase IV	NA	F1C5A5	Cronobacter_phage	28.3	5.2e-18
>prophage 99
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1241189	1243748	3597394		Acinetobacter_phage(100.0%)	1	NA	NA
WP_066637386.1|1241189_1243748_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	28.2	1.7e-46
>prophage 100
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1269327	1273269	3597394		Clostridium_phage(100.0%)	1	NA	NA
WP_191090951.1|1269327_1273269_+	cell wall-binding repeat-containing protein	NA	A0A0A8WJG0	Clostridium_phage	28.9	3.1e-10
>prophage 101
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1276613	1278296	3597394		Tupanvirus(100.0%)	1	NA	NA
WP_066637455.1|1276613_1278296_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	28.3	6.9e-44
>prophage 102
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1285373	1285985	3597394		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_066637474.1|1285373_1285985_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	36.5	3.0e-29
>prophage 103
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1290579	1294523	3597394		Emiliania_huxleyi_virus(50.0%)	3	NA	NA
WP_066637484.1|1290579_1291773_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	23.8	8.4e-20
WP_066637487.1|1291860_1292331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066637490.1|1292525_1294523_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	31.6	1.6e-63
>prophage 104
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1310474	1312037	3597394		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_066642899.1|1310474_1312037_-	inorganic phosphate transporter	NA	M4QMY4	Ostreococcus_lucimarinus_virus	30.5	9.9e-37
>prophage 105
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1320288	1324705	3597394		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_157621752.1|1320288_1321212_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	6.9e-22
WP_066637566.1|1321208_1321727_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_191090955.1|1321867_1324705_-	cell wall-binding repeat-containing protein	NA	A0A1B0T6A2	Bacillus_phage	28.1	2.5e-06
>prophage 106
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1333497	1335666	3597394		Ralstonia_phage(100.0%)	1	NA	NA
WP_083190531.1|1333497_1335666_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	36.4	2.2e-103
>prophage 107
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1374078	1375047	3597394		Oenococcus_phage(100.0%)	1	NA	NA
WP_066642926.1|1374078_1375047_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	39.7	3.3e-51
>prophage 108
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1390236	1394666	3597394		Aeromonas_phage(33.33%)	4	NA	NA
WP_191090978.1|1390236_1391487_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	45.8	2.8e-82
WP_066637744.1|1391548_1392412_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	36.7	5.3e-16
WP_066637746.1|1392735_1393590_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_066637747.1|1393586_1394666_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	40.3	3.1e-05
>prophage 109
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1403144	1408417	3597394		Tupanvirus(50.0%)	4	NA	NA
WP_066637772.1|1403144_1404875_+	SelB C-terminal domain-containing protein	NA	A0A2K9KZ60	Tupanvirus	25.8	2.3e-10
WP_066637775.1|1404885_1405914_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_066637778.1|1405941_1407366_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_066637781.1|1407451_1408417_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.5	2.3e-28
>prophage 110
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1419199	1420366	3597394		Yellowstone_lake_mimivirus(100.0%)	1	NA	NA
WP_066637809.1|1419199_1420366_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.7	1.7e-25
>prophage 111
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1423837	1432324	3597394		Cronobacter_phage(33.33%)	9	NA	NA
WP_066642939.1|1423837_1424845_+	TerC/Alx family metal homeostasis membrane protein	NA	K4F9T9	Cronobacter_phage	39.1	9.5e-41
WP_066642942.1|1425041_1426724_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_066637818.1|1426882_1427341_-	VOC family protein	NA	NA	NA	NA	NA
WP_066637821.1|1427350_1427632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083190541.1|1427628_1428159_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	50.8	2.6e-29
WP_083190542.1|1428121_1428559_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_066637823.1|1428555_1430049_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_066637825.1|1430050_1430428_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_066637827.1|1430464_1432324_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	36.0	7.0e-98
>prophage 112
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1436706	1440253	3597394		Streptomyces_phage(33.33%)	3	NA	NA
WP_191090956.1|1436706_1437648_-	lytic transglycosylase domain-containing protein	NA	A0A2L1IVL5	Streptomyces_phage	59.0	2.0e-29
WP_157621939.1|1437896_1439204_-	PhoH family protein	NA	M4R2C8	Vibrio_phage	29.0	1.8e-36
WP_066637838.1|1439488_1440253_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	37.5	3.0e-15
>prophage 113
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1453271	1454606	3597394		Hokovirus(100.0%)	1	NA	NA
WP_066637877.1|1453271_1454606_+	Gfo/Idh/MocA family oxidoreductase	NA	A0A1V0SGE7	Hokovirus	33.1	4.7e-11
>prophage 114
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1473963	1475244	3597394		Streptococcus_phage(100.0%)	1	NA	NA
WP_066637924.1|1473963_1475244_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	56.5	2.9e-135
>prophage 115
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1488718	1489699	3597394		Tupanvirus(100.0%)	1	NA	NA
WP_066637960.1|1488718_1489699_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.8	8.6e-47
>prophage 116
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1494231	1499065	3597394		Staphylococcus_phage(50.0%)	3	NA	NA
WP_066637973.1|1494231_1495197_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	3.7e-18
WP_083190546.1|1495193_1496891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066637976.1|1497196_1499065_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	24.0	3.3e-31
>prophage 117
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1502165	1503998	3597394	tRNA	Indivirus(100.0%)	1	NA	NA
WP_066637984.1|1502165_1503998_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	28.1	1.8e-58
>prophage 118
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1508566	1511580	3597394		Mycobacterium_phage(50.0%)	4	NA	NA
WP_191090960.1|1508566_1509271_-	peptidoglycan-binding protein	NA	A0A0A7S2A2	Mycobacterium_phage	47.0	2.6e-05
WP_066637999.1|1509603_1510215_+	DUF4126 domain-containing protein	NA	NA	NA	NA	NA
WP_066638007.1|1510205_1510646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066638010.1|1510734_1511580_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	37.9	7.2e-42
>prophage 119
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1548240	1549116	3597394		Actinomyces_phage(100.0%)	1	NA	NA
WP_066638079.1|1548240_1549116_-	C40 family peptidase	NA	A0A2P1CIC9	Actinomyces_phage	44.7	2.7e-15
>prophage 120
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1556139	1558566	3597394		Lactococcus_phage(50.0%)	2	NA	NA
WP_066638106.1|1556139_1556541_-	cold shock domain-containing protein	NA	Q9AZD3	Lactococcus_phage	47.6	1.1e-08
WP_083190552.1|1556664_1558566_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	7.1e-37
>prophage 121
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1571367	1573875	3597394		Agrobacterium_phage(100.0%)	1	NA	NA
WP_066638147.1|1571367_1573875_-	polynucleotide kinase-phosphatase	NA	A0A2L0UZN4	Agrobacterium_phage	26.0	4.5e-23
>prophage 122
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1584063	1590948	3597394		Tupanvirus(25.0%)	7	NA	NA
WP_066638175.1|1584063_1585251_-	acetoin utilization protein AcuC	NA	A0A2K9L4C2	Tupanvirus	28.2	1.7e-12
WP_066638178.1|1585283_1585823_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_083190555.1|1585900_1586704_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	33.2	4.3e-28
WP_066638181.1|1586710_1587676_-	proline dehydrogenase family protein	NA	A0A2H4PQT6	Staphylococcus_phage	31.6	4.4e-35
WP_066638184.1|1587709_1588525_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_066642984.1|1588521_1589448_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_066638187.1|1589529_1590948_+	DNA repair protein RadA	NA	A0A0R8V1H3	Thermobifida_phage	26.1	1.1e-05
>prophage 123
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1596088	1606361	3597394	tRNA,protease	Mycobacterium_phage(28.57%)	9	NA	NA
WP_191090963.1|1596088_1597567_-	SH3 domain-containing protein	NA	A0A2P1CIC9	Actinomyces_phage	42.0	1.1e-13
WP_066638206.1|1598018_1600544_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	41.0	9.7e-135
WP_066638211.1|1600711_1601653_-	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	42.1	3.8e-44
WP_066638218.1|1601671_1602658_+	non-homologous end-joining DNA ligase	NA	A0A291AUP8	Sinorhizobium_phage	34.1	4.6e-32
WP_066638221.1|1602654_1603503_+	non-homologous end-joining DNA ligase	NA	NA	NA	NA	NA
WP_066638224.1|1603589_1603922_-	Lsr2 family protein	NA	A0A222ZMT6	Mycobacterium_phage	45.1	4.7e-13
WP_066642985.1|1604070_1604256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066638234.1|1604282_1605785_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	35.0	1.5e-69
WP_066638242.1|1605854_1606361_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.9	4.8e-25
>prophage 124
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1615449	1620580	3597394	protease	Pandoravirus(25.0%)	5	NA	NA
WP_066643000.1|1615449_1616268_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	4.2e-23
WP_083190559.1|1616300_1616975_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	52.2	1.8e-43
WP_066643001.1|1616952_1618950_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	41.1	2.9e-105
WP_066638263.1|1619216_1620038_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_066638265.1|1620028_1620580_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	29.7	2.8e-10
>prophage 125
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1624528	1625047	3597394		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_066643009.1|1624528_1625047_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	44.2	3.3e-29
>prophage 126
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1628635	1642691	3597394		Streptococcus_virus(25.0%)	10	NA	NA
WP_066638278.1|1628635_1629799_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	27.2	3.9e-06
WP_066638281.1|1629795_1630458_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	39.9	4.0e-32
WP_066638284.1|1630525_1631152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066643011.1|1631264_1632038_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_066638287.1|1632081_1632591_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_066638290.1|1632672_1637796_-	cell wall-binding repeat-containing protein	NA	A0A217EQY2	Bacillus_phage	29.6	2.3e-13
WP_191090964.1|1637768_1638002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083190561.1|1638065_1638587_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066638301.1|1638755_1639961_+	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_066638302.1|1639988_1642691_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	32.2	6.4e-100
>prophage 127
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1647563	1649897	3597394		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_066638308.1|1647563_1649897_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	27.1	1.4e-10
>prophage 128
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1664677	1667553	3597394		Xanthomonas_phage(50.0%)	3	NA	NA
WP_066638365.1|1664677_1665142_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.0	7.0e-15
WP_066638366.1|1665146_1666097_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_083190564.1|1666110_1667553_-	ATP-binding protein	NA	R4TQL5	Phaeocystis_globosa_virus	28.7	6.4e-14
>prophage 129
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1676693	1679006	3597394		Bacteriophage(100.0%)	1	NA	NA
WP_066638399.1|1676693_1679006_-	DNA polymerase III subunit gamma and tau	NA	A0A1L2BWV7	Bacteriophage	34.0	1.2e-43
>prophage 130
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1683956	1688861	3597394		Mollivirus(50.0%)	2	NA	NA
WP_066638409.1|1683956_1684904_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.5	7.3e-35
WP_066638411.1|1684934_1688861_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.5	4.6e-123
>prophage 131
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1694494	1695802	3597394		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_066638431.1|1694494_1695802_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	35.1	5.0e-66
>prophage 132
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1705658	1706207	3597394		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_066643025.1|1705658_1706207_-	orotate phosphoribosyltransferase	NA	Q58MW1	Prochlorococcus_phage	39.3	1.4e-17
>prophage 133
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1715096	1727020	3597394		Salmonella_phage(20.0%)	10	NA	NA
WP_066638491.1|1715096_1715975_+	ribonuclease HI family protein	NA	J9Q745	Salmonella_phage	44.4	8.6e-22
WP_083190568.1|1715941_1717789_-	MFS transporter	NA	NA	NA	NA	NA
WP_083190569.1|1717788_1718529_-	LppX_LprAFG lipoprotein	NA	NA	NA	NA	NA
WP_066638497.1|1718598_1719378_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.2	4.5e-14
WP_066638500.1|1719416_1720556_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_066638502.1|1720555_1721530_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_066638504.1|1721635_1722745_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4SND3	Cyanophage	31.4	4.6e-20
WP_066638507.1|1722951_1725522_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.6	6.7e-123
WP_066638510.1|1725642_1726446_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_066638513.1|1726504_1727020_+	O-acetyl-ADP-ribose deacetylase	NA	E2CTW8	Turbot_reddish_body_iridovirus	45.1	1.2e-26
>prophage 134
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1734527	1738322	3597394		Catovirus(50.0%)	3	NA	NA
WP_066638524.1|1734527_1735604_-	DnaJ domain-containing protein	NA	A0A1V0SBY2	Catovirus	44.0	2.9e-11
WP_066638525.1|1735728_1736409_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_066638528.1|1736405_1738322_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.4	1.8e-136
>prophage 135
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1742315	1746268	3597394		Catovirus(50.0%)	4	NA	NA
WP_066638538.1|1742315_1743857_-	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0S9J5	Catovirus	28.2	5.0e-41
WP_157621773.1|1744095_1744248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191090966.1|1744384_1745221_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_066638542.1|1745230_1746268_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	48.2	7.4e-65
>prophage 136
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1759235	1768069	3597394		uncultured_Mediterranean_phage(66.67%)	5	NA	NA
WP_066638567.1|1759235_1761668_+	excinuclease ABC subunit A	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	30.6	5.0e-120
WP_083190574.1|1761868_1763644_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_191090967.1|1763660_1765454_+	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	22.4	2.5e-12
WP_157621776.1|1765953_1766586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066636906.1|1767268_1768069_-	ATP-binding protein	NA	A0A1B1IWL7	uncultured_Mediterranean_phage	31.1	2.7e-06
>prophage 137
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1778181	1782584	3597394		Acanthamoeba_polyphaga_moumouvirus(50.0%)	5	NA	NA
WP_066638590.1|1778181_1779084_-	NAD(P)-dependent oxidoreductase	NA	L7RCI0	Acanthamoeba_polyphaga_moumouvirus	23.6	2.1e-07
WP_066638593.1|1779138_1779729_+	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_066638594.1|1779965_1780181_+	DUF4177 domain-containing protein	NA	NA	NA	NA	NA
WP_066643044.1|1780791_1781700_+	arginase family protein	NA	NA	NA	NA	NA
WP_066638595.1|1781669_1782584_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.6	5.4e-51
>prophage 138
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1808357	1812253	3597394		Planktothrix_phage(50.0%)	5	NA	NA
WP_066638659.1|1808357_1809077_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	2.0e-32
WP_066638662.1|1809169_1809937_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_066643051.1|1809933_1810416_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_066638665.1|1810578_1811187_+	RDD family protein	NA	NA	NA	NA	NA
WP_066638668.1|1811236_1812253_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	45.3	4.0e-79
>prophage 139
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1816329	1822574	3597394		Bacillus_phage(50.0%)	5	NA	NA
WP_066638696.1|1816329_1819830_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.1	2.6e-05
WP_066638698.1|1819839_1820181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157621942.1|1820209_1820719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157621783.1|1820784_1821033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066638706.1|1821125_1822574_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	39.4	2.9e-83
>prophage 140
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1826166	1828383	3597394		uncultured_virus(100.0%)	1	NA	NA
WP_066638720.1|1826166_1828383_+	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	32.7	1.3e-82
>prophage 141
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1837330	1838032	3597394		Planktothrix_phage(100.0%)	1	NA	NA
WP_066638745.1|1837330_1838032_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	27.7	2.3e-17
>prophage 142
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1841712	1844581	3597394	tRNA,transposase	Staphylococcus_phage(50.0%)	2	NA	NA
WP_191090983.1|1841712_1842780_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.6	3.6e-30
WP_066638766.1|1843300_1844581_-|tRNA	serine--tRNA ligase	tRNA	A0A2I2L4X3	Orpheovirus	32.7	3.9e-55
>prophage 143
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1860031	1867617	3597394		Mycobacterium_phage(33.33%)	8	NA	NA
WP_066643072.1|1860031_1860547_-	SprT-like domain-containing protein	NA	S5Y6H4	Mycobacterium_phage	44.6	9.8e-26
WP_066638801.1|1860601_1860988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083190582.1|1861006_1862788_+	NAD-binding protein	NA	NA	NA	NA	NA
WP_191090886.1|1862822_1863350_-	DUF3806 domain-containing protein	NA	NA	NA	NA	NA
WP_083190583.1|1863414_1865397_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	31.7	1.7e-62
WP_066638805.1|1865446_1865950_+	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_066638809.1|1866081_1866573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066638813.1|1866765_1867617_-	transglycosylase family protein	NA	A0A2I6B0Z0	Macacine_betaherpesvirus	52.8	2.6e-23
>prophage 144
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1871097	1875789	3597394		Bacillus_phage(100.0%)	1	NA	NA
WP_066638830.1|1871097_1875789_-	cell division-like protein	NA	A0A217ERB2	Bacillus_phage	32.0	6.2e-18
>prophage 145
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1897549	1900264	3597394		Clostridium_phage(100.0%)	1	NA	NA
WP_083190585.1|1897549_1900264_+	cell wall-binding repeat-containing protein	NA	A0A0A8WJG0	Clostridium_phage	25.7	4.1e-06
>prophage 146
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1912607	1913669	3597394		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_066638917.1|1912607_1913669_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	29.2	9.4e-07
>prophage 147
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1916673	1917918	3597394		Tupanvirus(100.0%)	1	NA	NA
WP_066638930.1|1916673_1917918_-	class I SAM-dependent methyltransferase	NA	A0A2K9L0U7	Tupanvirus	30.3	2.6e-32
>prophage 148
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1933229	1934030	3597394		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_066638978.1|1933229_1934030_+	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.6	4.0e-18
>prophage 149
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1937635	1938487	3597394		Kaumoebavirus(100.0%)	1	NA	NA
WP_066639000.1|1937635_1938487_+	formamidopyrimidine-DNA glycosylase	NA	A0A1V0CNR6	Kaumoebavirus	30.0	6.8e-08
>prophage 150
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1950492	1952007	3597394		Staphylococcus_phage(100.0%)	1	NA	NA
WP_066639027.1|1950492_1952007_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.9	4.4e-34
>prophage 151
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1956337	1957867	3597394		Rhizobium_phage(100.0%)	1	NA	NA
WP_066639048.1|1956337_1957867_-	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	28.5	9.4e-16
>prophage 152
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1964597	1972242	3597394		Bacillus_phage(100.0%)	3	NA	NA
WP_066639064.1|1964597_1968281_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	29.9	7.6e-11
WP_066639066.1|1968517_1970251_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.1e-31
WP_066639073.1|1970247_1972242_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	1.3e-44
>prophage 153
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1975847	1976789	3597394		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_066643103.1|1975847_1976789_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.1	6.4e-23
>prophage 154
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	1994457	2001492	3597394		Klosneuvirus(33.33%)	5	NA	NA
WP_066639102.1|1994457_1996125_+	FAD-dependent oxidoreductase	NA	A0A1V0SIN1	Klosneuvirus	27.7	6.6e-23
WP_066639105.1|1996152_1997073_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_066639112.1|1997203_1997641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066639115.1|1997736_1999023_-	serine hydrolase	NA	A0A2K9VHZ2	Mycobacterium_phage	26.8	3.2e-17
WP_066639118.1|1999134_2001492_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	32.7	8.3e-88
>prophage 155
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2005087	2006716	3597394		Gordonia_phage(50.0%)	2	NA	NA
WP_066639134.1|2005087_2006122_-	SGNH/GDSL hydrolase family protein	NA	A0A160DD06	Gordonia_phage	27.9	3.9e-13
WP_083190595.1|2006149_2006716_-	methyltransferase domain-containing protein	NA	A0A1J0MC50	Streptomyces_phage	40.7	8.0e-13
>prophage 156
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2025770	2030466	3597394	protease	Marseillevirus(50.0%)	5	NA	NA
WP_083190597.1|2025770_2027843_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A2R3ZRI5	Marseillevirus	29.2	5.9e-13
WP_066639190.1|2027879_2028623_-	DUF881 domain-containing protein	NA	NA	NA	NA	NA
WP_066639193.1|2028680_2028944_+	cell division protein CrgA	NA	NA	NA	NA	NA
WP_083190598.1|2029010_2029931_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_066639195.1|2029947_2030466_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	42.0	9.9e-18
>prophage 157
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2047487	2060440	3597394		Brazilian_cedratvirus(20.0%)	11	NA	NA
WP_066639241.1|2047487_2048414_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	1.4e-17
WP_066639250.1|2048410_2049265_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_066639253.1|2049269_2049506_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066639256.1|2049580_2050477_+	universal stress protein	NA	NA	NA	NA	NA
WP_083190849.1|2050490_2051090_-	DUF3566 domain-containing protein	NA	NA	NA	NA	NA
WP_066639262.1|2051242_2053945_-	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	29.0	3.6e-87
WP_066643167.1|2054028_2056143_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	40.2	2.8e-127
WP_066643170.1|2056433_2056919_-	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_066639265.1|2056990_2058235_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_066639268.1|2058279_2059260_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4QGJ9	Cyanophage	40.1	2.9e-58
WP_066639271.1|2059306_2060440_-	DNA polymerase III subunit beta	NA	A0A286N319	Arthrobacter_phage	32.7	1.9e-45
>prophage 158
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2066145	2069793	3597394		Leptospira_phage(25.0%)	4	NA	NA
WP_066639289.1|2066145_2067258_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	30.2	3.1e-08
WP_191090985.1|2067254_2068028_-	ParA family protein	NA	Q8JL10	Natrialba_phage	35.7	8.7e-18
WP_066639292.1|2068426_2068750_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	46.5	1.1e-19
WP_066639294.1|2068746_2069793_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	47.1	6.6e-69
>prophage 159
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2078264	2082629	3597394	tRNA	Mycobacterium_phage(50.0%)	3	NA	NA
WP_066639307.1|2078264_2079740_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A249XS88	Mycobacterium_phage	35.0	8.4e-54
WP_066639309.1|2079732_2080329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066639311.1|2080325_2082629_+	acyltransferase	NA	A0A166XZF2	Gordonia_phage	30.8	4.8e-64
>prophage 160
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2086263	2087331	3597394		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_066639318.1|2086263_2087331_+	inositol-3-phosphate synthase	NA	A0A0H4IPK5	Stenotrophomonas_phage	44.6	1.4e-74
>prophage 161
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2093368	2094475	3597394		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_066639336.1|2093368_2094475_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	37.6	3.6e-57
>prophage 162
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2103500	2105495	3597394		Catovirus(100.0%)	1	NA	NA
WP_066639354.1|2103500_2105495_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	28.6	2.8e-12
>prophage 163
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2114418	2120894	3597394		Paramecium_bursaria_Chlorella_virus(33.33%)	8	NA	NA
WP_066639377.1|2114418_2115585_-	nucleotide sugar dehydrogenase	NA	M1HZB2	Paramecium_bursaria_Chlorella_virus	53.7	1.4e-112
WP_066639380.1|2115883_2116171_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_066639382.1|2116232_2116850_+	single-stranded DNA-binding protein	NA	A0A222ZFS3	Arthrobacter_phage	71.2	9.2e-47
WP_066639385.1|2116937_2117174_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_066639388.1|2117200_2117650_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_066639398.1|2117800_2118835_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_066639400.1|2118834_2119611_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_066639402.1|2119616_2120894_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.9	3.5e-08
>prophage 164
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2130928	2136324	3597394		Planktothrix_phage(50.0%)	4	NA	NA
WP_066639416.1|2130928_2133586_+	replicative DNA helicase	NA	G9BWB0	Planktothrix_phage	52.1	9.0e-22
WP_083190608.1|2133807_2134671_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_157621797.1|2134739_2135438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066639419.1|2135478_2136324_-	hypothetical protein	NA	B5WZL1	Staphylococcus_phage	29.5	1.5e-26
>prophage 165
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2145787	2146771	3597394		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_066643186.1|2145787_2146771_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	28.8	6.5e-18
>prophage 166
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2151179	2156189	3597394	transposase	Erysipelothrix_phage(50.0%)	3	NA	NA
WP_066639474.1|2151179_2152532_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.2	1.4e-39
WP_083190497.1|2153856_2155392_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_066636906.1|2155388_2156189_+	ATP-binding protein	NA	A0A1B1IWL7	uncultured_Mediterranean_phage	31.1	2.7e-06
>prophage 167
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2162563	2169678	3597394		Escherichia_phage(50.0%)	4	NA	NA
WP_066639485.1|2162563_2163364_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	42.8	3.0e-45
WP_066639488.1|2163728_2165171_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_066639496.1|2165203_2166262_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_066639498.1|2166258_2169678_+	thiol reductant ABC exporter subunit CydD	NA	F2Y1V6	Organic_Lake_phycodnavirus	24.3	4.1e-11
>prophage 168
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2187567	2192101	3597394		Streptococcus_phage(50.0%)	3	NA	NA
WP_083190618.1|2187567_2189544_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.7	1.2e-92
WP_191090892.1|2189874_2190288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066639538.1|2190733_2192101_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.0	3.9e-37
>prophage 169
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2219905	2223613	3597394		Diadromus_pulchellus_ascovirus(33.33%)	3	NA	NA
WP_066639636.1|2219905_2220766_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	42.4	4.3e-50
WP_083190626.1|2220799_2223001_-	catalase	NA	A0A2K9L0T1	Tupanvirus	44.7	1.6e-125
WP_066639638.1|2223124_2223613_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.8	1.6e-22
>prophage 170
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2231146	2231635	3597394		Molluscum_contagiosum_virus(100.0%)	1	NA	NA
WP_066643214.1|2231146_2231635_-	glutathione peroxidase	NA	A0A1S7DLQ4	Molluscum_contagiosum_virus	36.7	2.5e-15
>prophage 171
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2235716	2237222	3597394		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_066639668.1|2235716_2237222_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	52.9	5.3e-120
>prophage 172
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2250954	2251257	3597394		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_066639711.1|2250954_2251257_-	YrhK family protein	NA	A0A2H4IYD3	uncultured_Caudovirales_phage	49.3	4.6e-15
>prophage 173
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2271648	2274604	3597394		Streptomyces_phage(50.0%)	4	NA	NA
WP_066639771.1|2271648_2272824_-	DUF2786 domain-containing protein	NA	A0A291LHS8	Streptomyces_phage	30.7	4.1e-11
WP_066639774.1|2273109_2273595_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_066639777.1|2273685_2273874_+	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_066639780.1|2273971_2274604_+	sulfotransferase family 2 domain-containing protein	NA	A0A0E3HRE0	Synechococcus_phage	36.2	1.0e-24
>prophage 174
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2292968	2295249	3597394		Brochothrix_phage(50.0%)	2	NA	NA
WP_157621950.1|2292968_2294012_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	25.5	1.2e-19
WP_066639832.1|2294025_2295249_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	36.3	3.0e-41
>prophage 175
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2317246	2326587	3597394		Actinomyces_phage(25.0%)	8	NA	NA
WP_191090986.1|2317246_2317798_-	C40 family peptidase	NA	A0A2P1CIC9	Actinomyces_phage	43.9	4.9e-15
WP_022926324.1|2319176_2319755_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_066639886.1|2319833_2322149_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.9	5.7e-89
WP_066639889.1|2322138_2323134_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_066639891.1|2323135_2323348_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_066639897.1|2323451_2324852_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	40.9	3.3e-52
WP_157621953.1|2325040_2325580_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_066639908.1|2325783_2326587_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	43.2	6.0e-46
>prophage 176
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2333778	2335152	3597394		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_066639919.1|2333778_2335152_+	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	28.6	1.9e-52
>prophage 177
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2347899	2348730	3597394		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_157621956.1|2347899_2348730_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	27.2	1.6e-09
>prophage 178
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2353269	2353542	3597394		Bacillus_phage(100.0%)	1	NA	NA
WP_066639965.1|2353269_2353542_+	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	55.1	3.7e-16
>prophage 179
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2357304	2358228	3597394		Indivirus(100.0%)	1	NA	NA
WP_066639982.1|2357304_2358228_+	cation transporter	NA	A0A1V0SED0	Indivirus	32.8	5.3e-06
>prophage 180
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2369467	2374736	3597394		Staphylococcus_phage(50.0%)	3	NA	NA
WP_066640029.1|2369467_2371204_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	34.3	3.3e-57
WP_066640031.1|2371299_2374047_-	DUF4173 domain-containing protein	NA	NA	NA	NA	NA
WP_066640033.1|2374043_2374736_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	1.7e-28
>prophage 181
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2377746	2378781	3597394		Tupanvirus(100.0%)	1	NA	NA
WP_066640040.1|2377746_2378781_-	saccharopine dehydrogenase	NA	A0A2K9L078	Tupanvirus	35.1	2.2e-53
>prophage 182
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2388684	2390319	3597394		Mycobacterium_phage(100.0%)	1	NA	NA
WP_083190642.1|2388684_2390319_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	27.5	1.0e-31
>prophage 183
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2398726	2400490	3597394		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_066640106.1|2398726_2400490_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	26.8	9.1e-39
>prophage 184
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2411485	2415405	3597394	transposase	Gordonia_phage(66.67%)	4	NA	NA
WP_066640171.1|2411485_2411914_+	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	37.7	1.4e-14
WP_157621820.1|2412268_2414086_+	DNRLRE domain-containing protein	NA	NA	NA	NA	NA
WP_066640175.1|2414107_2414431_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	47.6	2.6e-16
WP_157621821.1|2414385_2415405_+|transposase	IS3 family transposase	transposase	A0A160DCU2	Gordonia_phage	44.6	9.8e-70
>prophage 185
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2418957	2427869	3597394		Acinetobacter_phage(50.0%)	6	NA	NA
WP_083190645.1|2418957_2420457_+	FAD binding domain-containing protein	NA	A0A0P0IVM8	Acinetobacter_phage	36.2	3.8e-70
WP_083190646.1|2420453_2422886_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	47.2	4.6e-190
WP_066640182.1|2422887_2423715_+	xanthine dehydrogenase accessory protein XdhC	NA	NA	NA	NA	NA
WP_066640184.1|2423711_2425070_+	guanine deaminase	NA	NA	NA	NA	NA
WP_157621957.1|2425293_2426601_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	34.0	2.8e-53
WP_083190648.1|2426654_2427869_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.4	4.1e-38
>prophage 186
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2431732	2433703	3597394		Staphylococcus_phage(100.0%)	1	NA	NA
WP_066640196.1|2431732_2433703_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.3	4.7e-84
>prophage 187
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2470221	2473195	3597394		Anomala_cuprea_entomopoxvirus(50.0%)	3	NA	NA
WP_066640293.1|2470221_2471067_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.8	5.6e-10
WP_066640296.1|2471063_2472149_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_066640299.1|2472145_2473195_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.5	1.7e-08
>prophage 188
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2477201	2478221	3597394		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_066640311.1|2477201_2478221_-	ATP-dependent 6-phosphofructokinase	NA	H8ZJH0	Ostreococcus_tauri_virus	25.9	1.4e-12
>prophage 189
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2485730	2487095	3597394		Cyanophage(100.0%)	1	NA	NA
WP_066640333.1|2485730_2487095_+	glucose-6-phosphate dehydrogenase	NA	M4SJ15	Cyanophage	33.1	3.0e-53
>prophage 190
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2498146	2500213	3597394		Klosneuvirus(100.0%)	1	NA	NA
WP_066640352.1|2498146_2500213_-	M3 family metallopeptidase	NA	A0A1V0SIU1	Klosneuvirus	20.7	2.7e-18
>prophage 191
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2510762	2511440	3597394		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_066640391.1|2510762_2511440_+	biliverdin-producing heme oxygenase	NA	Q58M64	Prochlorococcus_phage	33.8	8.7e-22
>prophage 192
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2515383	2517069	3597394		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_066640401.1|2515383_2517069_+	FAD-binding dehydrogenase	NA	M1HTN0	Paramecium_bursaria_Chlorella_virus	53.3	2.0e-06
>prophage 193
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2531972	2536982	3597394		Iris_mild_mosaic_virus(50.0%)	3	NA	NA
WP_066640475.1|2531972_2534522_-	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	3.0e-14
WP_083190863.1|2534493_2535648_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_066640479.1|2535809_2536982_+	RtcB family protein	NA	A0A1X9SHH2	Mycobacterium_phage	61.0	3.0e-123
>prophage 194
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2544567	2546175	3597394		Catovirus(100.0%)	1	NA	NA
WP_066643329.1|2544567_2546175_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.2	3.7e-71
>prophage 195
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2561400	2562156	3597394		Planktothrix_phage(100.0%)	1	NA	NA
WP_066640564.1|2561400_2562156_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	1.2e-35
>prophage 196
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2565613	2567575	3597394		Virus_Rctr197k(100.0%)	1	NA	NA
WP_066643346.1|2565613_2567575_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.3	4.7e-20
>prophage 197
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2594121	2599214	3597394		Mycobacterium_phage(50.0%)	5	NA	NA
WP_066640625.1|2594121_2594514_-	PIN domain-containing protein	NA	V5UQI8	Mycobacterium_phage	34.9	1.8e-11
WP_066640628.1|2594510_2594774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066643356.1|2594937_2595870_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_157621830.1|2595884_2596661_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066640635.1|2597072_2599214_-	acyltransferase	NA	A0A166XZF2	Gordonia_phage	36.5	7.3e-99
>prophage 198
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2605917	2606583	3597394		Feldmannia_irregularis_virus(100.0%)	1	NA	NA
WP_022925721.1|2605917_2606583_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	35.4	7.2e-05
>prophage 199
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2614934	2615378	3597394		Hokovirus(100.0%)	1	NA	NA
WP_066643359.1|2614934_2615378_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	32.6	3.4e-11
>prophage 200
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2619422	2625779	3597394		Streptomyces_phage(100.0%)	1	NA	NA
WP_066640674.1|2619422_2625779_+	PKD domain-containing protein	NA	A0A2P1N0I0	Streptomyces_phage	31.5	5.9e-11
>prophage 201
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2633817	2635715	3597394		Escherichia_phage(50.0%)	2	NA	NA
WP_066640687.1|2633817_2634687_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	58.0	1.0e-91
WP_066640689.1|2634689_2635715_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	44.2	6.6e-74
>prophage 202
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2639692	2643370	3597394		Tupanvirus(50.0%)	3	NA	NA
WP_157621837.1|2639692_2640787_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	46.7	4.6e-33
WP_066640705.1|2640815_2641619_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_083190670.1|2641615_2643370_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.8e-10
>prophage 203
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2649943	2651074	3597394		Catovirus(100.0%)	1	NA	NA
WP_157621958.1|2649943_2651074_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.1	4.2e-21
>prophage 204
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2664950	2667754	3597394		Stenotrophomonas_phage(50.0%)	2	NA	NA
WP_066640757.1|2664950_2666087_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	A0A2D2W2B8	Stenotrophomonas_phage	26.8	1.9e-13
WP_066643363.1|2666083_2667754_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	31.0	2.9e-26
>prophage 205
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2680328	2681417	3597394		Bacillus_virus(100.0%)	1	NA	NA
WP_066640778.1|2680328_2681417_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.1e-25
>prophage 206
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2687072	2687747	3597394		Bacillus_phage(100.0%)	1	NA	NA
WP_066640785.1|2687072_2687747_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.8	6.2e-28
>prophage 207
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2691699	2693439	3597394		Bacillus_phage(100.0%)	1	NA	NA
WP_066643366.1|2691699_2693439_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	8.7e-42
>prophage 208
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2699301	2700393	3597394		Pacmanvirus(100.0%)	1	NA	NA
WP_066640801.1|2699301_2700393_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.0	9.7e-15
>prophage 209
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2720324	2722200	3597394		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_066640837.1|2720324_2721359_+	ABC transporter ATP-binding protein	NA	M1I4Q1	Paramecium_bursaria_Chlorella_virus	25.5	6.6e-05
WP_066640840.1|2721351_2722200_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.6	9.8e-15
>prophage 210
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2728139	2743331	3597394		Synechococcus_phage(14.29%)	16	NA	NA
WP_083190871.1|2728139_2729135_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	38.6	2.4e-12
WP_066640857.1|2729195_2729966_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	40.3	1.2e-08
WP_066640858.1|2729962_2731600_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.0	4.2e-30
WP_066640860.1|2731664_2732987_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_066640862.1|2733011_2733377_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_066640864.1|2733542_2734124_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	65.8	8.6e-71
WP_066640866.1|2734128_2736450_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_191090908.1|2736580_2737516_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	54.0	1.8e-86
WP_066640872.1|2737518_2738142_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_066640873.1|2738230_2738578_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_066640874.1|2738672_2739062_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_066640876.1|2739065_2739329_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_066640880.1|2739703_2739907_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	57.4	7.5e-14
WP_066640882.1|2740007_2741606_-	LCP family protein	NA	NA	NA	NA	NA
WP_066640883.1|2741875_2742091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066640888.1|2742368_2743331_-	D-glycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	28.0	4.0e-20
>prophage 211
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2748288	2748906	3597394		Synechococcus_phage(100.0%)	1	NA	NA
WP_083190872.1|2748288_2748906_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.2	2.3e-13
>prophage 212
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2753301	2758343	3597394		uncultured_Caudovirales_phage(50.0%)	6	NA	NA
WP_066640910.1|2753301_2754831_-	serine hydrolase	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	27.4	6.5e-09
WP_083190681.1|2754935_2755355_-	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_066640911.1|2755407_2755884_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_157621841.1|2755880_2756402_-	LytR C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_066640917.1|2756429_2756741_-	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_066640921.1|2756765_2758343_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	41.8	1.2e-66
>prophage 213
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2766243	2772578	3597394		uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_066640948.1|2766243_2767824_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	29.9	2.6e-45
WP_066640949.1|2768103_2769093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066640951.1|2769191_2770316_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	38.0	1.6e-57
WP_066640953.1|2770285_2770816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066640955.1|2770840_2771089_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_066640957.1|2771231_2771876_-	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_066640959.1|2771921_2772578_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.2	2.8e-25
>prophage 214
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2782479	2783817	3597394		Pandoravirus(100.0%)	1	NA	NA
WP_066640987.1|2782479_2783817_-	bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase	NA	A0A0B5JD48	Pandoravirus	27.4	4.2e-12
>prophage 215
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2794379	2798878	3597394		Erysipelothrix_phage(50.0%)	3	NA	NA
WP_066641000.1|2794379_2795780_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.2	3.0e-45
WP_157621843.1|2795925_2796753_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_083190684.1|2797072_2798878_+	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	27.8	2.8e-51
>prophage 216
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2812013	2814152	3597394		Pandoravirus(100.0%)	1	NA	NA
WP_066641026.1|2812013_2814152_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	37.8	3.2e-102
>prophage 217
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2829402	2832015	3597394		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_066641050.1|2829402_2832015_+	DEAD/DEAH box helicase	NA	M1I6E2	Acanthocystis_turfacea_Chlorella_virus	34.4	3.0e-46
>prophage 218
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2836596	2841589	3597394	holin	Bacillus_virus(50.0%)	2	NA	NA
WP_083190685.1|2836596_2837691_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	37.0	2.0e-28
WP_066641058.1|2837896_2841589_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	54.0	1.1e-12
>prophage 219
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2848591	2849338	3597394		Bacillus_phage(100.0%)	1	NA	NA
WP_066641066.1|2848591_2849338_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.7	3.0e-15
>prophage 220
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2858486	2860420	3597394		Bacillus_phage(100.0%)	2	NA	NA
WP_066641083.1|2858486_2859170_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.9	7.6e-42
WP_066641085.1|2859166_2860420_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.8	4.5e-24
>prophage 221
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2867186	2868323	3597394		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_066641101.1|2867186_2868323_+	S-(hydroxymethyl)mycothiol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.5	3.8e-30
>prophage 222
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2874199	2937182	3597394	tRNA,holin,transposase,integrase	Gordonia_phage(22.22%)	53	2894786:2894832	2934409:2934455
WP_066641119.1|2874199_2875666_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9V966	Bandra_megavirus	30.1	1.7e-35
WP_066641121.1|2875677_2876631_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_066641126.1|2877363_2878611_-	DUF4032 domain-containing protein	NA	NA	NA	NA	NA
WP_066641128.1|2878678_2879761_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	30.1	9.0e-21
WP_066641130.1|2880080_2881424_+	maltose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_083190689.1|2881580_2883215_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_066641133.1|2883216_2884134_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_083190875.1|2884133_2886074_+	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_066641140.1|2886091_2887153_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_066641141.1|2887156_2887939_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_066641142.1|2887935_2889405_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_066641146.1|2890346_2891393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066641147.1|2891663_2893607_+	serine/threonine protein kinase	NA	Q8QNG7	Ectocarpus_siliculosus_virus	22.7	4.5e-15
WP_066641148.1|2893757_2894714_+	transglycosylase family protein	NA	A0A1J0GVU2	Streptomyces_phage	56.6	5.0e-23
2894786:2894832	attL	TGTCTTGTAAACAGGTGGTTGAGGGTTCGAGTCCCTTCGCCAGCTCT	NA	NA	NA	NA
WP_066641150.1|2894970_2896095_+|integrase	site-specific integrase	integrase	A0A097BXY4	Mycobacterium_phage	41.3	8.0e-73
WP_066641151.1|2896252_2897149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157621966.1|2897150_2897756_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_066641152.1|2898585_2899419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157621850.1|2901265_2901775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066641158.1|2901936_2902191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131106365.1|2902577_2903171_-	cadmium resistance transporter	NA	NA	NA	NA	NA
WP_022921926.1|2903170_2903491_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_022921924.1|2905046_2905382_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066641162.1|2905378_2906494_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	25.4	3.4e-07
WP_191090916.1|2907071_2907635_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_066640175.1|2907597_2907921_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	47.6	2.6e-16
WP_157621821.1|2907875_2908895_+|transposase	IS3 family transposase	transposase	A0A160DCU2	Gordonia_phage	44.6	9.8e-70
WP_066641166.1|2909689_2910553_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_066641167.1|2910644_2911097_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_066641168.1|2911155_2912436_+	MFS transporter	NA	NA	NA	NA	NA
WP_066641169.1|2912421_2913093_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083190691.1|2913238_2915461_+	acetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_066641177.1|2915476_2916463_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_066641178.1|2916522_2917020_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_066641180.1|2917022_2918549_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_191090917.1|2918557_2919709_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_066641187.1|2919705_2920746_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_066641188.1|2920746_2921547_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_066641189.1|2921543_2922455_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_066641190.1|2922477_2923482_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_066641193.1|2923608_2924373_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_066641195.1|2924369_2925425_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_066641197.1|2925421_2926552_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_066641199.1|2926554_2927763_-	CoA transferase	NA	NA	NA	NA	NA
WP_083190692.1|2927817_2928288_+	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_066641201.1|2928284_2929454_+	thiolase	NA	NA	NA	NA	NA
WP_066641203.1|2929492_2930251_+	3-oxoacyl-ACP reductase FabG	NA	F2NZ40	Diadromus_pulchellus_ascovirus	29.6	1.7e-10
WP_066641205.1|2930247_2932344_+	acetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_066641206.1|2932450_2933239_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_066641207.1|2933268_2934240_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_157621969.1|2935351_2936344_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
2934409:2934455	attR	TGTCTTGTAAACAGGTGGTTGAGGGTTCGAGTCCCTTCGCCAGCTCT	NA	NA	NA	NA
WP_066641211.1|2936427_2936757_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_066641216.1|2936753_2937182_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 223
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2941726	2942443	3597394		Planktothrix_phage(100.0%)	1	NA	NA
WP_066641226.1|2941726_2942443_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	5.7e-24
>prophage 224
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2949426	2950890	3597394		Microcystis_phage(100.0%)	1	NA	NA
WP_066641241.1|2949426_2950890_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	37.1	1.4e-48
>prophage 225
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2964602	2969699	3597394		Mycobacterium_phage(33.33%)	6	NA	NA
WP_066641265.1|2964602_2965517_+	alpha/beta hydrolase	NA	A0A068F2G2	Mycobacterium_phage	26.5	5.4e-11
WP_066641267.1|2965513_2965906_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_066643421.1|2965951_2966167_+	DUF2945 domain-containing protein	NA	A0A1L2BWQ1	Bacteriophage	48.4	7.7e-09
WP_066641269.1|2966163_2966586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066641270.1|2966640_2967837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066641271.1|2967833_2969699_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	31.8	1.1e-26
>prophage 226
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2976054	2987935	3597394		Planktothrix_phage(20.0%)	12	NA	NA
WP_066643423.1|2976054_2977131_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.8	2.1e-14
WP_083190698.1|2977157_2977985_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_066641291.1|2977981_2978761_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_066641293.1|2978757_2979153_-	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_083190876.1|2979213_2980095_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_066641295.1|2980079_2980757_-	uracil-DNA glycosylase	NA	A0A286RUF9	Beluga_whale_alphaherpesvirus	42.9	2.2e-25
WP_066641297.1|2980909_2981200_+	DUF3263 domain-containing protein	NA	A0A2P1N2W2	Gordonia_phage	45.5	1.9e-10
WP_066641298.1|2981292_2982960_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_066641301.1|2982982_2984665_-	sodium/solute symporter	NA	A0A240F3J2	Aeromonas_phage	29.5	5.6e-46
WP_157621855.1|2984661_2985108_-	universal stress protein	NA	NA	NA	NA	NA
WP_066641305.1|2985260_2986097_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_066641307.1|2986309_2987935_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	56.7	4.2e-155
>prophage 227
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	2994276	3000452	3597394		Enterobacteria_phage(50.0%)	4	NA	NA
WP_066641326.1|2994276_2995263_+	glycosyltransferase family 2 protein	NA	A0A075B8F6	Enterobacteria_phage	36.8	1.3e-42
WP_066641328.1|2995301_2997353_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_066641329.1|2997324_2998032_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_066641330.1|2998028_3000452_-	hypothetical protein	NA	A0A1V0SGR7	Hokovirus	32.0	1.6e-33
>prophage 228
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3004964	3016919	3597394		Bacillus_phage(22.22%)	10	NA	NA
WP_066641335.1|3004964_3006665_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	24.5	3.2e-12
WP_066641337.1|3006836_3007460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083190701.1|3007609_3008935_-	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	32.3	1.6e-08
WP_066641339.1|3008979_3010470_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.2	5.5e-21
WP_066641341.1|3010487_3011198_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.1e-32
WP_066641343.1|3011251_3012922_-	DEAD/DEAH box helicase	NA	B2CRJ8	Acidianus_filamentous_virus	21.3	1.5e-14
WP_066643435.1|3013391_3014627_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	31.9	7.8e-29
WP_066641345.1|3014626_3015226_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.4	7.4e-17
WP_066641347.1|3015222_3016461_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	39.3	5.6e-67
WP_066641349.1|3016457_3016919_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	39.5	2.4e-15
>prophage 229
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3020273	3026764	3597394		Staphylococcus_phage(33.33%)	6	NA	NA
WP_066641362.1|3020273_3021164_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	4.0e-19
WP_157621975.1|3021330_3021732_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_066641366.1|3021775_3022054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066643444.1|3022537_3024520_+	peptidase M13	NA	A0A1V0SHG2	Klosneuvirus	26.0	7.0e-72
WP_083190702.1|3024646_3025750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_191090919.1|3025780_3026764_-	acyltransferase	NA	A0A166XZF2	Gordonia_phage	34.2	7.1e-33
>prophage 230
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3105181	3108741	3597394		Klosneuvirus(50.0%)	4	NA	NA
WP_066641466.1|3105181_3106402_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	23.8	1.8e-17
WP_066641468.1|3106422_3107268_+	YdcF family protein	NA	NA	NA	NA	NA
WP_066641470.1|3107455_3107836_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_066641471.1|3107835_3108741_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	2.0e-13
>prophage 231
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3119154	3119787	3597394		Pithovirus(100.0%)	1	NA	NA
WP_022925258.1|3119154_3119787_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	25.8	5.1e-08
>prophage 232
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3127745	3134099	3597394		Staphylococcus_phage(33.33%)	6	NA	NA
WP_066641494.1|3127745_3128711_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	1.7e-18
WP_066641500.1|3128707_3129595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066641502.1|3129594_3130518_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.5	1.7e-12
WP_066641504.1|3130514_3131225_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_066641506.1|3131208_3132513_-	FUSC family protein	NA	NA	NA	NA	NA
WP_066641508.1|3132605_3134099_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	65.9	6.1e-44
>prophage 233
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3139411	3145396	3597394		Staphylococcus_phage(50.0%)	3	NA	NA
WP_066641519.1|3139411_3141037_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.1	1.3e-44
WP_083190720.1|3141033_3142212_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_066641523.1|3142201_3145396_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.2	4.2e-58
>prophage 234
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3157956	3170161	3597394		Vibrio_phage(50.0%)	6	NA	NA
WP_066641548.1|3157956_3161430_+	DNA-directed RNA polymerase subunit beta	NA	G8DH04	Emiliania_huxleyi_virus	22.3	7.3e-32
WP_066641550.1|3161560_3165487_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.2	2.0e-49
WP_022925287.1|3165855_3166230_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_058890627.1|3166229_3166700_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_066641552.1|3166750_3168853_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.0	2.9e-60
WP_066641554.1|3168967_3170161_+	elongation factor Tu	NA	M4M9V7	Vibrio_phage	58.3	2.6e-05
>prophage 235
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3217409	3218645	3597394		Gordonia_phage(100.0%)	1	NA	NA
WP_066643486.1|3217409_3218645_-	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	47.3	2.8e-63
>prophage 236
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3222374	3232462	3597394		Planktothrix_phage(25.0%)	10	NA	NA
WP_066641636.1|3222374_3223139_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.6	1.9e-33
WP_066641637.1|3223173_3224427_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_066641639.1|3224648_3225869_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_066643500.1|3225934_3226675_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.4	6.8e-12
WP_083190725.1|3226671_3227511_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_066641641.1|3227507_3228383_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_066641643.1|3228379_3229534_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_066641647.1|3229530_3231099_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	22.9	1.0e-12
WP_066641648.1|3231095_3231731_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_066641649.1|3231727_3232462_+	3-hydroxybutyrate dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.2	2.1e-05
>prophage 237
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3238666	3243569	3597394		Mycobacterium_phage(50.0%)	4	NA	NA
WP_066643509.1|3238666_3240046_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	34.4	4.8e-35
WP_066641657.1|3240059_3241490_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_066641658.1|3241486_3242839_-	MFS transporter	NA	NA	NA	NA	NA
WP_066641662.1|3242870_3243569_-	Ltp family lipoprotein	NA	A0A0K0MWU9	Gordonia_phage	64.8	9.3e-11
>prophage 238
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3253135	3255429	3597394		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_066641678.1|3253135_3254338_-	ABC transporter ATP-binding protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	23.8	1.4e-06
WP_066641679.1|3254334_3255429_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	1.4e-16
>prophage 239
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3266931	3268579	3597394		Streptomyces_phage(50.0%)	2	NA	NA
WP_157621977.1|3266931_3267741_-	hypothetical protein	NA	A0A2L1IVP0	Streptomyces_phage	46.1	5.5e-23
WP_066641692.1|3267820_3268579_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	40.1	1.6e-24
>prophage 240
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3274146	3275283	3597394		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_066641703.1|3274146_3275283_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	24.7	1.2e-12
>prophage 241
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3279765	3281280	3597394		Acinetobacter_phage(100.0%)	1	NA	NA
WP_066643523.1|3279765_3281280_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	33.1	4.6e-07
>prophage 242
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3284532	3286023	3597394		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_066641723.1|3284532_3286023_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	1.5e-47
>prophage 243
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3296923	3299038	3597394		Bacillus_phage(100.0%)	1	NA	NA
WP_066641739.1|3296923_3299038_+	ATP-dependent DNA helicase UvrD2	NA	A7KV33	Bacillus_phage	26.1	3.4e-48
>prophage 244
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3317336	3318212	3597394		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_066641766.1|3317336_3318212_-	SOS response-associated peptidase	NA	V9IQW7	Stenotrophomonas_phage	31.2	4.4e-26
>prophage 245
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3325418	3326462	3597394	tRNA	Moraxella_phage(100.0%)	1	NA	NA
WP_066641781.1|3325418_3326462_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.4	4.7e-59
>prophage 246
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3331323	3335459	3597394		uncultured_virus(50.0%)	4	NA	NA
WP_066641786.1|3331323_3331617_+	co-chaperone GroES	NA	A0A221S4M3	uncultured_virus	51.6	2.0e-20
WP_066641787.1|3331745_3333350_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	55.8	1.6e-151
WP_066641791.1|3333446_3333752_-	WhiB family transcriptional regulator	NA	I6XD27	Mycobacterium_virus	42.0	1.1e-08
WP_066641793.1|3333941_3335459_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	3.2e-93
>prophage 247
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3344831	3347366	3597394		Bacillus_phage(100.0%)	1	NA	NA
WP_066641823.1|3344831_3347366_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	39.3	1.3e-126
>prophage 248
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3353304	3356251	3597394		Prochlorococcus_phage(100.0%)	3	NA	NA
WP_066641834.1|3353304_3353901_+	phosphoribosylglycinamide formyltransferase	NA	R9S626	Prochlorococcus_phage	27.9	5.7e-09
WP_066641838.1|3353859_3354477_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_066641839.1|3354652_3356251_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	43.9	2.9e-60
>prophage 249
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3368926	3370546	3597394		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_066641856.1|3368926_3370546_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.0	1.2e-08
>prophage 250
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3373822	3378084	3597394		Psychrobacter_phage(50.0%)	4	NA	NA
WP_083190749.1|3373822_3374632_+	Ltp family lipoprotein	NA	G3ENA3	Psychrobacter_phage	54.9	3.8e-08
WP_066641863.1|3375312_3375885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157621879.1|3376044_3376734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066641867.1|3376794_3378084_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	46.2	5.0e-87
>prophage 251
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3389664	3391311	3597394		Streptococcus_phage(100.0%)	1	NA	NA
WP_066643612.1|3389664_3391311_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	38.2	3.8e-79
>prophage 252
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3403979	3405805	3597394		Ralstonia_phage(50.0%)	2	NA	NA
WP_083190752.1|3403979_3404987_-	dihydrofolate reductase	NA	A0A0K2QQK4	Ralstonia_phage	45.5	3.9e-26
WP_066641908.1|3404983_3405805_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	62.6	2.1e-94
>prophage 253
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3410486	3413117	3597394		Mycobacterium_phage(100.0%)	1	NA	NA
WP_191090999.1|3410486_3413117_+	DNA translocase FtsK 4TM domain-containing protein	NA	S5VNE3	Mycobacterium_phage	51.2	5.1e-102
>prophage 254
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3422769	3424536	3597394		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_191090924.1|3422769_3424536_-	ABC-F family ATP-binding cassette domain-containing protein	NA	R4TX06	Phaeocystis_globosa_virus	42.7	3.2e-07
>prophage 255
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3432910	3434860	3597394		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_083190757.1|3432910_3434860_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	25.9	7.3e-13
>prophage 256
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3443383	3444478	3597394		Mycobacterium_phage(100.0%)	1	NA	NA
WP_066641975.1|3443383_3444478_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	71.5	9.1e-130
>prophage 257
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3453441	3457176	3597394		Bacillus_phage(100.0%)	1	NA	NA
WP_083190760.1|3453441_3457176_-	FHA domain-containing protein	NA	A0A1B1P7T5	Bacillus_phage	29.5	1.6e-08
>prophage 258
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3464808	3466137	3597394		Burkholderia_virus(100.0%)	1	NA	NA
WP_066643629.1|3464808_3466137_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.1	1.4e-44
>prophage 259
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3473891	3478255	3597394		Planktothrix_phage(25.0%)	5	NA	NA
WP_066642037.1|3473891_3474587_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	37.8	3.4e-29
WP_066642039.1|3474583_3475507_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_066642042.1|3475521_3477225_+	M23 family metallopeptidase	NA	V5R8R0	Arthrobacter_phage	47.2	2.9e-13
WP_066642044.1|3477226_3477646_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	39.3	1.7e-20
WP_066642049.1|3477778_3478255_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	3.8e-32
>prophage 260
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3481872	3482863	3597394	transposase	Enterobacteria_phage(33.33%)	3	NA	NA
WP_083190764.1|3481872_3482289_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.3	1.2e-18
WP_083190765.1|3482285_3482519_-|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	64.0	2.0e-18
WP_066642063.1|3482566_3482863_+	Lsr2 family protein	NA	A0A2D1GPL8	Mycobacterium_phage	44.9	2.5e-10
>prophage 261
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3491561	3493166	3597394	integrase	Gordonia_phage(100.0%)	3	3487809:3487825	3499788:3499804
3487809:3487825	attL	GCCTCGCGCAGCGACTC	NA	NA	NA	NA
WP_066642078.1|3491561_3491906_-	toxin-antitoxin system HicB family antitoxin	NA	A0A2P1A0Q8	Gordonia_phage	50.0	2.9e-05
WP_066642080.1|3491902_3492151_-	toxin HicA	NA	A0A2P1A0R7	Gordonia_phage	65.0	1.2e-05
WP_066642083.1|3492236_3493166_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2P1A0S4	Gordonia_phage	38.8	5.1e-41
3499788:3499804	attR	GCCTCGCGCAGCGACTC	NA	NA	NA	NA
>prophage 262
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3497173	3500194	3597394		Enterococcus_phage(50.0%)	3	NA	NA
WP_066642093.1|3497173_3497878_-	nickel pincer cofactor biosynthesis protein LarB	NA	A0A096XTB6	Enterococcus_phage	42.9	2.1e-18
WP_083190768.1|3497874_3498774_-	ATP-dependent sacrificial sulfur transferase LarE	NA	NA	NA	NA	NA
WP_066642096.1|3498709_3500194_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	27.8	1.2e-36
>prophage 263
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3504198	3507478	3597394		Micromonas_sp._RCC1109_virus(50.0%)	3	NA	NA
WP_083190887.1|3504198_3505533_+	mannitol dehydrogenase family protein	NA	E5EQS6	Micromonas_sp._RCC1109_virus	26.5	7.9e-27
WP_066642105.1|3506552_3506969_-	DUF3224 domain-containing protein	NA	NA	NA	NA	NA
WP_066642108.1|3507094_3507478_-	thioredoxin	NA	V5L6J2	Insectomime_virus	37.3	2.7e-12
>prophage 264
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3511062	3517291	3597394		Planktothrix_phage(33.33%)	6	NA	NA
WP_066642113.1|3511062_3512556_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	3.6e-12
WP_066642115.1|3512571_3513987_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_191090926.1|3514226_3514415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_191090927.1|3514411_3514984_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_083190772.1|3515080_3515410_-	DUF3039 domain-containing protein	NA	A0A2R4A1S7	Microbacterium_phage	52.0	5.5e-14
WP_066642127.1|3515542_3517291_+	DEAD/DEAH box helicase	NA	I4AZM6	Saccharomonospora_phage	36.4	7.1e-84
>prophage 265
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3520399	3526700	3597394	tRNA,protease,integrase	Mycobacterium_phage(66.67%)	7	3524590:3524635	3529611:3529656
WP_083190773.1|3520399_3521701_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	38.3	1.8e-47
WP_083190774.1|3521712_3522057_+|protease	ATP-dependent Clp protease adapter ClpS	protease	NA	NA	NA	NA
WP_066642140.1|3522061_3522646_+	DUF2017 domain-containing protein	NA	NA	NA	NA	NA
WP_066642145.1|3522754_3524311_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
3524590:3524635	attL	CGCCCTCTCAAGGCGGTAGCGCGGGTTCGAATCCCGTCGGGGCTAC	NA	NA	NA	NA
WP_157621893.1|3524675_3525104_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M8Y9	Mycobacterium_phage	46.0	7.6e-16
WP_066642149.1|3525478_3525961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066642152.1|3526091_3526700_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	38.9	1.4e-26
3529611:3529656	attR	CGCCCTCTCAAGGCGGTAGCGCGGGTTCGAATCCCGTCGGGGCTAC	NA	NA	NA	NA
>prophage 266
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3529780	3530470	3597394		Bacillus_virus(100.0%)	1	NA	NA
WP_066642167.1|3529780_3530470_+	HU family DNA-binding protein	NA	G3M9Y0	Bacillus_virus	38.0	6.1e-07
>prophage 267
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3541788	3544848	3597394		uncultured_Mediterranean_phage(33.33%)	5	NA	NA
WP_066642202.1|3541788_3542271_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	36.8	1.9e-18
WP_066642204.1|3542386_3542986_+	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_058892500.1|3542987_3543182_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_066642206.1|3543197_3543950_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.9	2.5e-22
WP_066642207.1|3543954_3544848_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	33.5	1.8e-22
>prophage 268
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3552139	3553321	3597394		uncultured_phage(100.0%)	1	NA	NA
WP_066642241.1|3552139_3553321_+	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	33.6	3.1e-14
>prophage 269
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3570004	3570682	3597394		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_066642304.1|3570004_3570682_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	30.0	4.9e-09
>prophage 270
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3575368	3576292	3597394		Mycobacterium_phage(100.0%)	1	NA	NA
WP_066642324.1|3575368_3576292_-	tyrosine recombinase XerC	NA	A0A142K7N4	Mycobacterium_phage	30.2	2.2e-15
>prophage 271
NZ_CP014989	Serinicoccus hydrothermalis strain JLT9 chromosome, complete genome	3597394	3585343	3587260	3597394		Staphylococcus_phage(100.0%)	1	NA	NA
WP_066642355.1|3585343_3587260_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	29.8	2.0e-55
