The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	27282	70038	4134643	transposase,tRNA	Synechococcus_phage(50.0%)	42	NA	NA
WP_010929577.1|27282_28233_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023995007.1|28314_28650_-	CoA transferase	NA	NA	NA	NA	NA
WP_010929578.1|28674_29109_-	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_019247164.1|29141_30359_-	thiolase family protein	NA	NA	NA	NA	NA
WP_010929580.1|30364_30862_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_019247165.1|31069_32005_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929582.1|32214_33006_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010929583.1|33048_34470_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_005012067.1|34625_35576_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814398.1|35572_36763_-	MFS transporter	NA	NA	NA	NA	NA
WP_010929585.1|37012_37924_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_010929586.1|37925_40064_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003814404.1|40060_40600_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_003814405.1|40603_41332_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010929587.1|41318_42212_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003814410.1|42282_42678_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_003814412.1|42687_43218_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.4	3.7e-12
WP_010930208.1|43663_44614_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929589.1|45200_45749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815265.1|45720_45957_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003815255.1|46084_46978_+	AEC family transporter	NA	NA	NA	NA	NA
WP_010929590.1|48147_49395_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003817748.1|49391_50006_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_005012067.1|50141_51092_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_029443813.1|51134_52391_+	muropeptide transporter	NA	NA	NA	NA	NA
WP_014906036.1|52502_53567_+	porin	NA	NA	NA	NA	NA
WP_010929592.1|53624_54359_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_019247224.1|54364_54955_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-20
WP_003817737.1|54979_55669_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023852650.1|55665_56427_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010929594.1|56506_57406_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012808.1|57499_58450_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929595.1|59250_60477_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_047122776.1|60476_60890_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929597.1|61079_62021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248755.1|62444_63419_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929599.1|63475_64057_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010929600.1|64069_64372_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_029443770.1|64490_65549_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_019247832.1|65583_66855_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_010929603.1|67484_68666_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012808.1|69087_70038_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	185342	243846	4134643	transposase,tRNA	Planktothrix_phage(22.22%)	54	NA	NA
WP_014486111.1|185342_186293_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929608.1|186289_188164_-	O-antigen biosynthesis protein WlbL	NA	A0A2P1ELS8	Moumouvirus	26.9	2.0e-23
WP_003807102.1|189511_190216_-	O-antigen biosynthesis protein WlbI	NA	NA	NA	NA	NA
WP_010929609.1|190212_191385_-	O-antigen biosynthesis protein WlbH	NA	NA	NA	NA	NA
WP_010929610.1|191580_192174_-	O-antigen biosynthesis protein WlbG	NA	NA	NA	NA	NA
WP_010929611.1|192170_193403_-	O-antigen biosynthesis protein WlbF	NA	NA	NA	NA	NA
WP_010929612.1|193420_194680_-	O-antigen biosynthesis protein WlbE	NA	NA	NA	NA	NA
WP_010929613.1|194703_195792_-	O-antigen biosynthesis protein WlbD	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	36.3	4.8e-46
WP_010929614.1|195799_196900_-	O-antigen biosynthesis protein WlbC	NA	A0A2K9L0G1	Tupanvirus	29.7	3.3e-31
WP_003807114.1|196903_197479_-	O-antigen biosynthesis protein WlbB	NA	NA	NA	NA	NA
WP_003807115.1|197482_198535_-	O-antigen biosynthesis protein WlbA	NA	NA	NA	NA	NA
WP_010929615.1|198665_199673_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_010929616.1|199674_200961_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_003807124.1|200977_201133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929617.1|201157_201961_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_010929618.1|201957_202824_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_010929619.1|202898_204029_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003807131.1|204028_204868_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.4	9.1e-21
WP_010930208.1|204981_205932_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929620.1|206849_207452_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_010929621.1|207481_208135_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003807138.1|208267_209524_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.5	6.2e-66
WP_010929622.1|209571_210471_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003818417.1|210546_210822_+	YbeD family protein	NA	NA	NA	NA	NA
WP_010929623.1|210829_211492_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_003807146.1|211553_212555_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_003807148.1|212569_213118_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.4	3.7e-47
WP_010929624.1|213175_214072_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_010929625.1|214068_215130_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	44.8	1.6e-78
WP_010929626.1|215165_216116_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929627.1|217015_218209_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_010929628.1|218290_218920_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_010927242.1|218981_219665_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_023853376.1|219674_221357_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003815933.1|221644_221992_+	DUF1840 domain-containing protein	NA	NA	NA	NA	NA
WP_003815930.1|222082_222400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930525.1|222682_223699_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003815929.1|223774_224575_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003815927.1|224571_225447_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_019248181.1|225457_226750_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929634.1|226792_227833_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	6.0e-22
WP_010929635.1|227938_228760_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_005012067.1|228860_229811_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014905488.1|229909_230815_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	9.8e-21
WP_003815918.1|230811_231645_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010929637.1|232481_233492_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_019247800.1|233488_233878_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010929638.1|234771_236025_+	amidase	NA	NA	NA	NA	NA
WP_010929639.1|236115_237816_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_010929640.1|238242_238890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050457416.1|238888_240328_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003815905.1|240420_240723_+	bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
WP_010929512.1|240750_241629_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|242895_243846_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	272629	318609	4134643	transposase,tRNA	Diachasmimorpha_longicaudata_entomopoxvirus(14.29%)	38	NA	NA
WP_010930892.1|272629_273580_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929659.1|275023_275926_-	YgcG family protein	NA	NA	NA	NA	NA
WP_003815889.1|275903_276533_-	LemA family protein	NA	NA	NA	NA	NA
WP_010929660.1|276815_278246_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.8	5.8e-44
WP_010929661.1|278279_278909_+	LysE family transporter	NA	NA	NA	NA	NA
WP_003815895.1|278957_280565_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	37.8	9.3e-14
WP_010929663.1|280589_281273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815898.1|281354_281831_-	bacterioferritin	NA	NA	NA	NA	NA
WP_005012067.1|282037_282988_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929664.1|284103_284631_+	META domain-containing protein	NA	NA	NA	NA	NA
WP_010929665.1|284722_285538_+	META and DUF4377 domain-containing protein	NA	NA	NA	NA	NA
WP_003808370.1|285598_286333_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_010929666.1|286370_288449_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	23.6	1.5e-27
WP_003808374.1|288698_288971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033446322.1|289072_290158_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010929668.1|290161_292066_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_014486044.1|292062_295737_+	translocation/assembly module TamB domain-containing protein	NA	NA	NA	NA	NA
WP_010929670.1|295797_296361_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	75.3	2.6e-72
WP_003808385.1|296368_296791_-	VOC family protein	NA	NA	NA	NA	NA
WP_010929671.1|296818_297238_-	VOC family protein	NA	NA	NA	NA	NA
WP_076879599.1|297266_297740_-	GNAT family N-acetyltransferase	NA	Q9AZG4	Lactococcus_phage	31.1	2.2e-11
WP_003808391.1|297839_298337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003808393.1|298491_300762_+	arginine/lysine/ornithine decarboxylase	NA	NA	NA	NA	NA
WP_010929672.1|300810_302043_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005012067.1|302141_303092_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|303190_304141_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929673.1|304243_304879_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	73.8	2.8e-83
WP_010929674.1|304875_305769_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_010929675.1|306163_307264_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_010929676.1|307345_307720_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_010929677.1|307779_310644_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.4	1.2e-261
WP_010929678.1|310788_311529_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929679.1|311598_312810_+	CoA transferase	NA	NA	NA	NA	NA
WP_005012067.1|313579_314530_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930048.1|314628_315579_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003818201.1|316127_316502_-	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010929807.1|316576_317635_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005012067.1|317658_318609_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	340900	347249	4134643	integrase	Acinetobacter_phage(16.67%)	10	338188:338210	353004:353026
338188:338210	attL	GCGCTGCAGGCCAGCCTGGCCGA	NA	NA	NA	NA
WP_010929843.1|340900_341890_+|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	44.4	4.4e-75
WP_010926403.1|341886_342087_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929845.1|342199_342541_-	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	45.3	1.0e-10
WP_019247983.1|342551_343736_-	hypothetical protein	NA	A0A291L9X3	Bordetella_phage	37.8	1.5e-24
WP_010929847.1|343772_344300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929848.1|344357_345005_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	41.4	2.0e-31
WP_010929849.1|345001_345988_-	recombinase RecT	NA	H9C0R8	Aeromonas_phage	57.3	2.0e-67
WP_010926410.1|345991_346174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926411.1|346170_346548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929850.1|346781_347249_-	hypothetical protein	NA	Q3HQX1	Burkholderia_phage	71.3	2.1e-43
353004:353026	attR	GCGCTGCAGGCCAGCCTGGCCGA	NA	NA	NA	NA
>prophage 5
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	435440	492392	4134643	transposase,tRNA,tail	uncultured_Caudovirales_phage(19.05%)	61	NA	NA
WP_005012067.1|435440_436391_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929963.1|436489_437440_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	47.2	6.9e-17
WP_003815183.1|437436_438309_-	RNase adapter RapZ	NA	A0A1P8D5W0	Corynebacterium_phage	34.5	2.4e-08
WP_010929964.1|439239_440526_+	cytochrome c	NA	NA	NA	NA	NA
WP_010929965.1|440579_441506_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_010929966.1|441524_441980_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_003815177.1|442831_443623_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	9.5e-20
WP_003815175.1|443654_444275_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_010929967.1|444271_444901_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003815172.1|444913_445522_-	HAD-IIIA family hydrolase	NA	E3T535	Cafeteria_roenbergensis_virus	26.1	5.2e-10
WP_003815171.1|445518_446508_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	37.7	4.3e-38
WP_010929968.1|446613_447828_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|449779_450730_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929970.1|452163_453450_+	putative Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_010929971.1|453615_453924_+	FmdB family transcriptional regulator	NA	NA	NA	NA	NA
WP_003807035.1|453924_454590_+	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	28.4	6.7e-11
WP_003807038.1|454630_456421_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	25.5	6.5e-08
WP_010929972.1|456533_457394_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_077598842.1|457390_458470_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_005015810.1|458449_459400_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929974.1|459641_460526_-	DMT family transporter	NA	NA	NA	NA	NA
WP_033446233.1|462042_462477_-	carbon monoxide dehydrogenase	NA	NA	NA	NA	NA
WP_039249767.1|462439_463438_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247922.1|464567_465125_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247923.1|465100_465451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814657.1|465619_466414_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.4e-15
WP_010931416.1|466410_467460_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003814652.1|467459_468149_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_003814650.1|468235_468733_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_010931417.1|468764_470081_-	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_010931418.1|470097_471072_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_003814643.1|471108_471567_-	protein TolR	NA	NA	NA	NA	NA
WP_003814641.1|471566_472247_-	protein TolQ	NA	NA	NA	NA	NA
WP_010931419.1|472249_472678_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003814636.1|472730_474461_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	29.4	4.6e-11
WP_003814635.1|474526_475099_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_010931420.1|475079_475766_+	response regulator	NA	NA	NA	NA	NA
WP_010931421.1|476121_476793_+	SOS response-associated peptidase	NA	Q5QF62	Pseudomonas_virus	39.9	4.7e-36
WP_010931422.1|477121_477343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010926433.1|477342_477624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931423.1|477620_478136_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_010931424.1|478135_478687_-	lysozyme	NA	NA	NA	NA	NA
WP_010931425.1|478665_478908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931426.1|478912_479725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010926428.1|479724_479988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124740660.1|480028_480226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931428.1|480206_480623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931429.1|480627_484584_-	DUF1983 domain-containing protein	NA	A0A0B5A1N2	Achromobacter_phage	40.8	3.9e-215
WP_010931430.1|484576_484966_-	C40 family peptidase	NA	A0A0G3EYJ9	Achromobacter_phage	50.0	3.0e-35
WP_010931431.1|484962_485496_-	DUF1833 family protein	NA	A5A3Q9	Burkholderia_phage	46.9	1.1e-40
WP_010931432.1|485563_485923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931433.1|485932_488545_-|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	38.6	4.9e-105
WP_010931434.1|488570_488861_-	DUF1799 domain-containing protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	45.2	3.7e-14
WP_003813412.1|488878_489208_-|tail	phage tail assembly chaperone	tail	A0A2H4J121	uncultured_Caudovirales_phage	44.0	2.9e-15
WP_010931435.1|489217_489736_-|tail	phage tail protein	tail	A0A1S5R1H0	Pseudomonas_phage	38.3	5.4e-24
WP_010931436.1|489990_490491_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	45.1	4.4e-31
WP_010931437.1|490498_490921_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_010931438.1|490917_491316_-	hypothetical protein	NA	I6PCW1	Cronobacter_phage	38.0	4.2e-16
WP_010931439.1|491312_491708_-	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
WP_010931440.1|491707_491908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247789.1|491909_492392_-	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	37.1	1.8e-13
>prophage 6
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	617897	737412	4134643	transposase,terminase,tRNA,protease,holin	Bacillus_phage(16.67%)	110	NA	NA
WP_076879541.1|617897_618848_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023998122.1|619344_620214_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_010931496.1|620210_621032_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_019247235.1|621230_621722_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_019247236.1|621740_622814_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_023853086.1|622860_623964_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_003808577.1|624039_624660_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003808574.1|624680_625190_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.1	1.2e-28
WP_003808570.1|625244_625496_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.4	1.6e-18
WP_010931494.1|625559_626693_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_003808567.1|626700_627087_-	MOSC N-terminal beta barrel domain-containing protein	NA	NA	NA	NA	NA
WP_010931493.1|627083_629603_-	AsmA family protein	NA	NA	NA	NA	NA
WP_003808563.1|630031_630370_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003808562.1|630366_630873_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_010931492.1|630934_631735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931491.1|631845_632787_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931490.1|632880_634416_-	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931489.1|636095_637946_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.6e-17
WP_003808549.1|637949_638783_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931488.1|638782_639724_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010929956.1|640034_640985_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931487.1|641024_641996_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_039249903.1|642137_644426_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_003808542.1|644732_645641_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010931485.1|645695_646661_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931484.1|646735_648397_+	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_010931483.1|648468_649179_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|649327_650278_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814152.1|650976_651360_+	membrane protein	NA	NA	NA	NA	NA
WP_010927005.1|651417_652020_+	DUF2946 family protein	NA	NA	NA	NA	NA
WP_003820995.1|652037_652439_-	DoxX family protein	NA	NA	NA	NA	NA
WP_003814158.1|652572_653466_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814161.1|653462_654044_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003814165.1|654838_655573_+	arginyltransferase	NA	NA	NA	NA	NA
WP_010931480.1|655613_656663_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_003814172.1|656810_657389_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_010931479.1|657775_658753_+	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_019248367.1|658846_663241_-	dermonecrotic toxin	NA	NA	NA	NA	NA
WP_003814178.1|663441_664290_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931477.1|664448_665261_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015810.1|665316_666267_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931453.1|666365_667166_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_003814185.1|667227_667611_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_010931454.1|667622_669056_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	1.5e-52
WP_003814188.1|669262_669592_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_033462323.1|669594_670344_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010931456.1|670526_671447_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_003814195.1|671493_671706_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_010931457.1|671728_672151_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_010931458.1|672167_673268_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010931459.1|673364_674882_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_003814203.1|674957_675797_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.9	1.1e-66
WP_003814205.1|675818_676700_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_003814206.1|676781_677876_-	porin	NA	NA	NA	NA	NA
WP_010931401.1|678136_679087_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|679185_680136_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814209.1|680219_680579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931461.1|680960_681998_-	sodium:calcium antiporter	NA	NA	NA	NA	NA
WP_010931462.1|682314_683655_+	aminopeptidase P N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010931463.1|683664_684117_-	membrane protein	NA	NA	NA	NA	NA
WP_003814217.1|684213_685395_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_023995141.1|685460_686486_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003814221.1|686526_686766_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_010931464.1|686835_688425_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.2	8.7e-65
WP_010931465.1|688424_688973_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_003814226.1|689053_689626_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010927008.1|689644_690556_-	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_003814230.1|690629_691598_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_010931466.1|691720_692794_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.7	2.3e-08
WP_010931467.1|692798_694619_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	3.1e-74
WP_005015810.1|694695_695646_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_033446132.1|695734_696070_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_003819076.1|696203_696854_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_010931468.1|696875_698294_-	amidase	NA	NA	NA	NA	NA
WP_019248554.1|698363_699119_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019247734.1|699087_699846_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014905407.1|699856_700738_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931472.1|700754_701462_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	8.2e-07
WP_010931473.1|701464_702223_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	4.4e-14
WP_010931474.1|702432_704175_+	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_010925795.1|704167_704692_+	DUF934 domain-containing protein	NA	NA	NA	NA	NA
WP_010931475.1|704731_705526_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019248926.1|705693_706767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|706865_707816_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247378.1|708067_708274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931451.1|708345_708957_-	S24 family peptidase	NA	NA	NA	NA	NA
WP_023853179.1|709511_709763_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161633094.1|709755_710445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|710701_711652_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247942.1|712291_712777_+|transposase	transposase	transposase	C7U0W1	Enterobacteria_phage	61.5	7.3e-39
WP_010931447.1|712763_714041_+|terminase	terminase large subunit	terminase	A0A1B1P9C9	Acinetobacter_phage	64.7	2.4e-150
WP_010931446.1|714043_715462_+	DUF4055 domain-containing protein	NA	R9TF43	Synechococcus_phage	42.1	2.2e-99
WP_010931445.1|715490_716546_+	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	50.6	2.6e-97
WP_010931444.1|716551_716794_+	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	53.2	5.6e-16
WP_010931443.1|716916_717519_+	hypothetical protein	NA	R9TF81	Synechococcus_phage	43.6	7.9e-27
WP_019248169.1|720061_721777_+	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.1	9.1e-60
WP_003814006.1|721787_722279_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_010930015.1|722351_723368_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_003814004.1|723535_724315_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_003814003.1|724333_724861_-	lipoprotein	NA	NA	NA	NA	NA
WP_003814002.1|725154_725424_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_003821234.1|725514_727674_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003814000.1|727794_728514_+	lipoprotein	NA	NA	NA	NA	NA
WP_005013747.1|728510_729461_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813999.1|729601_730819_+	threonine ammonia-lyase	NA	NA	NA	NA	NA
WP_010930016.1|730812_731424_-	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	32.5	3.3e-12
WP_003813997.1|732057_733035_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_003813996.1|733178_733925_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_010930017.1|733946_734393_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_010930018.1|735180_737412_+|holin	choline BCCT transporter BetT	holin	NA	NA	NA	NA
>prophage 7
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	745046	817048	4134643	transposase,holin	Vibrio_phage(25.0%)	59	NA	NA
WP_023853536.1|745046_746063_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003813987.1|746259_747084_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_076879542.1|747161_748085_-	transcriptional regulator LrhA	NA	NA	NA	NA	NA
WP_010930021.1|748255_749407_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_010930022.1|749410_750442_+	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_019248051.1|750570_751542_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003813982.1|751566_753651_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_003813981.1|753717_754710_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930024.1|754818_756153_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010930025.1|756178_758191_-	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_023853163.1|758187_760236_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010930027.1|760339_760987_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003813974.1|761127_761622_+	azurin	NA	NA	NA	NA	NA
WP_010926969.1|761665_762337_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_010930029.1|762351_763845_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_010930031.1|766956_768063_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010930032.1|768186_768855_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|769075_770026_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813960.1|770108_772067_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	30.3	8.0e-28
WP_010930033.1|772094_772796_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020699608.1|772942_773758_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_003813954.1|773754_774570_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_003813952.1|774586_775390_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003813951.1|775373_775808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003813949.1|775804_776239_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_019247352.1|776240_776795_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|776812_777763_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930034.1|778075_779233_+	porin	NA	NA	NA	NA	NA
WP_003813943.1|779421_779781_+	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_003813941.1|779817_780294_+	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_010926963.1|780368_780992_+	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_010930035.1|780994_782251_+	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_003813932.1|782296_782791_+	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_003813930.1|782787_784155_+	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_010930036.1|784170_786498_+	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_003813926.1|786497_787571_+	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_003813924.1|787592_788081_+	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_003813921.1|788098_788746_+	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_003813920.1|788742_789051_+	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_010930037.1|789068_791081_+	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_019247436.1|791077_792580_+	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_003813916.1|792590_794075_+	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_003813915.1|794091_794421_+	DUF2818 family protein	NA	NA	NA	NA	NA
WP_010930039.1|794721_796953_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_003813909.1|797164_799435_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_010930041.1|799547_800066_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930042.1|800075_800852_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003813904.1|800848_802639_-	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	26.1	2.0e-25
WP_014905892.1|802698_803679_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930045.1|803816_804734_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930046.1|804862_805723_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_010926959.1|805758_809214_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_003813895.1|809243_809927_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003813893.1|809923_810412_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_010930742.1|810510_811461_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813068.1|811457_812477_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	35.7	1.5e-49
WP_010930049.1|812486_815195_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.0	2.8e-15
WP_010930050.1|815342_815999_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|816097_817048_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	925676	993069	4134643	transposase,tRNA	Enterococcus_phage(16.67%)	54	NA	NA
WP_010929632.1|925676_926693_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010926548.1|928201_928774_-	chorismate lyase	NA	NA	NA	NA	NA
WP_010930119.1|928833_929565_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_029443805.1|929616_930534_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930121.1|931341_934521_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_010930123.1|935969_936221_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_010930124.1|936366_936981_-	SCO family protein	NA	NA	NA	NA	NA
WP_019248379.1|937167_939282_-	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_003811948.1|939357_940209_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.1e-33
WP_010930126.1|940205_940832_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003817147.1|940828_942583_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_010930127.1|942875_945581_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_010930128.1|945593_947255_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_010930129.1|947267_949058_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.2	2.4e-39
WP_003817151.1|949279_950455_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_005012808.1|950497_951448_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930130.1|951546_952287_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_010930131.1|952481_954518_+	transketolase	NA	NA	NA	NA	NA
WP_010930132.1|954535_955546_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_010930133.1|955663_956857_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_010930134.1|956886_957660_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010930135.1|957656_958847_-	acetate kinase	NA	NA	NA	NA	NA
WP_003809454.1|958872_959811_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_010930136.1|959807_962156_-	DUF3141 domain-containing protein	NA	NA	NA	NA	NA
WP_010930137.1|962310_962952_-	glutathione transferase	NA	NA	NA	NA	NA
WP_023853531.1|963055_964189_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994624.1|964281_964434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930138.1|964465_965014_-	DinB family protein	NA	NA	NA	NA	NA
WP_003819814.1|965032_965518_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930139.1|965695_966634_+	DnaJ domain-containing protein	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	24.1	5.6e-11
WP_003809467.1|966636_966954_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247197.1|966999_967944_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_033461972.1|967964_969434_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_005012067.1|969517_970468_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811933.1|970766_971504_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_010930143.1|971939_972263_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_003811929.1|972297_972858_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_003811927.1|972978_973854_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_003817154.1|973866_974814_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_019247393.1|974915_975209_+	response regulator	NA	NA	NA	NA	NA
WP_065465820.1|975235_977293_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_003811919.1|977307_977808_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_010930145.1|977881_979588_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	1.4e-12
WP_010930146.1|980451_981504_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_003811911.1|981556_981946_+	chemotaxis response regulator CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	33.3	5.7e-10
WP_003817162.1|981954_982587_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_010930525.1|982686_983703_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930148.1|984491_985541_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_014486064.1|985537_987181_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_010930149.1|987177_988065_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003809396.1|988205_988679_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_010930151.1|988668_989691_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.4	8.7e-50
WP_015041211.1|989687_991115_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_010930525.1|992052_993069_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	996821	1057834	4134643	transposase,holin,tRNA,protease	Catovirus(22.22%)	49	NA	NA
WP_010930155.1|996821_997958_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	1.9e-85
WP_023853534.1|997954_999028_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003809423.1|999185_1000622_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_010930157.1|1000712_1001354_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010930525.1|1001689_1002706_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_033461720.1|1003038_1005771_+	pertactin autotransporter	NA	NA	NA	NA	NA
WP_010930160.1|1005837_1007259_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003809431.1|1007522_1008239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003809432.1|1008323_1008641_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_003819794.1|1008681_1009095_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_010930161.1|1009096_1009456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023853525.1|1009498_1011043_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_010930163.1|1011126_1011957_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_010930164.1|1011991_1013146_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_010930165.1|1013188_1014061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003809441.1|1017672_1018137_+	barstar family protein	NA	NA	NA	NA	NA
WP_005013747.1|1018163_1019114_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930167.1|1019481_1020258_-	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	28.7	4.3e-17
WP_003809638.1|1020302_1021160_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_010930169.1|1021181_1022198_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_014486066.1|1022332_1023373_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	40.2	2.1e-51
WP_010930171.1|1023567_1025649_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_010930172.1|1025884_1027378_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_003809629.1|1027608_1028403_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003819875.1|1028623_1029982_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_010930173.1|1029978_1030821_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	3.2e-26
WP_010930174.1|1030839_1032726_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	41.5	1.4e-109
WP_162096758.1|1032667_1032919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930175.1|1032963_1033596_-	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_003809618.1|1033614_1034217_+	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005012067.1|1034368_1035319_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_161633091.1|1035899_1036607_+	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_003812707.1|1036965_1037952_-	homoserine kinase	NA	NA	NA	NA	NA
WP_010930178.1|1038091_1039105_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005012067.1|1039101_1040052_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812703.1|1040164_1040623_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003812701.1|1040659_1041973_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_010930180.1|1041990_1042362_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_010930182.1|1043963_1044692_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_019248112.1|1044673_1047523_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|1047735_1048686_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019248175.1|1048853_1049678_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	22.7	1.0e-08
WP_010930185.1|1049677_1050556_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010930186.1|1051460_1052576_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020699602.1|1052604_1053399_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	23.3	1.2e-11
WP_010930188.1|1053395_1055261_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.3	9.3e-50
WP_003812436.1|1055339_1055972_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930189.1|1055968_1056271_-	membrane protein	NA	NA	NA	NA	NA
WP_010930190.1|1056313_1057834_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.0	1.2e-82
>prophage 10
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	1078703	1148172	4134643	transposase,tRNA	Erysipelothrix_phage(33.33%)	55	NA	NA
WP_010930198.1|1078703_1079654_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_033461500.1|1079752_1080376_-	serotype 2 fimbrial subunit	NA	NA	NA	NA	NA
WP_010930200.1|1080557_1082840_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_010930201.1|1082994_1085691_-	alpha-ketoglutarate dehydrogenase	NA	NA	NA	NA	NA
WP_010930202.1|1085816_1086305_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003813631.1|1088715_1091586_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_010930204.1|1091631_1092846_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_003813626.1|1093075_1094503_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	2.1e-41
WP_023853245.1|1094600_1095692_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_010930206.1|1095704_1096463_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003813621.1|1096550_1097453_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|1097449_1098400_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930207.1|1098529_1099513_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003813618.1|1099567_1100290_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930208.1|1100757_1101708_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930209.1|1102429_1102963_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003813612.1|1102955_1103918_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_003813609.1|1104011_1106489_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_003813607.1|1106605_1106914_+	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_003813603.1|1108558_1108885_+	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_010930742.1|1109033_1109984_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930211.1|1109993_1111349_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010930212.1|1111429_1113805_-	RNA-binding transcriptional accessory protein Tex	NA	NA	NA	NA	NA
WP_010930213.1|1113969_1116045_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	30.0	2.4e-75
WP_003813594.1|1116106_1116907_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_010930214.1|1117008_1117971_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_019247742.1|1117958_1118714_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_010930216.1|1118821_1120459_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_003813586.1|1120526_1121264_+	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_003813585.1|1121366_1121942_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_010930217.1|1122114_1122651_+	iron transporter	NA	NA	NA	NA	NA
WP_003813580.1|1122653_1122998_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_010930218.1|1123013_1123859_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_003821443.1|1123897_1125277_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_003813574.1|1125354_1126236_+	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_005013747.1|1126334_1127285_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811632.1|1127281_1127692_-	VOC family protein	NA	NA	NA	NA	NA
WP_010930219.1|1127799_1128654_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_003811636.1|1128646_1129609_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930220.1|1129654_1130779_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	28.3	1.5e-31
WP_019247966.1|1130884_1131763_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930222.1|1131887_1132667_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930223.1|1132820_1134242_+	MFS transporter	NA	NA	NA	NA	NA
WP_010930224.1|1134676_1136374_+	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_010930225.1|1136600_1137542_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_010930226.1|1137868_1138615_+	aldolase	NA	NA	NA	NA	NA
WP_033446252.1|1138622_1139549_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930228.1|1139670_1140588_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003811660.1|1140627_1141581_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003811662.1|1141605_1142184_+	amino acid synthesis family protein	NA	NA	NA	NA	NA
WP_010930229.1|1143857_1144466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930230.1|1144543_1144897_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_010930231.1|1144980_1145970_-	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_005012067.1|1146172_1147123_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930048.1|1147221_1148172_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	1249554	1312996	4134643	transposase	uncultured_Caudovirales_phage(40.0%)	53	NA	NA
WP_010930208.1|1249554_1250505_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811370.1|1250692_1251895_-	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_003811372.1|1251891_1252650_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_003811375.1|1253043_1253676_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930311.1|1254631_1257232_+	BP1344/BB2830 family autotransporter	NA	NA	NA	NA	NA
WP_010930312.1|1257219_1260639_-	TM0106 family RecB-like putative nuclease	NA	NA	NA	NA	NA
WP_010930313.1|1260646_1261552_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811381.1|1261690_1262269_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010930314.1|1262265_1263177_+	CoA ester lyase	NA	NA	NA	NA	NA
WP_010930315.1|1263190_1263871_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930316.1|1264072_1266112_+	acetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_014486069.1|1266130_1267117_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930317.1|1267142_1267940_+	citryl-CoA lyase	NA	NA	NA	NA	NA
WP_003811389.1|1267936_1269130_+	CoA transferase	NA	NA	NA	NA	NA
WP_003811391.1|1269126_1270089_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003811393.1|1270106_1271147_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003811396.1|1271134_1271743_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_010930318.1|1273331_1274327_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003811400.1|1274346_1275525_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_003811401.1|1275535_1276453_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_010930208.1|1276508_1277459_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812022.1|1277557_1278328_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	9.8e-30
WP_003812020.1|1278324_1279005_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010930319.1|1279071_1279860_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023853536.1|1280106_1281123_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930321.1|1281428_1282583_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_003817170.1|1287088_1287571_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_003817172.1|1287588_1287879_-	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_010930322.1|1288005_1288716_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_010930323.1|1288899_1289307_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_003817176.1|1289319_1289739_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_019248229.1|1289786_1290491_+	flagellar basal body rod modification protein FlgD	NA	NA	NA	NA	NA
WP_003817180.1|1290556_1291978_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_003817181.1|1292016_1292781_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_010930325.1|1292824_1293610_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_010930326.1|1293609_1294299_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_010930327.1|1294301_1295435_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_010930328.1|1295452_1296475_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	A0A088F6W1	Sulfitobacter_phage	31.4	1.9e-12
WP_010930329.1|1296544_1298191_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_010930330.1|1298224_1299757_+	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_010930331.1|1299835_1301656_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.6	6.4e-11
WP_010930332.1|1301776_1303396_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.3	1.5e-08
WP_014486070.1|1303574_1305017_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	41.8	1.0e-35
WP_010930525.1|1305233_1306250_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930333.1|1306296_1307085_-	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_003811859.1|1307107_1307377_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_015041547.1|1307393_1308185_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_003811855.1|1308196_1308538_-	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_010930335.1|1308548_1309049_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_003811852.1|1309041_1310052_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_003811850.1|1310054_1310627_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_005012067.1|1310996_1311947_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1312045_1312996_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	1355276	1414547	4134643	transposase,tRNA	Bacillus_phage(25.0%)	54	NA	NA
WP_005012067.1|1355276_1356227_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811759.1|1356344_1357271_+	paraslipin	NA	NA	NA	NA	NA
WP_010930360.1|1357336_1358494_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.2	2.3e-14
WP_003811754.1|1358474_1358942_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	45.1	6.2e-27
WP_003811752.1|1359007_1359442_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_003811750.1|1359431_1359782_+	RnfH family protein	NA	NA	NA	NA	NA
WP_003811748.1|1359978_1361133_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003811746.1|1361129_1362302_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003811743.1|1362349_1363243_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003811741.1|1363288_1363726_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_010930362.1|1363785_1364475_+	VIT family protein	NA	NA	NA	NA	NA
WP_010929577.1|1364484_1365435_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_076879547.1|1365533_1366484_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930364.1|1366582_1367545_-	transaldolase	NA	H6WFR1	Cyanophage	29.2	7.5e-11
WP_023852833.1|1367771_1368926_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.4	3.3e-53
WP_010930366.1|1368936_1372179_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_003809593.1|1373200_1373845_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_010930367.1|1373855_1374755_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003809599.1|1374802_1375888_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	6.4e-27
WP_010930368.1|1375884_1377579_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_005012808.1|1377757_1378708_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247209.1|1378849_1379152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247210.1|1379167_1380220_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003820487.1|1380261_1381323_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.8	2.9e-80
WP_010930369.1|1381356_1382193_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003812685.1|1382202_1382745_-	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_010930370.1|1382758_1384051_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_010930371.1|1384047_1384641_-	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_004567450.1|1384793_1385891_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_003820494.1|1385897_1386458_+	DUF3305 domain-containing protein	NA	NA	NA	NA	NA
WP_010930372.1|1386454_1387135_+	DUF3306 domain-containing protein	NA	NA	NA	NA	NA
WP_010930373.1|1387158_1389249_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_010930374.1|1389245_1389875_+	molecular chaperone TorD family protein	NA	NA	NA	NA	NA
WP_023853518.1|1390026_1390236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247523.1|1390250_1393220_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_003812666.1|1393854_1394088_+	lipoprotein	NA	NA	NA	NA	NA
WP_010930376.1|1394100_1395258_+	formate dehydrogenase subunit gamma	NA	NA	NA	NA	NA
WP_004567447.1|1395280_1395655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930377.1|1395688_1396804_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930378.1|1397703_1398408_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	2.6e-13
WP_004567445.1|1398404_1399223_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010930379.1|1399506_1400910_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_010930380.1|1400924_1401575_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_010930381.1|1401656_1402733_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_010930382.1|1402919_1404050_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_023853502.1|1404100_1405804_+	FimV N-terminal domain protein	NA	NA	NA	NA	NA
WP_010930384.1|1405807_1406620_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_014486072.1|1406764_1407859_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930386.1|1408070_1408700_+	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_010930387.1|1408702_1410370_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_010930388.1|1410384_1411041_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_076879548.1|1411520_1412471_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930389.1|1412502_1413600_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.3	3.5e-20
WP_076879549.1|1413596_1414547_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	1456396	1511892	4134643	transposase,tRNA	Streptococcus_virus(16.67%)	48	NA	NA
WP_010930416.1|1456396_1456885_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_010930417.1|1457002_1457581_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010930418.1|1457686_1458055_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023994932.1|1458061_1459174_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_010930419.1|1459860_1461063_+	MFS transporter	NA	NA	NA	NA	NA
WP_004568212.1|1461098_1461245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930420.1|1461266_1463927_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_010930421.1|1463939_1467344_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_023995689.1|1468011_1470237_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.5	1.2e-43
WP_010930423.1|1470283_1470610_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_010930424.1|1470660_1471269_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_010931070.1|1471367_1472318_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|1472416_1473367_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930425.1|1473436_1474201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930426.1|1474197_1474797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930427.1|1474900_1475752_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	35.3	7.0e-37
WP_010928449.1|1475811_1476438_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_010929577.1|1476434_1477385_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809954.1|1478277_1479183_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_010930437.1|1479194_1480322_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_010930436.1|1480410_1481025_-	serotype 3 fimbrial subunit	NA	NA	NA	NA	NA
WP_010930435.1|1481684_1482872_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_033446228.1|1482868_1485466_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	22.6	1.5e-21
WP_010930433.1|1485720_1485936_+	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_010930432.1|1486391_1486946_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.0	1.7e-15
WP_010930431.1|1487213_1487774_+	membrane protein	NA	NA	NA	NA	NA
WP_023853587.1|1487885_1489190_+	imelysin	NA	NA	NA	NA	NA
WP_019247498.1|1489186_1490698_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_019248041.1|1490803_1491805_+	imelysin family protein	NA	NA	NA	NA	NA
WP_019249265.1|1491794_1492907_+	DUF1513 domain-containing protein	NA	NA	NA	NA	NA
WP_005013747.1|1493005_1493956_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809983.1|1494061_1494895_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_010930623.1|1494908_1495667_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930624.1|1495828_1496821_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930625.1|1497038_1497815_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_010930626.1|1497922_1498705_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_003809992.1|1498831_1500418_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.0	1.9e-35
WP_010930627.1|1500442_1501306_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_020699633.1|1501513_1502293_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_003809999.1|1502285_1502795_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_010930629.1|1502923_1503607_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010930630.1|1503846_1505307_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	27.9	2.5e-34
WP_003820119.1|1505326_1505971_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_003810007.1|1506007_1506973_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_010930742.1|1507071_1508022_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930632.1|1508151_1509117_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_010930633.1|1509216_1510482_+	aspartate kinase	NA	NA	NA	NA	NA
WP_010929632.1|1510875_1511892_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	1758435	1841144	4134643	transposase	Klosneuvirus(14.29%)	51	NA	NA
WP_005012067.1|1758435_1759386_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930804.1|1759484_1762085_-	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_003818658.1|1762191_1763196_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010930803.1|1763304_1764645_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	22.8	8.8e-18
WP_003818661.1|1764685_1765714_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930802.1|1765909_1766455_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930801.1|1766451_1767012_+	diaminobutyrate acetyltransferase	NA	NA	NA	NA	NA
WP_005015810.1|1767110_1768061_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810867.1|1768084_1768549_-	GatB/YqeY domain-containing protein	NA	A0A0K2FLI9	Brevibacillus_phage	32.4	3.9e-05
WP_010930799.1|1768695_1769904_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_010930798.1|1769947_1770385_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930797.1|1770503_1771793_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_005012067.1|1774533_1775484_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930595.1|1775582_1776599_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_010930596.1|1776777_1777812_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_003811733.1|1777808_1778435_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	35.1	1.6e-22
WP_010930597.1|1778431_1779484_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_010930598.1|1779533_1780304_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_010930599.1|1780354_1781191_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010930600.1|1781386_1782127_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930601.1|1782201_1782945_+	glutamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020699606.1|1783621_1784380_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	6.7e-31
WP_003811716.1|1785517_1786807_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_010930602.1|1788417_1789665_-	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_010930603.1|1789674_1791384_-	thiamine pyrophosphate-binding protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	27.3	5.9e-35
WP_003811709.1|1791380_1792319_-	citrate lyase subunit beta	NA	NA	NA	NA	NA
WP_003811706.1|1792315_1793599_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_010930604.1|1793602_1794085_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_010930605.1|1794085_1795072_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_003811701.1|1795244_1795964_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|1796080_1797031_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930606.1|1800216_1801566_+	amidase	NA	NA	NA	NA	NA
WP_010930607.1|1801623_1802418_+	putative hydro-lyase	NA	NA	NA	NA	NA
WP_003816497.1|1802551_1803427_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_014486076.1|1803470_1807187_-	virulence factors two-component system sensor histidine kinase BvgS	NA	A0A1V0SGX0	Hokovirus	32.0	4.2e-33
WP_005013747.1|1807195_1808146_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930609.1|1808244_1808874_-	virulence factors two-component system response regulator BvgA	NA	NA	NA	NA	NA
WP_039250273.1|1809300_1820067_+	filamentous hemagglutinin/adhesin	NA	A0A0R6PJK4	Moraxella_phage	32.5	3.6e-29
WP_010930611.1|1820829_1821564_+	molecular chaperone FimB	NA	NA	NA	NA	NA
WP_010930612.1|1821626_1824248_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_019247160.1|1824228_1825359_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_010930614.1|1825351_1827106_+	filamentous hemagglutinin transporter protein FhaC	NA	NA	NA	NA	NA
WP_010930615.1|1828424_1828925_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_010930616.1|1828931_1829906_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930617.1|1831462_1831954_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_019248349.1|1831967_1832933_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019247163.1|1832953_1833655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930620.1|1834829_1835342_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_010930621.1|1835420_1839044_+	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010930622.1|1839057_1840089_-	C45 family peptidase	NA	NA	NA	NA	NA
WP_005012067.1|1840193_1841144_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	1908850	2032429	4134643	transposase,tRNA	Klosneuvirus(10.0%)	106	NA	NA
WP_005013747.1|1908850_1909801_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810741.1|1911127_1911730_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003810743.1|1911969_1912671_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003816696.1|1912664_1913447_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.8	2.0e-09
WP_005012808.1|1913631_1914582_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930483.1|1914680_1915418_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	46.6	4.1e-41
WP_010926609.1|1915607_1916366_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930482.1|1916412_1917402_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930481.1|1917579_1918548_-	transporter	NA	NA	NA	NA	NA
WP_010930480.1|1920087_1921056_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010930479.1|1921064_1922006_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_010930478.1|1922479_1923490_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930477.1|1923480_1924995_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930476.1|1924991_1926338_+	BatD family protein	NA	NA	NA	NA	NA
WP_010930475.1|1926340_1927375_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_023852967.1|1927424_1929050_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	52.2	2.0e-149
WP_010929591.1|1929602_1930553_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930487.1|1930657_1931605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247865.1|1931658_1933473_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010930489.1|1933465_1934140_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023995112.1|1934269_1937344_+	autotransporter SphB2	NA	NA	NA	NA	NA
WP_019247905.1|1937357_1937657_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930492.1|1937971_1938595_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_010930493.1|1938838_1939708_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010930494.1|1939685_1940630_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247909.1|1940715_1941642_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247910.1|1941754_1942534_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930497.1|1942524_1943721_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_019248077.1|1943751_1944702_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_010930499.1|1944923_1945613_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930500.1|1945677_1946433_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930501.1|1946484_1947477_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930502.1|1947486_1948440_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811538.1|1948555_1949518_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019249376.1|1950919_1951348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|1951344_1952295_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_170954298.1|1952588_1953326_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	1.3e-87
WP_010930504.1|1953749_1954937_-	MFS transporter	NA	NA	NA	NA	NA
WP_019249653.1|1954940_1955321_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930506.1|1957040_1958012_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930507.1|1958025_1958739_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930508.1|1958743_1959661_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811452.1|1959767_1960064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065465821.1|1960162_1961113_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930509.1|1962271_1965205_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_003810969.1|1965204_1965549_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_004568496.1|1965545_1967174_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_010930510.1|1967170_1967650_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_003810975.1|1967646_1967931_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_010930511.1|1967927_1968254_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005013747.1|1968409_1969360_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247780.1|1969403_1969946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012808.1|1969978_1970929_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930513.1|1971092_1971941_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_004568494.1|1971933_1972440_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	38.4	3.4e-07
WP_010930515.1|1972436_1973438_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_010930516.1|1973450_1974245_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010930517.1|1974293_1976195_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_003810992.1|1976191_1976815_-	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_003816541.1|1976941_1978066_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930518.1|1978446_1980051_+	ABC-F family ATPase	NA	A0A1V0SKJ1	Klosneuvirus	28.9	1.2e-53
WP_010930519.1|1980205_1980982_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.2	1.2e-30
WP_010930520.1|1981066_1982065_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930521.1|1982061_1982835_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930522.1|1983819_1984770_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930523.1|1984807_1985395_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	35.8	4.7e-16
WP_003811007.1|1985412_1985796_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	25.8	8.1e-09
WP_003811011.1|1987155_1988448_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.0	1.7e-66
WP_010930524.1|1988582_1989623_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.3	6.1e-91
WP_010930525.1|1989720_1990737_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003811015.1|1991004_1991652_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_010930526.1|1991777_1992536_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.2	1.4e-68
WP_019247478.1|1992520_1993300_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.9	4.8e-32
WP_003811022.1|1993317_1994202_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	49.5	4.6e-15
WP_004568488.1|1994198_1994978_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_010930528.1|1995082_1995682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930529.1|1995970_1996723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003816525.1|1996841_1998242_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.5	7.3e-31
WP_003816523.1|1998265_1998664_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003811035.1|1998839_1999040_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_010930530.1|1999178_1999907_+	redoxin family protein	NA	A0A1D8KSL1	Synechococcus_phage	56.8	9.6e-43
WP_003816520.1|2000040_2001456_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_003816518.1|2001459_2002323_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_004568486.1|2002335_2003085_-	glycerophosphodiester phosphodiesterase	NA	A0A2H4PGQ5	Escherichia_phage	27.8	1.5e-14
WP_019247881.1|2003267_2005283_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_019247882.1|2005264_2005933_-	arylesterase	NA	NA	NA	NA	NA
WP_076879557.1|2006707_2007658_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813572.1|2007806_2008145_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_003813570.1|2008202_2008364_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_003813568.1|2008395_2008596_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010930533.1|2008861_2011435_-	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_019247811.1|2011505_2014055_-	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_010930535.1|2016605_2017094_+	DUF1854 domain-containing protein	NA	NA	NA	NA	NA
WP_029443743.1|2017185_2018337_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004566336.1|2018390_2019212_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_010930537.1|2019250_2020480_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_004566334.1|2020608_2021049_+	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_076879559.1|2021159_2022110_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930538.1|2022106_2022580_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033446178.1|2022741_2023680_+	membrane protein	NA	NA	NA	NA	NA
WP_010930540.1|2023681_2024890_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.0	3.8e-36
WP_010930541.1|2024994_2025501_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_010930542.1|2025503_2028365_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	1.0e-71
WP_010930543.1|2028354_2029320_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_076879560.1|2029379_2031380_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.0	9.7e-21
WP_005012067.1|2031478_2032429_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	2083680	2136758	4134643	transposase	Salmonella_phage(28.57%)	49	NA	NA
WP_005013747.1|2083680_2084631_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930573.1|2084755_2085565_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_005015810.1|2085765_2086716_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931041.1|2086712_2087324_-	DUF2239 family protein	NA	NA	NA	NA	NA
WP_003812368.1|2087546_2089007_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	1.6e-97
WP_010931040.1|2089103_2090696_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.3	1.0e-17
WP_019247974.1|2091049_2091307_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003816876.1|2091308_2092649_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_010931038.1|2092744_2093434_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247976.1|2093446_2094877_+	MFS transporter	NA	NA	NA	NA	NA
WP_014905903.1|2096601_2097423_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931036.1|2097433_2099005_+	amidohydrolase	NA	NA	NA	NA	NA
WP_010931035.1|2099033_2100011_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931034.1|2100037_2100841_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	2.7e-30
WP_010931033.1|2100837_2101632_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003816890.1|2101639_2102875_+	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_010931032.1|2102867_2103302_+	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_010931031.1|2104574_2106302_-	sulfate permease	NA	NA	NA	NA	NA
WP_010931030.1|2106413_2107772_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_005013747.1|2108064_2109015_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931029.1|2109055_2110126_+	FUSC family protein	NA	NA	NA	NA	NA
WP_010931028.1|2110148_2111027_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010931027.1|2111198_2112170_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010931026.1|2112332_2113175_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931025.1|2113336_2114017_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010931024.1|2114010_2115180_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931023.1|2115176_2116208_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	27.8	1.8e-26
WP_010931022.1|2116251_2117493_+	MFS transporter	NA	NA	NA	NA	NA
WP_010931021.1|2117527_2119060_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_010931020.1|2119140_2119764_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_010931019.1|2119794_2120406_+	LysE family translocator	NA	NA	NA	NA	NA
WP_010931018.1|2120441_2120912_+	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_033456131.1|2121101_2121335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019248147.1|2121342_2122347_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_010931017.1|2122383_2123898_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931016.1|2123901_2124861_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931015.1|2124889_2125693_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931014.1|2125694_2127329_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	2.9e-15
WP_010931013.1|2127412_2128474_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004567322.1|2128672_2128942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931012.1|2128945_2129470_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	32.9	6.5e-09
WP_005012067.1|2129885_2130836_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931011.1|2130832_2131867_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_003816758.1|2131975_2132614_+	DedA family protein	NA	NA	NA	NA	NA
WP_019247724.1|2132908_2133136_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003820420.1|2133258_2133972_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010931070.1|2134216_2135167_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003816756.1|2135361_2135811_+	dUTP diphosphatase	NA	S4TNT3	Salmonella_phage	67.2	3.7e-45
WP_010929584.1|2135807_2136758_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	2229458	2281615	4134643	transposase,tRNA	Salmonella_phage(25.0%)	45	NA	NA
WP_005013747.1|2229458_2230409_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814065.1|2230575_2230929_+	cytochrome c	NA	NA	NA	NA	NA
WP_003814063.1|2230941_2231304_+	cytochrome c	NA	NA	NA	NA	NA
WP_003814061.1|2231345_2231771_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_003814059.1|2231973_2233230_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	64.8	1.2e-11
WP_003814057.1|2233428_2234409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005015028.1|2234558_2235800_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_005013747.1|2235898_2236849_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814052.1|2236857_2237553_-	two-component system response regulator KdpE	NA	NA	NA	NA	NA
WP_003814050.1|2240374_2240974_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_010930950.1|2240984_2243150_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	27.1	1.2e-24
WP_010930949.1|2243173_2244958_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_017685545.1|2244957_2245047_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_003814042.1|2245741_2246014_+	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_003814040.1|2246013_2248080_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_010929577.1|2248076_2249027_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015014.1|2249142_2249475_-	multidrug transporter	NA	NA	NA	NA	NA
WP_010929073.1|2249471_2250158_-	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_010930948.1|2250144_2251104_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.2	3.1e-57
WP_003814032.1|2251145_2253506_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.0	7.6e-81
WP_010930946.1|2253505_2254138_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_010930945.1|2254239_2255580_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.9	1.6e-75
WP_010930944.1|2255626_2256982_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	1.6e-83
WP_170954289.1|2257107_2257752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814024.1|2257696_2258014_-	virulence factor	NA	NA	NA	NA	NA
WP_003814023.1|2258286_2258802_-	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	5.1e-06
WP_003814022.1|2258895_2259057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019248325.1|2259072_2259828_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_019247690.1|2260166_2260373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814020.1|2260380_2261040_-	NAAT family transporter	NA	NA	NA	NA	NA
WP_010930941.1|2261334_2263539_-	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_010930940.1|2263649_2264873_-	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_003814017.1|2264995_2265970_-	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_005013753.1|2266037_2267231_-	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_003814016.1|2267245_2268046_-	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_010930939.1|2268042_2269899_-	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_003814014.1|2269895_2270501_-	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_003814013.1|2270519_2271905_-	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_019248324.1|2272630_2273836_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003814011.1|2273924_2274707_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_010929577.1|2274805_2275756_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2275854_2276805_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814010.1|2276831_2277605_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_003814009.1|2277616_2278858_+	MFS transporter	NA	NA	NA	NA	NA
WP_005012067.1|2280664_2281615_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	2484708	2536345	4134643	transposase	Erysipelothrix_phage(33.33%)	45	NA	NA
WP_005013747.1|2484708_2485659_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930731.1|2486529_2487402_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010930732.1|2487479_2488619_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930733.1|2488977_2490234_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_003816691.1|2490239_2490767_+	aromatic-ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_003816690.1|2490771_2491590_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003816687.1|2491589_2492312_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930735.1|2492333_2492648_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_010930736.1|2492665_2493814_+	CoA transferase	NA	NA	NA	NA	NA
WP_010930737.1|2493844_2494720_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003816680.1|2494716_2496036_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_014486081.1|2496108_2497305_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
WP_010930739.1|2497315_2498803_-	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_029443852.1|2501397_2502297_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023852887.1|2502434_2503400_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015810.1|2503498_2504449_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|2504670_2505621_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812024.1|2505617_2505920_-	SelT/SelW/SelH family protein	NA	NA	NA	NA	NA
WP_003812026.1|2506079_2506484_+	group III truncated hemoglobin	NA	NA	NA	NA	NA
WP_010930743.1|2506476_2507703_+	NnrS family protein	NA	NA	NA	NA	NA
WP_003812030.1|2507699_2508146_+	membrane protein	NA	NA	NA	NA	NA
WP_003812032.1|2508215_2508998_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_010930744.1|2509039_2510545_+	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_019247851.1|2510830_2511664_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930745.1|2513101_2513923_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010930746.1|2513941_2514796_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_003812044.1|2514799_2515771_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247855.1|2516455_2516632_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005013747.1|2516957_2517908_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812172.1|2519205_2519502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930747.1|2519676_2521029_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.4	8.5e-45
WP_010930525.1|2521171_2522188_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930748.1|2524167_2525181_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_010930749.1|2525267_2526173_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003812179.1|2526329_2526674_+	exported protein	NA	NA	NA	NA	NA
WP_010930750.1|2526831_2527290_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_010930751.1|2527303_2529520_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_003812183.1|2529516_2530578_+	XdhC family protein	NA	NA	NA	NA	NA
WP_010930752.1|2530606_2531581_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930753.1|2531532_2532351_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.8	2.3e-16
WP_003812191.1|2532363_2532972_-	LON peptidase substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010930754.1|2533146_2533542_+	VOC family protein	NA	NA	NA	NA	NA
WP_010930755.1|2533560_2535000_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	37.4	7.4e-55
WP_003812199.1|2535028_2535376_+	GFA family protein	NA	NA	NA	NA	NA
WP_010929577.1|2535394_2536345_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	2572691	2641067	4134643	transposase,tRNA,protease	Klosneuvirus(22.22%)	59	NA	NA
WP_005013747.1|2572691_2573642_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_047122784.1|2573601_2574015_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	59.0	3.8e-36
WP_003816708.1|2574299_2574599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930783.1|2575008_2577291_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.1	3.2e-36
WP_124740709.1|2577756_2577951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033461429.1|2577976_2580007_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.9	1.0e-65
WP_006218592.1|2580026_2580239_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003810720.1|2580516_2581056_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_023852902.1|2581169_2582465_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	33.5	3.0e-63
WP_019248030.1|2582541_2583699_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_010930787.1|2583882_2584782_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_010930788.1|2584800_2586105_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_010930789.1|2586070_2587177_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003810707.1|2587264_2587501_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_010930790.1|2587639_2588710_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	25.7	2.5e-15
WP_003810703.1|2588713_2590069_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_003810701.1|2590095_2591256_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_010930791.1|2591258_2591897_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_023995843.1|2591898_2593185_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010930793.1|2593243_2594539_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_003810693.1|2594545_2595052_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004568542.1|2595048_2596197_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_003810689.1|2596224_2596650_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.2	2.1e-21
WP_010930794.1|2596972_2599855_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	3.7e-138
WP_023852900.1|2599947_2600703_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_010930796.1|2601468_2602818_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_010930048.1|2602916_2603867_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930594.1|2603940_2604414_+	RidA family protein	NA	NA	NA	NA	NA
WP_010930593.1|2604439_2605648_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_003816734.1|2605644_2606418_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_014905757.1|2606417_2607041_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_010926757.1|2607206_2607467_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_010930591.1|2607770_2608352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004568544.1|2608418_2608673_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_010930590.1|2608659_2611284_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.4	1.7e-81
WP_010930589.1|2611355_2612174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003810661.1|2612170_2612776_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_010930588.1|2612813_2613947_-	general secretion pathway protein	NA	NA	NA	NA	NA
WP_010930587.1|2615662_2616037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930586.1|2616134_2617409_-	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_010930585.1|2617412_2618990_-	lipoprotein	NA	NA	NA	NA	NA
WP_010930584.1|2619896_2621252_-	amidase	NA	NA	NA	NA	NA
WP_010930583.1|2621248_2622883_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	8.2e-18
WP_010930582.1|2622875_2623706_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003810637.1|2623723_2624668_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930581.1|2624720_2626295_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019247553.1|2626342_2626702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247554.1|2626694_2627015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247555.1|2627130_2628063_+	acyclic terpene utilization AtuA family protein	NA	NA	NA	NA	NA
WP_003818676.1|2628165_2629122_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003810623.1|2629271_2630609_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_010930578.1|2630613_2631870_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_010930577.1|2632065_2633112_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_003818672.1|2633169_2633538_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_010930576.1|2633668_2634541_-	MOSC N-terminal beta barrel domain-containing protein	NA	NA	NA	NA	NA
WP_003818670.1|2634617_2635520_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014905734.1|2636576_2637794_-	four-carbon acid sugar kinase family protein	NA	NA	NA	NA	NA
WP_010929577.1|2639067_2640018_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2640116_2641067_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	2788396	2845370	4134643	transposase,protease	Streptococcus_phage(20.0%)	44	NA	NA
WP_005012067.1|2788396_2789347_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812014.1|2789445_2789880_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_010931098.1|2789962_2792299_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	42.8	3.2e-124
WP_010930525.1|2792490_2793507_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003819753.1|2793697_2794288_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931097.1|2794378_2794684_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_023853546.1|2795151_2796159_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_010931095.1|2796155_2797031_+	membrane protein	NA	NA	NA	NA	NA
WP_010931094.1|2797105_2798506_-	MFS transporter	NA	NA	NA	NA	NA
WP_003809348.1|2798583_2799087_-	peroxiredoxin	NA	M1I839	Pelagibacter_phage	44.1	1.8e-24
WP_010931092.1|2799333_2799765_+	lipoprotein	NA	NA	NA	NA	NA
WP_010931091.1|2799774_2800659_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_010931090.1|2800676_2804138_-	DUF748 domain-containing protein	NA	NA	NA	NA	NA
WP_003819741.1|2804273_2804759_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_003819740.1|2804739_2804991_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_010931089.1|2804987_2805479_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_010931088.1|2805475_2805997_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_010931087.1|2806003_2807209_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_010931086.1|2807353_2808451_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_010931085.1|2808461_2809568_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010929956.1|2809702_2810653_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931099.1|2810649_2811444_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_010931100.1|2811475_2812180_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931101.1|2812254_2813055_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_003809276.1|2813051_2813459_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003819722.1|2813455_2814097_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_010931102.1|2814089_2816090_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010931103.1|2817350_2818682_+	MFS transporter	NA	NA	NA	NA	NA
WP_005012067.1|2818678_2819629_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931105.1|2821335_2821602_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_003812839.1|2822309_2822648_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_010931107.1|2827202_2827805_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931108.1|2827901_2829191_+	MFS transporter	NA	NA	NA	NA	NA
WP_003812846.1|2829248_2829980_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.4e-12
WP_010931109.1|2829976_2830780_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.5	7.9e-14
WP_003812851.1|2830776_2831865_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003820410.1|2831861_2832791_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003812857.1|2832939_2834085_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015810.1|2834106_2835057_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931110.1|2835387_2839209_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010931111.1|2839365_2840034_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_014905522.1|2840038_2841712_-	MCE family protein	NA	NA	NA	NA	NA
WP_003820402.1|2841730_2843050_-	PqiA/YebS family transporter subunit	NA	NA	NA	NA	NA
WP_010931114.1|2843054_2845370_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.1e-164
>prophage 21
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	2852869	2916512	4134643	transposase,protease	uncultured_Mediterranean_phage(22.22%)	58	NA	NA
WP_003820400.1|2852869_2853184_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	1.2e-10
WP_003812875.1|2853411_2853657_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	76.6	1.3e-20
WP_003820399.1|2853751_2854270_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	5.1e-14
WP_010931117.1|2854369_2855575_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_019247560.1|2855690_2857088_-	chloride channel protein	NA	NA	NA	NA	NA
WP_010931119.1|2857204_2857783_-	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_010931120.1|2857855_2859247_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	32.0	1.4e-29
WP_005012067.1|2859414_2860365_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812889.1|2860645_2861266_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010931122.1|2861262_2861676_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_010931123.1|2861672_2862716_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_003812895.1|2862771_2862960_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_010931124.1|2862969_2863734_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_010931125.1|2863824_2864481_+	adenylate kinase	NA	NA	NA	NA	NA
WP_010931126.1|2864572_2865331_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010931127.1|2865356_2866958_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_010931128.1|2867158_2868163_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_003812908.1|2868263_2868527_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_010931129.1|2868644_2869421_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_005012067.1|2870011_2870962_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812917.1|2873345_2874458_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_005012808.1|2874514_2875465_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003813070.1|2875673_2875895_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_010931131.1|2876108_2877515_-	threonine synthase	NA	NA	NA	NA	NA
WP_003813074.1|2877511_2878816_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_010931132.1|2878812_2880000_-	alanine transaminase	NA	NA	NA	NA	NA
WP_003813077.1|2880216_2880669_+	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_003813079.1|2880671_2881136_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_003813082.1|2881215_2882895_+	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	36.9	1.5e-70
WP_003813085.1|2882999_2883977_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_019248137.1|2884056_2885025_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_003813089.1|2885045_2886419_-	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	58.2	4.0e-135
WP_019248136.1|2886415_2887252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931135.1|2887368_2887824_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_003813094.1|2887839_2888112_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003813095.1|2888204_2888528_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_010926331.1|2888575_2888956_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003813103.1|2889175_2889973_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_010931136.1|2890129_2891992_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_003820295.1|2892041_2892953_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003813109.1|2892957_2893224_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_010931137.1|2893310_2894180_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931138.1|2894315_2895281_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003813114.1|2895451_2896462_+	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.6	3.6e-16
WP_010931139.1|2896609_2897761_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_003814555.1|2898903_2900376_-	magnesium transporter	NA	NA	NA	NA	NA
WP_003814554.1|2900386_2900797_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_010929220.1|2900860_2901907_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_003814552.1|2902013_2902892_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931140.1|2902905_2904102_-	amidohydrolase	NA	NA	NA	NA	NA
WP_023852727.1|2904178_2905855_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	28.1	9.3e-33
WP_005012067.1|2905851_2906802_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023852715.1|2906922_2907819_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_003814547.1|2910096_2912322_+	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_003814544.1|2912486_2913575_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.4	8.7e-32
WP_019248416.1|2913531_2914185_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931144.1|2914232_2915030_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930176.1|2915561_2916512_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	2926553	2977873	4134643	transposase	Ostreococcus_lucimarinus_virus(16.67%)	47	NA	NA
WP_023852748.1|2926553_2927792_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931152.1|2927833_2929096_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_010931153.1|2929102_2929855_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_019248355.1|2929906_2930092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003820813.1|2930367_2930832_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_003820814.1|2930863_2931523_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_010931154.1|2931667_2933776_+	AsmA family protein	NA	NA	NA	NA	NA
WP_010931155.1|2933777_2934398_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931156.1|2934489_2935242_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019248356.1|2936376_2937501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247402.1|2937546_2937915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930176.1|2938156_2939107_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247492.1|2940142_2940685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2941070_2942021_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023997028.1|2942017_2942983_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003815281.1|2943052_2943889_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0P0BXC9	Ostreococcus_lucimarinus_virus	33.3	1.6e-33
WP_010931158.1|2944401_2945511_+	porin	NA	NA	NA	NA	NA
WP_005012067.1|2945572_2946523_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931159.1|2946715_2947498_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931160.1|2947511_2948261_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.4	1.2e-11
WP_010931161.1|2948288_2949635_-	MFS transporter	NA	NA	NA	NA	NA
WP_010931162.1|2949660_2950590_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003819549.1|2950705_2951611_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931163.1|2951628_2952828_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_010931164.1|2952900_2953593_-	HD domain-containing protein	NA	A0A1D6Y7U0	Golden_Marseillevirus	29.9	4.7e-07
WP_010931165.1|2953641_2956068_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.8	1.2e-86
WP_005013747.1|2956112_2957063_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809026.1|2957279_2957648_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_003809025.1|2957934_2958861_+	VOC family protein	NA	NA	NA	NA	NA
WP_010931167.1|2958904_2959915_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_010931168.1|2959911_2960346_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_019248105.1|2961471_2962260_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.0	6.7e-34
WP_010931170.1|2962269_2963052_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931171.1|2963055_2964147_-	DUF2817 domain-containing protein	NA	NA	NA	NA	NA
WP_010931172.1|2964252_2965728_+	acyl--CoA ligase	NA	Q75ZG1	Hepacivirus	25.6	3.0e-35
WP_010931173.1|2965869_2966418_+	cysteine dioxygenase family protein	NA	NA	NA	NA	NA
WP_003809010.1|2966433_2966895_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931174.1|2966995_2967985_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931175.1|2968283_2968985_+	riboflavin synthase	NA	NA	NA	NA	NA
WP_010931176.1|2969023_2970397_-	amidase	NA	NA	NA	NA	NA
WP_023997744.1|2970435_2971722_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931177.1|2972608_2973511_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_010931178.1|2973458_2974679_-	MFS transporter	NA	NA	NA	NA	NA
WP_010931179.1|2974675_2975185_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_010926062.1|2975174_2975870_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_010931181.1|2975940_2976810_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930208.1|2976922_2977873_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	3033999	3088327	4134643	transposase,tRNA,protease	Clostridium_phage(16.67%)	55	NA	NA
WP_010931196.1|3033999_3035460_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_010931197.1|3035470_3036301_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_010931198.1|3036425_3036797_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012067.1|3036895_3037846_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809257.1|3037944_3038748_-	anti-sigma factor	NA	NA	NA	NA	NA
WP_004568255.1|3038744_3039272_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003809253.1|3039322_3039691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003809252.1|3039891_3040374_-	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_003819714.1|3040504_3040957_+	CopD family protein	NA	NA	NA	NA	NA
WP_003819713.1|3040964_3041378_-	VOC family protein	NA	NA	NA	NA	NA
WP_023853532.1|3041499_3042174_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	30.0	2.7e-07
WP_020699651.1|3042388_3043618_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_033461698.1|3043620_3045090_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_010931202.1|3045101_3047300_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004568261.1|3047462_3047900_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_010931203.1|3048201_3048498_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_023853526.1|3048509_3049379_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_010931205.1|3049393_3050149_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_010931206.1|3050152_3050650_+	DoxX family protein	NA	NA	NA	NA	NA
WP_010931207.1|3050681_3052112_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	35.0	6.5e-51
WP_003809223.1|3052250_3052598_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003809222.1|3052718_3053066_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003809221.1|3053065_3053677_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_010931208.1|3053680_3055660_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_033461695.1|3055663_3056578_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003809217.1|3056786_3057341_-	response regulator	NA	NA	NA	NA	NA
WP_010931210.1|3057337_3058549_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_023998300.1|3058743_3059652_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010931212.1|3059889_3060756_-	pirin family protein	NA	NA	NA	NA	NA
WP_010931213.1|3061514_3062321_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931214.1|3062374_3063733_+	MFS transporter	NA	NA	NA	NA	NA
WP_023999042.1|3063729_3064851_-	CoA transferase	NA	NA	NA	NA	NA
WP_003819684.1|3064977_3065889_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931216.1|3065912_3066902_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931217.1|3066926_3067394_-	MaoC family dehydratase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_019247777.1|3067407_3067869_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010931218.1|3068080_3068788_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|3068907_3069858_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005015810.1|3069956_3070907_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_047122802.1|3071052_3072177_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.3	3.8e-38
WP_023853315.1|3072382_3072946_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_003814871.1|3073940_3074423_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_003814873.1|3074580_3075828_-	serine hydroxymethyltransferase	NA	A0A219YCZ0	Aeromonas_phage	52.7	1.1e-99
WP_003820605.1|3076044_3076701_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_003814877.1|3076736_3077966_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005012067.1|3078233_3079184_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931221.1|3079275_3080691_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	46.9	1.9e-18
WP_010931222.1|3080696_3081833_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_003814883.1|3081902_3082274_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	56.9	4.7e-30
WP_010931223.1|3082361_3083108_-	membrane protein	NA	NA	NA	NA	NA
WP_003820599.1|3083144_3084209_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_010931224.1|3084397_3084790_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_010927106.1|3084799_3085228_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004567739.1|3085523_3086621_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004567741.1|3086962_3088327_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 25
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	3311290	3436315	4134643	transposase,tRNA	Acinetobacter_phage(20.0%)	102	NA	NA
WP_005012808.1|3311290_3312241_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931334.1|3313070_3313958_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931335.1|3315545_3317021_+	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013747.1|3317119_3318070_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931336.1|3318474_3319119_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_019247677.1|3319143_3319728_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_014905506.1|3319828_3320446_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_010931337.1|3320448_3322164_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_010931338.1|3322160_3322469_-	urease subunit beta	NA	NA	NA	NA	NA
WP_003814828.1|3322485_3323103_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_010931340.1|3323147_3323450_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_003814832.1|3323550_3324405_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_124740609.1|3324592_3324817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929281.1|3324986_3325259_+	MerR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010929282.1|3325676_3326084_-	GFA family protein	NA	NA	NA	NA	NA
WP_010931341.1|3326453_3327248_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010927102.1|3327348_3328584_+	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_003814852.1|3328652_3329669_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931342.1|3329680_3331057_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_003814856.1|3331053_3332250_+	MFS transporter	NA	NA	NA	NA	NA
WP_003814858.1|3332246_3333785_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_010931343.1|3333781_3335041_-	YeaH/YhbH family protein	NA	NA	NA	NA	NA
WP_010929591.1|3336981_3337932_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931344.1|3338698_3339793_-	CoA transferase	NA	NA	NA	NA	NA
WP_019248373.1|3339785_3341120_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_003808193.1|3341073_3341757_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019248372.1|3341782_3342946_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004566224.1|3342942_3343944_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931346.1|3343943_3344816_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931347.1|3344812_3345562_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.9e-09
WP_010931348.1|3345558_3346350_-	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	29.4	1.7e-08
WP_010931349.1|3346346_3347486_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047122778.1|3347761_3348547_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014486103.1|3348580_3349363_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_010931351.1|3349366_3349756_+	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_010931352.1|3350895_3351759_+	MaoC family dehydratase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010931353.1|3351794_3352883_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_005013747.1|3352879_3353830_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247959.1|3354183_3357162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003818344.1|3358088_3358967_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_005013747.1|3360915_3361866_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931354.1|3361862_3362330_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	50.7	5.6e-36
WP_010931355.1|3362372_3363143_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010927090.1|3363163_3363964_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_010931356.1|3363974_3365384_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_003814739.1|3365478_3366264_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010929632.1|3366503_3367520_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814742.1|3367627_3368020_-	OsmC family protein	NA	NA	NA	NA	NA
WP_010931357.1|3368157_3368838_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_023994844.1|3368842_3369814_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014905422.1|3369909_3370860_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814239.1|3372364_3373066_+	response regulator	NA	W8CYM9	Bacillus_phage	36.6	5.6e-32
WP_010927010.1|3373065_3374490_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_010931361.1|3375559_3376900_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003820957.1|3377015_3378779_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	50.0	5.0e-162
WP_010931362.1|3378890_3379769_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003814250.1|3379881_3380697_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003814252.1|3380700_3380952_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_010930158.1|3381036_3382053_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814254.1|3382383_3382605_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_019247693.1|3384965_3385883_-	DMT family transporter	NA	NA	NA	NA	NA
WP_019247692.1|3386380_3387589_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931365.1|3387668_3389240_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003814275.1|3389357_3390293_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003814277.1|3390481_3391426_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	8.4e-07
WP_003814283.1|3391993_3397711_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	39.5	1.0e-195
WP_010931367.1|3397716_3398844_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	37.8	3.8e-38
WP_003814287.1|3398899_3399526_+	aminotransferase class IV	NA	NA	NA	NA	NA
WP_010929632.1|3399797_3400814_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010927020.1|3400909_3401620_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931368.1|3401616_3402606_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931369.1|3402701_3404333_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_010931370.1|3404335_3405073_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247745.1|3405228_3406101_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_003814298.1|3406369_3407590_+	MFS transporter	NA	NA	NA	NA	NA
WP_003814300.1|3407586_3408246_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_003814302.1|3408317_3408950_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_010931372.1|3408979_3409498_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_010931373.1|3409508_3410618_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003814312.1|3410664_3411519_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_010931374.1|3411520_3412423_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|3413645_3414596_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014905441.1|3416352_3417342_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247413.1|3417338_3417497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931375.1|3417517_3418306_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	53.0	5.1e-66
WP_003817833.1|3418302_3419334_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.7	7.4e-73
WP_003815390.1|3419352_3419916_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	1.1e-65
WP_019248071.1|3419971_3421492_-	anthranilate synthase component I	NA	S4VNU7	Pandoravirus	32.0	3.1e-43
WP_010931377.1|3421755_3422460_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003815384.1|3422467_3423205_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003815381.1|3423310_3423685_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003815379.1|3423727_3425017_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_010931378.1|3425013_3426183_+	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_010931379.1|3426179_3427019_+	thiol:disulfide interchange protein DsbC	NA	NA	NA	NA	NA
WP_010931380.1|3427078_3428014_+	D-2-hydroxyacid dehydrogenase family protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.7	6.4e-15
WP_005012067.1|3428026_3428977_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931381.1|3429075_3430038_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.5	4.6e-93
WP_003817821.1|3430069_3430429_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_010931382.1|3430553_3431456_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	24.0	1.9e-08
WP_010931383.1|3431457_3433230_-	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_003815367.1|3433264_3434041_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_005012808.1|3435364_3436315_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	3451253	3516670	4134643	transposase	Planktothrix_phage(66.67%)	51	NA	NA
WP_005012067.1|3451253_3452204_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931392.1|3452333_3453467_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931393.1|3453510_3454416_-	hydrolase	NA	NA	NA	NA	NA
WP_023852622.1|3454418_3456119_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.0e-15
WP_010931394.1|3456115_3457036_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003817805.1|3457043_3458021_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014905459.1|3458079_3459123_-	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_003815317.1|3461097_3461334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931396.1|3461460_3462324_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003815315.1|3462412_3463234_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003815313.1|3463313_3464051_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931397.1|3464047_3465040_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003817794.1|3465153_3465816_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931399.1|3465860_3467009_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005012067.1|3469332_3470283_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931400.1|3470381_3471332_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927663.1|3471672_3472623_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3472721_3473672_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012808.1|3473763_3474714_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929184.1|3476851_3478081_+	spore maturation protein	NA	NA	NA	NA	NA
WP_003814419.1|3478083_3479526_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_010931414.1|3479630_3480776_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.2	1.7e-41
WP_010931413.1|3480807_3481605_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_010931412.1|3481629_3483189_-	chaperone SurA	NA	NA	NA	NA	NA
WP_010931411.1|3483185_3485558_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_010931410.1|3485667_3486771_+	phosphotransferase	NA	NA	NA	NA	NA
WP_010931409.1|3486770_3487463_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003814436.1|3487606_3488308_+	membrane protein	NA	NA	NA	NA	NA
WP_003814437.1|3488292_3488670_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_005012067.1|3489401_3490352_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814441.1|3490511_3491384_-	oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_003814443.1|3491724_3491943_+	DUF1059 domain-containing protein	NA	NA	NA	NA	NA
WP_010929975.1|3491982_3493362_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_010929976.1|3493403_3494801_-	amidase family protein	NA	NA	NA	NA	NA
WP_010927038.1|3494840_3496493_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	6.0e-16
WP_010929977.1|3496496_3497381_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010929978.1|3497380_3498322_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010929980.1|3500186_3501002_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814459.1|3501069_3501639_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|3501639_3502590_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814461.1|3503244_3504342_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_003814462.1|3504375_3505641_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005012067.1|3505798_3506749_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929982.1|3506992_3507583_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_010929983.1|3507598_3510043_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_003814467.1|3510162_3511134_-	FecR family protein	NA	NA	NA	NA	NA
WP_023852739.1|3511265_3511790_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005012067.1|3511749_3512700_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929984.1|3512921_3515117_-	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_010929985.1|3515189_3515618_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|3515719_3516670_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	3567214	3621563	4134643	transposase	Lake_Baikal_phage(14.29%)	46	NA	NA
WP_005012067.1|3567214_3568165_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929806.1|3568286_3569540_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929805.1|3569517_3570480_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929804.1|3570611_3571106_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_010929803.1|3571105_3572338_+	CoA transferase	NA	NA	NA	NA	NA
WP_019247316.1|3573083_3573365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929802.1|3573351_3574338_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929801.1|3574481_3574886_+	RidA family protein	NA	NA	NA	NA	NA
WP_010929800.1|3575027_3578414_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010929799.1|3578444_3579908_+	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_019248869.1|3579928_3581545_+	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010929797.1|3581630_3582290_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929796.1|3582319_3582760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929795.1|3583270_3583474_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	5.8e-14
WP_010929794.1|3583649_3584555_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|3584653_3585604_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|3588525_3589476_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929793.1|3589574_3590603_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_019247419.1|3590629_3591802_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003814681.1|3591927_3592905_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814685.1|3592915_3593887_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929791.1|3593953_3594739_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_003814691.1|3594731_3595964_-	CoA transferase	NA	NA	NA	NA	NA
WP_003814694.1|3596159_3596915_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	40.8	2.9e-42
WP_010929789.1|3597025_3597544_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.9	2.1e-12
WP_010929788.1|3599332_3600733_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_003820700.1|3600832_3601177_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_003814701.1|3601265_3601736_+	universal stress protein	NA	NA	NA	NA	NA
WP_019247421.1|3602146_3602545_+	GTP-binding protein	NA	E4ZFJ7	Streptococcus_phage	44.3	9.0e-19
WP_010929577.1|3602676_3603627_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814730.1|3606071_3606806_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	43.8	1.4e-41
WP_003814728.1|3607215_3607395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814726.1|3607585_3608899_+	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_010929786.1|3608914_3610426_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010929785.1|3610422_3611628_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_022997984.1|3611823_3612801_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_033446199.1|3612893_3613388_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003814720.1|3613517_3614576_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	40.5	2.8e-59
WP_010927086.1|3614572_3616192_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_157734664.1|3616151_3616424_-	GtrA family protein	NA	NA	NA	NA	NA
WP_010929784.1|3616379_3617483_+	ChbG/HpnK family deacetylase	NA	NA	NA	NA	NA
WP_010929783.1|3617479_3617935_+	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_003814709.1|3617940_3618864_-	alpha/beta fold hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	27.2	4.8e-07
WP_010929782.1|3618953_3619613_-	LysE family translocator	NA	NA	NA	NA	NA
WP_047122777.1|3619609_3620524_-	DMT family transporter	NA	NA	NA	NA	NA
WP_010929577.1|3620612_3621563_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	3848869	3904982	4134643	transposase,tRNA,protease	Bacillus_phage(28.57%)	46	NA	NA
WP_003815821.1|3848869_3849319_+|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
WP_010929719.1|3849837_3849978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929718.1|3849985_3850147_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|3850424_3851375_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929717.1|3852418_3852697_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_010929716.1|3853839_3854388_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.1	1.3e-28
WP_010929715.1|3854450_3856130_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	27.6	3.6e-16
WP_010929714.1|3856126_3857878_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.8	3.4e-09
WP_003817696.1|3857874_3858000_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_004567834.1|3858013_3859168_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_010929713.1|3859183_3860803_-	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010929712.1|3860886_3861432_-	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929711.1|3863666_3864647_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929710.1|3864660_3865785_+	CoA transferase	NA	NA	NA	NA	NA
WP_003814321.1|3865792_3867547_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_010929709.1|3867653_3868553_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814324.1|3868617_3869601_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_010929708.1|3869736_3870717_+	AEC family transporter	NA	NA	NA	NA	NA
WP_010929707.1|3870733_3872125_-	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_010929706.1|3872276_3872813_+|tRNA	bifunctional alanine racemase/tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_019247543.1|3872743_3874129_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	30.3	4.5e-17
WP_003814332.1|3874271_3874910_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_033461782.1|3874996_3876886_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.8	2.5e-79
WP_003814337.1|3876882_3877824_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003814339.1|3877929_3878979_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.6	5.6e-68
WP_010929704.1|3879231_3879933_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_010929703.1|3879929_3880628_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_010929702.1|3880628_3881984_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.8	3.4e-25
WP_010929701.1|3881980_3882472_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003814351.1|3882490_3883447_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003814355.1|3884857_3886960_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_003814356.1|3887130_3888174_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003814358.1|3888217_3888961_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814363.1|3889982_3890393_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_010929700.1|3891342_3892140_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005012808.1|3892238_3893189_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_039251057.1|3893161_3894103_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3894099_3895050_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929681.1|3895164_3896166_-	HindIII family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_010929682.1|3896256_3896823_-	preprotein translocase subunit SecD	NA	NA	NA	NA	NA
WP_010929683.1|3897141_3899055_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_010929684.1|3899096_3900527_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_019247308.1|3900639_3902052_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003818947.1|3902068_3902764_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|3902982_3903933_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|3904031_3904982_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP012128	Bordetella pertussis strain B203 chromosome, complete genome	4134643	4036925	4110246	4134643	transposase,protease	uncultured_Mediterranean_phage(16.67%)	55	NA	NA
WP_005012067.1|4036925_4037876_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931563.1|4037872_4039063_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_010931562.1|4039184_4039949_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_003807735.1|4040035_4041139_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_010930158.1|4041330_4042347_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003815102.1|4042628_4043117_+	D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	34.1	1.6e-17
WP_003817656.1|4044460_4045141_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.8	3.5e-15
WP_010931560.1|4045202_4046054_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_010931559.1|4046050_4046848_-	thiazole synthase	NA	NA	NA	NA	NA
WP_010931558.1|4046951_4047845_-	cobalamin-binding protein	NA	NA	NA	NA	NA
WP_010931557.1|4047856_4049746_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	30.8	7.6e-07
WP_010931556.1|4050082_4053856_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	50.8	8.6e-10
WP_005012067.1|4053852_4054803_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929826.1|4055111_4055804_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	41.6	6.3e-36
WP_003818232.1|4056177_4056678_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_023853391.1|4056784_4057705_+	bestrophin	NA	NA	NA	NA	NA
WP_010929823.1|4057721_4058198_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929822.1|4058291_4060142_+	biosynthetic-type acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	30.4	2.2e-59
WP_010929821.1|4060197_4060956_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929820.1|4060983_4062417_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003818225.1|4062490_4063270_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929819.1|4063282_4064116_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_020699616.1|4064124_4064895_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.9	8.1e-24
WP_010929818.1|4064894_4065959_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929817.1|4066110_4068738_-	DNA topoisomerase III	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	25.4	6.1e-23
WP_010929816.1|4068801_4071423_+	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_003815964.1|4072350_4072809_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_010929815.1|4073087_4075331_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_010929814.1|4075527_4077552_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_019248007.1|4077675_4078638_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010929812.1|4078849_4079989_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_010929811.1|4080011_4080977_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_004565905.1|4081172_4082363_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.4e-21
WP_003815955.1|4082376_4082622_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_010929810.1|4082650_4084672_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_003815953.1|4084718_4086326_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	57.3	5.4e-22
WP_010929808.1|4086426_4087596_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_005013747.1|4090477_4091428_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929699.1|4091584_4091908_+	phosphate starvation-inducible protein	NA	NA	NA	NA	NA
WP_023853200.1|4092012_4093053_-	cyclase family protein	NA	NA	NA	NA	NA
WP_010929697.1|4093058_4093838_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_003807672.1|4093883_4094180_-	YciI family protein	NA	NA	NA	NA	NA
WP_003807674.1|4094205_4094481_-	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
WP_003819086.1|4094537_4095182_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_010929696.1|4095181_4095868_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_010929695.1|4095997_4096849_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929694.1|4096899_4097625_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929693.1|4097656_4099006_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_010929692.1|4099117_4100050_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033454003.1|4100507_4103303_-|protease	serine protease autotransporter SphB1	protease	NA	NA	NA	NA
WP_010929690.1|4103896_4106839_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_010929689.1|4106910_4107630_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	43.9	8.0e-50
WP_010929688.1|4107668_4108217_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	41.7	1.2e-21
WP_019248089.1|4108371_4109271_+	virginiamycin B lyase	NA	NA	NA	NA	NA
WP_005012808.1|4109295_4110246_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
