The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016534	Planococcus antarcticus DSM 14505 chromosome, complete genome	3765545	681664	724299	3765545	integrase,transposase,protease	Enterobacteria_phage(25.0%)	41	676042:676056	722165:722179
676042:676056	attL	AAAGAGCACCAAAAA	NA	NA	NA	NA
WP_065537279.1|681664_682489_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_169314363.1|682699_682873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083387817.1|683431_685360_+	peptidoglycan glycosyltransferase	NA	NA	NA	NA	NA
WP_040851874.1|685793_686180_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006828573.1|686218_687514_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_006828572.1|687696_688752_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_065537277.1|688860_689349_+	DUF4306 domain-containing protein	NA	NA	NA	NA	NA
WP_040851851.1|689555_689735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040851849.1|689805_690072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154669118.1|690318_690654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006828569.1|690962_692459_+	flotillin family protein	NA	NA	NA	NA	NA
WP_065537276.1|692829_694389_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_006828567.1|694348_696157_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	29.0	7.4e-20
WP_065537275.1|696305_697604_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_006828565.1|697713_698655_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_065537274.1|698651_699479_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_065537273.1|699845_702056_+	alpha-galactosidase	NA	NA	NA	NA	NA
WP_065537272.1|702361_704395_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_006828561.1|704609_705155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006828560.1|705266_705458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006828559.1|705465_705909_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_083387739.1|706115_706364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065537271.1|706353_706605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065537270.1|706847_708167_+	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_083387740.1|708466_709330_+	cell envelope integrity protein TolA	NA	A0A0K0MWU9	Gordonia_phage	72.2	2.2e-06
WP_065537268.1|709403_709727_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065537267.1|710037_710262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065537266.1|710620_710908_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_065537265.1|711642_713508_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_065537264.1|713551_715606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065537263.1|715810_716947_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_083387742.1|717132_717420_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_065537261.1|717720_718242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154669119.1|718395_718485_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_065537260.1|718540_718741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154669120.1|718765_719335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006831608.1|719947_720460_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065537257.1|720983_721229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154669121.1|721359_721500_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_065537256.1|721884_722748_+	DUF4352 domain-containing protein	NA	A0A1B1P898	Bacillus_phage	33.3	2.2e-09
722165:722179	attR	TTTTTGGTGCTCTTT	NA	NA	NA	NA
WP_065537255.1|722982_724299_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	49.8	1.6e-112
>prophage 2
NZ_CP016534	Planococcus antarcticus DSM 14505 chromosome, complete genome	3765545	993621	1001260	3765545		Synechococcus_phage(33.33%)	7	NA	NA
WP_006830152.1|993621_994917_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.5	2.1e-16
WP_006830151.1|994932_995649_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SCX8	Cyanophage	42.4	3.8e-44
WP_006830150.1|995645_995900_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	32.9	8.0e-05
WP_006830149.1|995896_996580_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_006830148.1|996563_998789_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.2	4.2e-166
WP_006830147.1|998764_1000186_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.7	2.6e-52
WP_006830146.1|1000198_1001260_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.1	6.7e-61
>prophage 3
NZ_CP016534	Planococcus antarcticus DSM 14505 chromosome, complete genome	3765545	1295530	1305299	3765545		Staphylococcus_phage(85.71%)	9	NA	NA
WP_065537093.1|1295530_1296592_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	26.8	3.6e-22
WP_006831229.1|1297665_1298334_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_065537092.1|1298409_1299450_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006831231.1|1299537_1299768_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	65.2	7.2e-21
WP_006831232.1|1299875_1300322_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	63.0	1.9e-46
WP_006831233.1|1300388_1300847_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	37.3	1.3e-18
WP_006831234.1|1300827_1301607_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	37.6	9.3e-36
WP_006831235.1|1301695_1303285_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	62.2	3.8e-185
WP_006831236.1|1304102_1305299_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	75.9	7.5e-162
>prophage 4
NZ_CP016534	Planococcus antarcticus DSM 14505 chromosome, complete genome	3765545	1331812	1340124	3765545		Staphylococcus_phage(33.33%)	8	NA	NA
WP_065537396.1|1331812_1332571_+	TerC family protein	NA	S5MAL1	Bacillus_phage	41.8	2.1e-32
WP_065537075.1|1332659_1334549_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	35.0	3.5e-97
WP_065537074.1|1334580_1335123_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	37.7	1.0e-20
WP_065537073.1|1335295_1336756_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.3	1.5e-140
WP_065537072.1|1336779_1337199_+	universal stress protein	NA	NA	NA	NA	NA
WP_065537071.1|1337255_1338548_+	MFS transporter	NA	NA	NA	NA	NA
WP_006830842.1|1338610_1339174_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	45.2	6.3e-42
WP_083387755.1|1339170_1340124_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	75.6	9.9e-56
>prophage 5
NZ_CP016534	Planococcus antarcticus DSM 14505 chromosome, complete genome	3765545	1536678	1547823	3765545		uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_065537020.1|1536678_1538955_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.7	5.1e-34
WP_006828751.1|1539031_1539385_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_006828750.1|1539470_1539761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083387760.1|1540801_1542847_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.8	2.4e-75
WP_065537018.1|1542837_1543350_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.2	9.4e-29
WP_065537017.1|1543444_1544998_+	pectate lyase	NA	D6R401	Bacillus_phage	40.5	2.7e-103
WP_065537016.1|1545025_1545550_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	30.9	7.7e-18
WP_065537015.1|1545630_1547823_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	34.4	1.1e-09
>prophage 6
NZ_CP016534	Planococcus antarcticus DSM 14505 chromosome, complete genome	3765545	1739253	1793938	3765545	integrase,transposase	Bacillus_virus(50.0%)	59	1732577:1732591	1768119:1768133
1732577:1732591	attL	AAAAAGCGCAATCAT	NA	NA	NA	NA
WP_065536538.1|1739253_1740213_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_065536948.1|1742716_1743427_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_065536947.1|1743451_1743775_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_065536946.1|1743767_1744268_+	DUF1453 family protein	NA	NA	NA	NA	NA
WP_065536945.1|1744282_1744717_-	DUF2621 domain-containing protein	NA	NA	NA	NA	NA
WP_065536944.1|1744836_1745055_+	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
WP_065536943.1|1745077_1745293_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_006831430.1|1745879_1746008_+	YvrJ family protein	NA	NA	NA	NA	NA
WP_065536942.1|1746102_1746666_+	SCO family protein	NA	NA	NA	NA	NA
WP_065536941.1|1746674_1747043_-	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_065536940.1|1747200_1747839_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_065536939.1|1747877_1748138_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_006831423.1|1748228_1748771_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.7	9.3e-27
WP_006831422.1|1749044_1749905_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_006831421.1|1750127_1750619_+	DinB family protein	NA	NA	NA	NA	NA
WP_006831420.1|1750760_1753475_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_006831419.1|1753727_1754168_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_006831418.1|1754151_1754460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006831417.1|1754475_1754766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006831416.1|1754786_1755380_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_040852984.1|1755510_1755924_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_065536938.1|1756043_1758014_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.3	1.6e-124
WP_065536937.1|1758010_1760437_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.6	3.1e-98
WP_065536936.1|1760949_1762239_+	threonine ammonia-lyase IlvA	NA	NA	NA	NA	NA
WP_065537383.1|1762453_1762981_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_065536935.1|1763211_1763640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006831216.1|1763973_1765905_+	fructose-1,6-bisphosphatase	NA	NA	NA	NA	NA
WP_065536934.1|1766384_1766876_-	DMT family transporter	NA	NA	NA	NA	NA
WP_065536933.1|1766887_1767553_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_006830708.1|1767564_1767990_-	DMT family transporter	NA	NA	NA	NA	NA
WP_006830707.1|1768370_1770425_+	GAF domain-containing protein	NA	NA	NA	NA	NA
1768119:1768133	attR	AAAAAGCGCAATCAT	NA	NA	NA	NA
WP_040852634.1|1770766_1771090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154669198.1|1771210_1771615_+	NUDIX domain-containing protein	NA	D0R7I2	Paenibacillus_phage	31.3	4.4e-05
WP_006830705.1|1771690_1772143_-	DUF305 domain-containing protein	NA	NA	NA	NA	NA
WP_006830704.1|1772415_1773276_+	phosphotransferase	NA	NA	NA	NA	NA
WP_065536932.1|1773351_1774251_+	DMT family transporter	NA	NA	NA	NA	NA
WP_169314379.1|1774931_1775945_-	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_006830700.1|1776071_1776977_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_154669139.1|1777552_1778696_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	56.1	1.1e-80
WP_154669199.1|1778724_1778766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006830695.1|1779315_1779660_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065536931.1|1779649_1780393_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_065536930.1|1780577_1780997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006830692.1|1781486_1781828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006830691.1|1782349_1783282_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_065536929.1|1783481_1783868_+	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_083387766.1|1783887_1784901_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_154669140.1|1784910_1785378_+	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_154669141.1|1785718_1786777_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006830686.1|1786999_1787707_+	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.0	4.3e-24
WP_006830685.1|1787652_1788504_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_006830684.1|1788556_1789129_+	dCTP deaminase	NA	Q8V6P6	Halorubrum_phage	39.7	2.7e-24
WP_006830683.1|1789286_1790042_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_065536927.1|1790117_1790909_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_006831727.1|1791129_1791327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065536926.1|1791693_1792296_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	50.6	6.9e-47
WP_083387767.1|1792374_1792539_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_006831696.1|1792646_1792874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065536925.1|1792870_1793938_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP016534	Planococcus antarcticus DSM 14505 chromosome, complete genome	3765545	2010687	2049953	3765545	transposase	Escherichia_phage(22.22%)	42	NA	NA
WP_065536840.1|2010687_2012004_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	49.8	3.5e-112
WP_006831651.1|2012321_2012708_+	hypothetical protein	NA	A0A1D3SNK9	Enterococcus_phage	60.9	1.6e-41
WP_006831650.1|2012748_2013111_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_006831649.1|2013213_2013621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006831648.1|2013624_2014098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065536839.1|2014704_2014950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006831646.1|2014950_2015751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065536348.1|2015872_2017429_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_065536310.1|2017403_2018174_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	32.5	2.7e-35
WP_083387820.1|2018168_2018687_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_065536837.1|2019746_2020364_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	28.5	2.5e-12
WP_065536836.1|2020523_2021126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065536835.1|2021137_2022031_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_065536834.1|2022338_2022962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006831552.1|2023697_2024144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006831551.1|2024161_2024488_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065536833.1|2024860_2025529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154669139.1|2025706_2026850_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	56.1	1.1e-80
WP_006828299.1|2028418_2029285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006828300.1|2029281_2029590_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_006828301.1|2029607_2030492_-	type II CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_006828302.1|2030488_2034490_-	type II CRISPR RNA-guided endonuclease Cas9	NA	NA	NA	NA	NA
WP_040851709.1|2035068_2035923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006828304.1|2036346_2036706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006828305.1|2036706_2037054_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_006828306.1|2037333_2037657_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_006828307.1|2038141_2038501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006828308.1|2038497_2038821_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006828309.1|2039411_2039672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006828310.1|2039807_2040716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065536830.1|2041028_2041376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006828312.1|2041480_2041705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006828313.1|2041852_2043364_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	26.6	3.1e-19
WP_065536829.1|2043360_2044113_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	33.5	6.9e-36
WP_006828315.1|2044373_2044571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006828316.1|2045219_2045447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006828317.1|2045502_2046219_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.3	3.0e-12
WP_006828318.1|2046175_2047552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006828319.1|2047548_2047824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006828320.1|2047813_2048230_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_154669152.1|2048760_2049654_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.8	6.0e-55
WP_006830420.1|2049653_2049953_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP016534	Planococcus antarcticus DSM 14505 chromosome, complete genome	3765545	2850430	2895455	3765545	integrase,transposase	Escherichia_phage(21.43%)	39	2847441:2847471	2894830:2894860
2847441:2847471	attL	TTAATTGTTTGGGTGCCAGGCACCCAAACAA	NA	NA	NA	NA
WP_154669169.1|2850430_2851018_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_006831618.1|2851155_2851377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065536641.1|2851351_2851927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065536640.1|2852655_2856102_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	39.1	1.5e-45
WP_065536639.1|2856302_2856581_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	54.2	3.8e-16
WP_083387790.1|2857212_2858718_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_065536637.1|2858721_2859318_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_065536636.1|2859617_2860361_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_065536635.1|2860798_2861023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065536634.1|2861156_2861870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154669210.1|2861788_2861983_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_154669170.1|2862185_2863328_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2L1IVA1	Escherichia_phage	30.1	1.5e-10
WP_006830734.1|2863324_2864098_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.5	8.6e-34
WP_065536633.1|2864214_2865771_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_065536632.1|2865745_2866516_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	32.9	1.2e-35
WP_065537363.1|2866547_2867336_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_065536631.1|2867491_2868067_-	sugar transferase	NA	NA	NA	NA	NA
WP_065536630.1|2869209_2870091_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_065536629.1|2870123_2871404_-	nucleotide sugar dehydrogenase	NA	A0A218MKK1	uncultured_virus	23.6	5.7e-06
WP_065536628.1|2871403_2872414_-	NAD-dependent epimerase	NA	A0A1D8EQC0	Escherichia_phage	25.6	5.4e-28
WP_065536627.1|2872440_2873499_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_065536626.1|2873563_2874907_-	phenylacetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_065536625.1|2874899_2876156_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_065536624.1|2876152_2877064_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_065536623.1|2877053_2878457_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_065536622.1|2878651_2880487_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	28.4	2.7e-25
WP_006830909.1|2880614_2881382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065536621.1|2881432_2882134_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_006830907.1|2882137_2882860_-	capsular polysaccharide biosynthesis protein	NA	A0A1X9I5E1	Streptococcus_phage	36.4	3.4e-24
WP_065536620.1|2883040_2883826_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_065536619.1|2883841_2884765_+	LytR family transcriptional regulator	NA	A0A1X9I5X1	Streptococcus_phage	30.3	4.2e-19
WP_065536617.1|2885878_2886118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065536616.1|2886318_2887479_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_065536615.1|2887507_2888473_-	GDP-mannose 4,6-dehydratase	NA	M1IBX1	Acanthocystis_turfacea_Chlorella_virus	26.4	4.1e-25
WP_154669211.1|2889372_2890377_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	28.1	3.4e-14
WP_065537362.1|2890876_2891839_-	patatin-like phospholipase family protein	NA	A0A1B2LRS3	Wolbachia_phage	39.9	1.6e-58
WP_006829485.1|2892352_2893096_+	C40 family peptidase	NA	A0A0A8WIF2	Clostridium_phage	38.7	4.9e-10
WP_065536614.1|2893619_2894786_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_065536613.1|2894867_2895455_-|transposase	transposase	transposase	NA	NA	NA	NA
2894830:2894860	attR	TTAATTGTTTGGGTGCCAGGCACCCAAACAA	NA	NA	NA	NA
>prophage 9
NZ_CP016534	Planococcus antarcticus DSM 14505 chromosome, complete genome	3765545	3544132	3591941	3765545	transposase	Paenibacillus_phage(10.0%)	44	NA	NA
WP_006828436.1|3544132_3544381_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	58.5	7.3e-19
WP_083387810.1|3545916_3546819_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_065536402.1|3546886_3547678_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_006831622.1|3547866_3548400_+	dCTP deaminase	NA	R4TP42	Halovirus	37.2	5.6e-24
WP_065536401.1|3548637_3549807_+|transposase	IS701-like element ISPlan1 family transposase	transposase	NA	NA	NA	NA
WP_006831623.1|3549895_3551515_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_006831624.1|3551525_3552626_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_040853096.1|3552641_3553616_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_065536400.1|3553967_3555029_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006831127.1|3555112_3556288_+	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_006831128.1|3556787_3557420_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006831129.1|3557444_3558290_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_083387827.1|3558782_3559304_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	36.3	1.1e-21
WP_065536398.1|3559466_3560579_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_065536397.1|3560695_3561439_-	Fic family protein	NA	A0A2R2XF11	White_spot_syndrome_virus	25.5	4.6e-08
WP_006830395.1|3561939_3563151_-	type III PLP-dependent enzyme	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	25.8	5.3e-14
WP_006830394.1|3563160_3564390_-	MFS transporter	NA	NA	NA	NA	NA
WP_006830393.1|3564393_3566382_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_006830392.1|3566371_3568270_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_065536396.1|3569092_3569860_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_006830390.1|3569837_3570665_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.8	2.0e-12
WP_006830389.1|3570713_3571766_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006830388.1|3571762_3572761_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_006830387.1|3572977_3573943_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_065536395.1|3574476_3575004_-	DNA topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	47.9	4.8e-44
WP_065536394.1|3575057_3575498_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_006830382.1|3575891_3576434_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065536393.1|3576753_3577608_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_065537338.1|3577711_3578236_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_006830379.1|3578481_3579003_+	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_006830378.1|3579596_3580874_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	29.3	5.8e-11
WP_006830377.1|3581255_3581531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006830375.1|3583516_3583702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065536390.1|3583832_3585194_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_006830373.1|3585493_3585811_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_065536389.1|3585824_3586109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006830370.1|3586706_3586982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006830369.1|3587014_3587380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006830368.1|3587435_3587738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006830367.1|3588557_3589112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081487855.1|3589976_3590384_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	44.5	8.9e-22
WP_065536388.1|3590490_3590691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154669152.1|3590748_3591642_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.8	6.0e-55
WP_006830420.1|3591641_3591941_-|transposase	transposase	transposase	NA	NA	NA	NA
