The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016510	Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 chromosome, complete genome	4747525	371624	415220	4747525	protease,terminase,coat,portal,lysis,integrase	Enterobacteria_phage(44.62%)	67	375471:375516	414736:414781
WP_001043660.1|371624_372677_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	2.2e-112
WP_001285275.1|372959_374063_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893221.1|374074_375325_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.1e-98
375471:375516	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
WP_000051900.1|375530_376694_-|integrase	site-specific integrase	integrase	A0A075B8E2	Enterobacteria_phage	99.7	2.4e-229
WP_000016640.1|376923_377559_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
WP_001277769.1|377659_377839_-	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	98.3	1.6e-28
WP_000208013.1|377935_378622_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.2	4.3e-53
WP_000224223.1|378632_378896_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
WP_001289978.1|378897_379383_-	hypothetical protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.3e-43
WP_000812182.1|379379_380006_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	71.2	7.1e-71
WP_001682200.1|380002_380167_-	DUF2737 domain-containing protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_001111313.1|380177_380474_-	hypothetical protein	NA	Q76H42	Enterobacteria_phage	90.8	3.9e-43
WP_001253481.1|380520_380805_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	97.9	2.6e-44
WP_000031375.1|380804_381422_-	recombinase	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
WP_000158027.1|381551_381740_-	hypothetical protein	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
WP_000582314.1|381720_381879_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
WP_000776964.1|381964_382276_-	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
WP_001737461.1|382423_382627_-	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
WP_000651935.1|382626_382863_-	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
WP_000213983.1|382899_383094_-	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_001682202.1|383308_383887_+	superinfection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_000216175.1|383907_384210_-	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_071531586.1|384229_384442_+	hypothetical protein	NA	A0A075B8J1	Enterobacteria_phage	100.0	1.6e-30
WP_001095984.1|384563_385214_-	LexA family transcriptional repressor	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000276884.1|385294_385480_+	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_000424167.1|385586_385865_+	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_000067075.1|386038_386854_+	DNA replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001248406.1|386850_388227_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000736921.1|388300_388738_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_000679702.1|388734_388908_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113772.1|388874_389051_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|389053_389386_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|389378_389555_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|389547_390159_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000036317.1|390155_390380_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_000149925.1|390376_390580_+	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219131.1|390560_390740_+	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_001235453.1|390736_391360_+	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_015675486.1|391449_391659_+	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	100.0	6.7e-34
WP_000286100.1|391798_392002_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000074137.1|391979_392477_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
WP_001531485.1|392565_393003_+|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
WP_001682204.1|393037_393229_+	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	95.2	1.1e-27
WP_001177703.1|393215_393902_+	hypothetical protein	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
WP_000807785.1|394204_394447_+	DUF2560 domain-containing protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001278047.1|394448_394628_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
WP_000729925.1|394651_395140_+	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_000417849.1|395117_396617_+|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
WP_000774656.1|396616_398794_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
WP_000433852.1|398807_399719_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196938.1|399718_401011_+|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000684729.1|401049_401259_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001166098.1|401242_401743_+	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_001122424.1|401702_403121_+	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_000774927.1|403124_403826_+	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_000627697.1|403825_404281_+	hypothetical protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_000964902.1|404283_404976_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
WP_000246945.1|404985_406281_+	DNA injection protein	NA	Q716G3	Shigella_phage	84.5	2.1e-181
WP_001029838.1|406280_408278_+	hypothetical protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
WP_000749288.1|408368_408854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000179612.1|408959_409217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000287064.1|409256_409511_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	63.3	4.4e-19
WP_000129930.1|409646_411650_+	endorhamnosidase	NA	A0A2H4FWI0	Salmonella_phage	99.9	0.0e+00
WP_000671495.1|411708_413166_-	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
WP_000703640.1|413155_414088_-	glycosyltransferase	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|414084_414447_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_001683918.1|414944_415220_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.9e-23
414736:414781	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 2
NZ_CP016510	Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 chromosome, complete genome	4747525	1019446	1027469	4747525	protease,transposase	Dickeya_phage(14.29%)	10	NA	NA
WP_001201751.1|1019446_1020565_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125890.1|1020561_1022508_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_001652477.1|1022488_1022683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000447499.1|1022637_1022859_-	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1023182_1023503_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1023533_1025810_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001542475.1|1025855_1026044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|1026000_1026459_+|transposase	IS200/IS605 family transposase IS200F	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001117984.1|1026732_1026930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|1027091_1027469_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 3
NZ_CP016510	Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 chromosome, complete genome	4747525	1078078	1176037	4747525	tail,protease,terminase,transposase,portal,lysis,tRNA	Salmonella_phage(45.76%)	108	NA	NA
WP_001154025.1|1078078_1078882_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1078874_1080197_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1080177_1080882_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572753.1|1080881_1085348_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925883.1|1085692_1087513_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1087772_1088321_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1088348_1088996_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1089057_1090248_-	aspartate aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1090432_1091524_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1092130_1093531_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1093731_1094193_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301921.1|1094189_1094423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000544849.1|1094509_1095724_+	PLP-dependent lyase/thiolase	NA	NA	NA	NA	NA
WP_000893206.1|1095968_1097402_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191413.1|1097482_1098685_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001528853.1|1098879_1100220_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	7.2e-262
WP_000065276.1|1100216_1100465_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001682304.1|1100505_1100745_-	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	98.7	3.3e-37
WP_000189634.1|1100750_1101620_-	DNA methylase	NA	A0A1C9II58	Salmonella_phage	86.3	7.2e-146
WP_000187054.1|1101616_1102297_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	97.8	3.3e-130
WP_000100830.1|1102293_1103079_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.8	2.4e-148
WP_000995352.1|1103084_1103381_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
WP_000186242.1|1103471_1103672_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000373338.1|1103959_1104166_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_000091280.1|1104192_1104627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000439725.1|1104628_1105054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230956.1|1105096_1105492_-	transcriptional regulator	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000992434.1|1105596_1105833_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_015675517.1|1105798_1106173_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.9e-63
WP_000024046.1|1106264_1107170_+	hypothetical protein	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
WP_000788826.1|1107166_1107868_+	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	99.1	1.9e-128
WP_023602525.1|1107912_1108314_+	chromosome partitioning protein ParB	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
WP_000215887.1|1108310_1108844_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.8	8.1e-92
WP_000224239.1|1108845_1109103_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	4.5e-40
WP_000208143.1|1109113_1109515_+	hypothetical protein	NA	I6R0R2	Salmonella_phage	82.0	1.2e-18
WP_000877758.1|1109622_1110267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1110497_1110731_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1110847_1111096_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|1111130_1111733_+	hypothetical protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001241019.1|1111732_1111939_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_001096547.1|1111941_1112553_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001617856.1|1112549_1112696_+	hypothetical protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1112685_1113483_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_000508329.1|1113649_1113868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158478.1|1113905_1114094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000658038.1|1114148_1114337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682303.1|1114539_1114842_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000301013.1|1114819_1115359_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	72.4	2.2e-76
WP_001080030.1|1115666_1116161_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.3	2.2e-59
WP_000371784.1|1116371_1116905_+	DNA breaking-rejoining protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989238.1|1116861_1119000_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	6.9e-291
WP_000196190.1|1118996_1119203_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077906132.1|1119229_1120747_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.7	7.5e-175
WP_077906133.1|1120670_1122749_+	peptidase S14	NA	A0A291AWT6	Escherichia_phage	69.3	2.4e-264
WP_001107908.1|1122839_1123163_+	recombinase RecA	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1123155_1123455_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453192.1|1123435_1124002_+|tail	tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000196703.1|1123998_1124400_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000132755.1|1124411_1125161_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478858.1|1125206_1125605_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1125601_1125931_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_065305406.1|1126010_1128998_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	2.5e-262
WP_000978295.1|1128994_1129327_+|tail	tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_000410972.1|1129425_1129950_+	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
WP_000877926.1|1130039_1130573_-	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1130662_1131358_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000606356.1|1131367_1132105_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	5.2e-113
WP_020867839.1|1132002_1132707_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
WP_077906116.1|1134530_1136129_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	66.0	7.8e-138
WP_000178849.1|1136167_1136410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001532020.1|1136463_1138839_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	64.9	1.9e-87
WP_031618324.1|1139339_1139660_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
WP_000143158.1|1139649_1140231_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_000161705.1|1140427_1141150_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_077905646.1|1141428_1141581_+	hypothetical protein	NA	S4TTF2	Salmonella_phage	84.8	1.6e-13
WP_000343758.1|1141800_1143021_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_071531551.1|1143017_1143515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193784.1|1143949_1146562_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1146769_1147780_+	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001220671.1|1147945_1148488_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1148484_1149594_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1149692_1151801_+	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
WP_000053044.1|1151813_1153721_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|1153735_1154989_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_000433414.1|1154993_1156634_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
WP_000759136.1|1156630_1157194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001537784.1|1157449_1157617_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1157716_1158235_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_000156454.1|1158303_1160064_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1160249_1160702_+	macrodomain Ter protein	NA	NA	NA	NA	NA
WP_001674965.1|1160773_1161826_-	outer membrane protein A	NA	NA	NA	NA	NA
WP_000288732.1|1162182_1162692_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1162908_1163514_+	DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1163500_1165654_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1165672_1166119_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1166242_1168297_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1168332_1168791_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847716.1|1168885_1169548_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
WP_000975203.1|1169718_1170135_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1170179_1170497_-	heat-shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1170554_1171766_-	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
WP_000859416.1|1171980_1172529_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1172554_1173334_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1173382_1173664_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1173660_1173990_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|1174076_1174736_-	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_071531552.1|1174801_1175011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938191.1|1175356_1176037_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP016510	Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 chromosome, complete genome	4747525	1963897	1972517	4747525	integrase	Salmonella_phage(28.57%)	17	1960573:1960595	1970286:1970308
1960573:1960595	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_014344507.1|1963897_1964023_-	putative cytoplasmic protein	NA	S4TTF2	Salmonella_phage	89.5	4.3e-12
WP_001667856.1|1964322_1964589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000457876.1|1964717_1964843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001520426.1|1965105_1965222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989029.1|1965412_1965613_+	PhoPQ-activated virulence protein PagK	NA	NA	NA	NA	NA
WP_001531593.1|1966744_1967008_-	DUF1441 domain-containing protein	NA	Q9EYD0	Enterobacteria_phage	59.8	2.0e-19
WP_031608154.1|1967059_1967251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789529.1|1967315_1967483_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050883.1|1967739_1968273_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_001709685.1|1968326_1968614_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	9.9e-28
WP_023602538.1|1968746_1969241_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	67.6	2.0e-20
WP_001173880.1|1969258_1970155_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.3	6.6e-78
WP_077464269.1|1970351_1970471_-	hypothetical protein	NA	NA	NA	NA	NA
1970286:1970308	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000722368.1|1970528_1970882_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000979694.1|1970898_1971774_-	membrane protein	NA	NA	NA	NA	NA
WP_000168394.1|1971774_1972149_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1972286_1972517_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 5
NZ_CP016510	Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 chromosome, complete genome	4747525	2075160	2085761	4747525		Morganella_phage(25.0%)	13	NA	NA
WP_001157304.1|2075160_2076591_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
WP_000377037.1|2076664_2077360_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_000107434.1|2077439_2077751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080662.1|2078401_2079598_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_024131109.1|2079855_2080044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2080054_2080267_-	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457664.1|2080721_2081990_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	1.2e-226
WP_000394197.1|2081992_2082412_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2082538_2082700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343854.1|2082677_2082920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598921.1|2083180_2083978_+	protein MtfA	NA	NA	NA	NA	NA
WP_065632869.1|2084349_2084640_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	52.6	2.1e-09
WP_001219015.1|2085287_2085761_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
>prophage 6
NZ_CP016510	Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 chromosome, complete genome	4747525	2171756	2182262	4747525		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2171756_2173070_-	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2173096_2174176_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2174180_2174954_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2174950_2175943_-	protein RfbI	NA	NA	NA	NA	NA
WP_000973708.1|2175948_2176500_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2176500_2177379_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2177426_2178326_-	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2178325_2179411_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2179787_2180681_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111845.1|2180858_2182262_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	6.8e-21
>prophage 7
NZ_CP016510	Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 chromosome, complete genome	4747525	2250538	2259709	4747525	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|2250538_2252572_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2252812_2253271_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|2253442_2253973_+	lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2254029_2254497_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2254543_2255263_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_000272850.1|2255259_2256945_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|2257167_2257899_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2257958_2258066_+	membrane protein	NA	NA	NA	NA	NA
WP_000824857.1|2258046_2258778_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569165.1|2258761_2259709_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 8
NZ_CP016510	Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 chromosome, complete genome	4747525	2331759	2345510	4747525	protease,holin,tail,head	Salmonella_phage(38.46%)	14	NA	NA
WP_000806401.1|2331759_2332263_-	hypothetical protein	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2332290_2332581_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2332928_2334758_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2334811_2335255_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2335632_2336160_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2336162_2337404_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_000003792.1|2337464_2337983_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	88.0	5.2e-75
WP_001120499.1|2337996_2338326_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894638.1|2338622_2339954_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	4.6e-19
WP_010989045.1|2339982_2340351_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2340365_2341355_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2341683_2344050_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2344218_2344422_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2344718_2345510_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 9
NZ_CP016510	Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 chromosome, complete genome	4747525	3138836	3145185	4747525	tRNA	uncultured_Caudovirales_phage(33.33%)	8	NA	NA
WP_000942506.1|3138836_3139010_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.6	2.0e-15
WP_000927761.1|3139089_3139440_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	6.2e-24
WP_000778548.1|3139594_3140698_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	57.3	7.3e-119
WP_000244319.1|3141015_3141774_-	hypothetical protein	NA	I2E8W3	Clostridium_phage	39.5	1.2e-11
WP_071526801.1|3141799_3141988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133994.1|3142038_3142584_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003339.1|3142659_3144177_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	4.8e-89
WP_071524012.1|3144186_3145185_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.7e-05
>prophage 10
NZ_CP016510	Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 chromosome, complete genome	4747525	4333036	4353933	4747525	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587739.1|4333036_4333678_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	4.6e-33
WP_024132246.1|4334256_4334673_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000084336.1|4335053_4335509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151758.1|4335505_4336120_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368193.1|4336126_4337785_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_000359509.1|4337787_4338420_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000951734.1|4338412_4339528_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_001093501.1|4339518_4339878_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632053.1|4340041_4341589_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_000703633.1|4341588_4342518_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000593182.1|4342514_4342877_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4343204_4343927_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4343936_4344980_-	hypothetical protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4344967_4345177_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271420.1|4345176_4346130_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4346129_4348484_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4348580_4348709_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4348668_4348986_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907497.1|4349037_4349562_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
WP_000729852.1|4349561_4350989_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4350978_4351176_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4351172_4351628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4351787_4352102_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4352114_4352720_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4352722_4353010_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4353585_4353933_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
