The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016530	Salmonella enterica subsp. enterica serovar Heidelberg strain SA01AB09084001 chromosome, complete genome	4751449	371624	415220	4751449	holin,coat,portal,protease,integrase,lysis,terminase	Enterobacteria_phage(44.44%)	64	375471:375516	414736:414781
WP_001043660.1|371624_372677_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	2.2e-112
WP_001285275.1|372959_374063_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893221.1|374074_375325_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.1e-98
375471:375516	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
WP_000051900.1|375530_376694_-|integrase	site-specific integrase	integrase	A0A075B8E2	Enterobacteria_phage	99.7	2.4e-229
WP_000016640.1|376923_377559_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
WP_001277769.1|377659_377839_-	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	98.3	1.6e-28
WP_000208013.1|377935_378622_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.2	4.3e-53
WP_000224223.1|378632_378896_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
WP_001289978.1|378897_379383_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.3e-43
WP_000812182.1|379379_380006_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	71.2	7.1e-71
WP_001682200.1|380002_380167_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_001111313.1|380177_380474_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	90.8	3.9e-43
WP_000031375.1|380804_381422_-	ERF family protein	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
WP_001163402.1|381418_381562_-	hypothetical protein	NA	A0A075B8I9	Enterobacteria_phage	100.0	3.2e-19
WP_000158027.1|381551_381740_-	DUF5444 family protein	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
WP_000582314.1|381720_381879_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
WP_000776964.1|381964_382276_-	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
WP_001737461.1|382423_382627_-	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
WP_000651935.1|382626_382863_-	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
WP_000213983.1|382899_383094_-	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_001682202.1|383308_383887_+	superinfection exclusion B family protein	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_000216175.1|383907_384210_-	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001095984.1|384563_385214_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000276884.1|385294_385480_+	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_000424167.1|385586_385865_+	lambda phage CII family protein	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001125981.1|385899_386046_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067075.1|386038_386854_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001248406.1|386850_388227_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000736921.1|388300_388738_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_000679702.1|388734_388908_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113772.1|388874_389051_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|389053_389386_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|389378_389555_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|389547_390159_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000036317.1|390155_390380_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_000149925.1|390376_390580_+	phage NinH family protein	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219131.1|390560_390740_+	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_001235453.1|390736_391360_+	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_000286100.1|391798_392002_+|holin	phage holin family protein	holin	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000074137.1|391979_392477_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
WP_001531485.1|392565_393003_+|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
WP_001177703.1|393215_393902_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
WP_000807785.1|394204_394447_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001278047.1|394448_394628_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
WP_000729925.1|394651_395140_+	DNA-packaging protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_000417849.1|395117_396617_+|terminase	terminase large subunit	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
WP_000774656.1|396616_398794_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
WP_000433852.1|398807_399719_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196938.1|399718_401011_+|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000684729.1|401049_401259_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001166098.1|401242_401743_+	packaged DNA stabilization gp4 family protein	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_001122424.1|401702_403121_+	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_000774927.1|403124_403826_+	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_000627697.1|403825_404281_+	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_000964902.1|404283_404976_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
WP_000246945.1|404985_406281_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	84.5	2.1e-181
WP_001029838.1|406280_408278_+	hypothetical protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
WP_000749288.1|408368_408854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023602519.1|409256_409544_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	67.8	1.9e-26
WP_000129930.1|409646_411650_+	endorhamnosidase	NA	A0A2H4FWI0	Salmonella_phage	99.9	0.0e+00
WP_000671495.1|411708_413166_-	glucosyltransferase domain-containing protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
WP_000703640.1|413155_414088_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|414084_414447_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_001683918.1|414944_415220_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.9e-23
414736:414781	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 2
NZ_CP016530	Salmonella enterica subsp. enterica serovar Heidelberg strain SA01AB09084001 chromosome, complete genome	4751449	1019445	1027468	4751449	protease,transposase	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|1019445_1020564_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125890.1|1020560_1022507_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|1022636_1022858_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1023181_1023502_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1023532_1025809_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1025999_1026458_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001117984.1|1026731_1026929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|1027090_1027468_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 3
NZ_CP016530	Salmonella enterica subsp. enterica serovar Heidelberg strain SA01AB09084001 chromosome, complete genome	4751449	1078077	1176036	4751449	tRNA,tail,holin,portal,protease,lysis,terminase,transposase	Salmonella_phage(43.86%)	103	NA	NA
WP_001154025.1|1078077_1078881_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1078873_1080196_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1080176_1080881_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572753.1|1080880_1085347_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925883.1|1085691_1087512_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1087771_1088320_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1088347_1088995_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1089056_1090247_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_045720415.1|1090431_1091523_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.5	8.3e-99
WP_000117870.1|1092129_1093530_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1093730_1094192_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1094508_1095723_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893206.1|1095967_1097401_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191413.1|1097481_1098684_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262307.1|1098878_1100171_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000065276.1|1100215_1100464_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001682304.1|1100504_1100744_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	98.7	3.3e-37
WP_000189634.1|1100749_1101619_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	86.3	7.2e-146
WP_000187054.1|1101615_1102296_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	97.8	3.3e-130
WP_000100830.1|1102292_1103078_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.8	2.4e-148
WP_000995352.1|1103083_1103380_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
WP_000186242.1|1103470_1103671_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000373338.1|1103958_1104165_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_000091280.1|1104191_1104626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000439725.1|1104627_1105053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230956.1|1105095_1105491_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000992434.1|1105595_1105832_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_015675517.1|1105797_1106172_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.9e-63
WP_031611230.1|1106263_1107169_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.3	7.7e-175
WP_000788826.1|1107165_1107867_+	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	99.1	1.9e-128
WP_023602525.1|1107911_1108313_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
WP_000215887.1|1108309_1108843_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.8	8.1e-92
WP_000224239.1|1108844_1109102_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	4.5e-40
WP_000208143.1|1109112_1109514_+	hypothetical protein	NA	I6R0R2	Salmonella_phage	82.0	1.2e-18
WP_000877758.1|1109621_1110266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1110496_1110730_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1110846_1111095_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|1111129_1111732_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096547.1|1111940_1112552_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001617856.1|1112548_1112695_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1112684_1113482_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_000508329.1|1113648_1113867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000658038.1|1114147_1114336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682303.1|1114538_1114841_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000301013.1|1114818_1115358_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	72.4	2.2e-76
WP_001080030.1|1115665_1116160_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.3	2.2e-59
WP_000371784.1|1116370_1116904_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989238.1|1116860_1118999_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	6.9e-291
WP_000196190.1|1118995_1119202_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009205.1|1119198_1120746_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	63.8	1.1e-176
WP_077906133.1|1120669_1122748_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.3	2.4e-264
WP_001107908.1|1122838_1123162_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1123154_1123454_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453192.1|1123434_1124001_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000196703.1|1123997_1124399_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000132755.1|1124410_1125160_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478858.1|1125205_1125604_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1125600_1125930_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_065305406.1|1126009_1128997_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	2.5e-262
WP_000978295.1|1128993_1129326_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_000410972.1|1129424_1129949_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
WP_000877926.1|1130038_1130572_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1130661_1131357_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000606356.1|1131366_1132104_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	5.2e-113
WP_020867839.1|1132001_1132706_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
WP_000033414.1|1132777_1136128_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	69.3	0.0e+00
WP_000178849.1|1136166_1136409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001532020.1|1136462_1138838_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	64.9	1.9e-87
WP_031618324.1|1139338_1139659_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
WP_000143158.1|1139648_1140230_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_000161705.1|1140426_1141149_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000343758.1|1141799_1143020_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_071531551.1|1143016_1143514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193784.1|1143948_1146561_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1146768_1147779_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1147944_1148487_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1148483_1149593_-	YcbX family protein	NA	NA	NA	NA	NA
WP_001086485.1|1149691_1151800_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1151812_1153720_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|1153734_1154988_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1154992_1156633_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1156629_1157193_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1157448_1157616_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1157715_1158234_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1158302_1160063_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1160248_1160701_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1160772_1161825_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1162181_1162691_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1162907_1163513_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1163499_1165653_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1165671_1166118_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1166241_1168296_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1168331_1168790_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847716.1|1168884_1169547_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1169720_1170134_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1170178_1170496_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1170553_1171765_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|1171979_1172528_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1172553_1173333_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1173381_1173663_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1173659_1173989_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|1174075_1174735_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938191.1|1175355_1176036_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP016530	Salmonella enterica subsp. enterica serovar Heidelberg strain SA01AB09084001 chromosome, complete genome	4751449	2075159	2082411	4751449		Morganella_phage(33.33%)	8	NA	NA
WP_001157304.1|2075159_2076590_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
WP_000377037.1|2076663_2077359_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_000107434.1|2077438_2077750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080662.1|2078400_2079597_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_024131109.1|2079854_2080043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2080053_2080266_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457664.1|2080720_2081989_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.2e-226
WP_000394197.1|2081991_2082411_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 5
NZ_CP016530	Salmonella enterica subsp. enterica serovar Heidelberg strain SA01AB09084001 chromosome, complete genome	4751449	2171754	2182260	4751449		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2171754_2173068_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2173094_2174174_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2174178_2174952_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2174948_2175941_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2175946_2176498_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2176498_2177377_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2177424_2178324_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2178323_2179409_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2179785_2180679_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111845.1|2180856_2182260_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	6.8e-21
>prophage 6
NZ_CP016530	Salmonella enterica subsp. enterica serovar Heidelberg strain SA01AB09084001 chromosome, complete genome	4751449	2250536	2259707	4751449	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|2250536_2252570_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2252810_2253269_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|2253440_2253971_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2254027_2254495_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2254541_2255261_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2255257_2256943_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|2257165_2257897_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2257956_2258064_+	protein YohO	NA	NA	NA	NA	NA
WP_000824857.1|2258044_2258776_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569165.1|2258759_2259707_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NZ_CP016530	Salmonella enterica subsp. enterica serovar Heidelberg strain SA01AB09084001 chromosome, complete genome	4751449	2279114	2345501	4751449	tail,lysis,holin	Salmonella_phage(25.0%)	59	NA	NA
WP_000989295.1|2279114_2279810_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2279963_2280848_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2281024_2281744_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2281740_2281986_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136394.1|2282190_2283432_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956097.1|2283425_2284661_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2284735_2285746_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2285761_2287282_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2287415_2288414_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2288912_2289935_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001520237.1|2290084_2291227_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2291241_2291910_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2292239_2293097_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2293085_2293475_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001531764.1|2293479_2294847_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022910.1|2295063_2295951_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2295983_2297306_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488244.1|2297349_2299341_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2299686_2301156_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548316.1|2301345_2302209_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137966.1|2302329_2303379_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873906.1|2303457_2304315_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	1.3e-22
WP_000854395.1|2304379_2306068_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2306084_2307023_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2307022_2308153_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2308520_2309702_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213897.1|2309765_2310431_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2310432_2310555_-	membrane protein	NA	NA	NA	NA	NA
WP_001523448.1|2310942_2311197_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2311520_2312093_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169346.1|2312305_2313292_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2313321_2314041_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2314454_2315027_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957755.1|2315352_2316909_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561742.1|2317015_2318821_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501626.1|2318830_2319925_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137747.1|2319924_2320950_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000222013.1|2320951_2322541_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	7.2e-19
WP_001094639.1|2322544_2322889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2323279_2324470_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234834.1|2324497_2325193_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578130.1|2325344_2327105_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	1.4e-100
WP_000494192.1|2327229_2327514_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033443.1|2327622_2328243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2328270_2329278_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2329457_2329685_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2329716_2331477_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2331757_2332261_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2332288_2332579_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000022213.1|2334802_2335246_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2335623_2336151_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2336153_2337395_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2337987_2338317_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894638.1|2338613_2339945_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	4.6e-19
WP_010989045.1|2339973_2340342_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2340356_2341346_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2341674_2344041_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2344209_2344413_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2344709_2345501_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP016530	Salmonella enterica subsp. enterica serovar Heidelberg strain SA01AB09084001 chromosome, complete genome	4751449	4333966	4381487	4751449	tail,plate,holin,tRNA	Burkholderia_phage(40.91%)	50	NA	NA
WP_000587739.1|4333966_4334608_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	4.6e-33
WP_024132246.1|4335186_4335603_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000084336.1|4335983_4336439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151758.1|4336435_4337050_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368193.1|4337056_4338715_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_000359509.1|4338717_4339350_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000951734.1|4339342_4340458_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_001093501.1|4340448_4340808_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632053.1|4340971_4342519_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_000703633.1|4342518_4343448_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000593182.1|4343444_4343807_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4344134_4344857_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4344866_4345910_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4345897_4346107_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271420.1|4346106_4347060_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4347059_4349414_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4349510_4349639_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4349598_4349916_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907497.1|4349967_4350492_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
WP_000729852.1|4350491_4351919_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4351908_4352106_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4352102_4352558_-	Gp37 family protein	NA	NA	NA	NA	NA
WP_000777266.1|4352717_4353032_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4353044_4353650_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4353652_4353940_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4354515_4354863_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_000136400.1|4354995_4356345_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000790037.1|4356689_4358339_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001541297.1|4358782_4359025_+	outer membrane protein	NA	NA	NA	NA	NA
WP_022742863.1|4359058_4359727_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000977979.1|4359723_4360461_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000750804.1|4360460_4362557_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000982749.1|4362699_4363110_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252085.1|4363275_4364166_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000382573.1|4364180_4365725_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695415.1|4365856_4367047_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179176.1|4367408_4368518_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000973681.1|4368606_4369965_+	maltoporin	NA	NA	NA	NA	NA
WP_000782497.1|4370128_4371046_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000019230.1|4371226_4371724_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455249.1|4371737_4372610_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017360.1|4372708_4375129_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002900.1|4375299_4375668_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646079.1|4375776_4376385_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001128112.1|4376563_4377889_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001575282.1|4377885_4377999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030592.1|4378020_4378230_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416271.1|4378328_4378844_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001039342.1|4379090_4380401_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001182224.1|4380488_4381487_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
