The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016525	Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A chromosome, complete genome	4751375	371624	415220	4751375	portal,coat,holin,terminase,integrase,lysis,protease	Enterobacteria_phage(44.44%)	64	375471:375516	414736:414781
WP_001043660.1|371624_372677_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	2.2e-112
WP_001285275.1|372959_374063_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893221.1|374074_375325_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.1e-98
375471:375516	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
WP_000051900.1|375530_376694_-|integrase	site-specific integrase	integrase	A0A075B8E2	Enterobacteria_phage	99.7	2.4e-229
WP_000016640.1|376923_377559_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
WP_001277769.1|377659_377839_-	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	98.3	1.6e-28
WP_000208013.1|377935_378622_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.2	4.3e-53
WP_000224223.1|378632_378896_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
WP_001289978.1|378897_379383_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.3e-43
WP_000812182.1|379379_380006_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	71.2	7.1e-71
WP_001682200.1|380002_380167_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_001111313.1|380177_380474_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	90.8	3.9e-43
WP_000031375.1|380804_381422_-	ERF family protein	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
WP_001163402.1|381418_381562_-	hypothetical protein	NA	A0A075B8I9	Enterobacteria_phage	100.0	3.2e-19
WP_000158027.1|381551_381740_-	DUF5444 family protein	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
WP_000582314.1|381720_381879_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
WP_000776964.1|381964_382276_-	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
WP_001737461.1|382423_382627_-	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
WP_000651935.1|382626_382863_-	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
WP_000213983.1|382899_383094_-	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_001682202.1|383308_383887_+	superinfection exclusion B family protein	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_000216175.1|383907_384210_-	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001095984.1|384563_385214_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000276884.1|385294_385480_+	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_000424167.1|385586_385865_+	lambda phage CII family protein	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001125981.1|385899_386046_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067075.1|386038_386854_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001248406.1|386850_388227_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000736921.1|388300_388738_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_000679702.1|388734_388908_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113772.1|388874_389051_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|389053_389386_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|389378_389555_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|389547_390159_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000036317.1|390155_390380_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_000149925.1|390376_390580_+	phage NinH family protein	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219131.1|390560_390740_+	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_001235453.1|390736_391360_+	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_000286100.1|391798_392002_+|holin	phage holin family protein	holin	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000074137.1|391979_392477_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
WP_001531485.1|392565_393003_+|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
WP_001177703.1|393215_393902_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
WP_000807785.1|394204_394447_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001278047.1|394448_394628_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
WP_000729925.1|394651_395140_+	DNA-packaging protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_000417849.1|395117_396617_+|terminase	terminase large subunit	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
WP_000774656.1|396616_398794_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
WP_000433852.1|398807_399719_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196938.1|399718_401011_+|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000684729.1|401049_401259_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001166098.1|401242_401743_+	packaged DNA stabilization gp4 family protein	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_001122424.1|401702_403121_+	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_000774927.1|403124_403826_+	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_000627697.1|403825_404281_+	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_000964902.1|404283_404976_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
WP_000246945.1|404985_406281_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	84.5	2.1e-181
WP_001029838.1|406280_408278_+	hypothetical protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
WP_000749288.1|408368_408854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023602519.1|409256_409544_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	67.8	1.9e-26
WP_000129930.1|409646_411650_+	endorhamnosidase	NA	A0A2H4FWI0	Salmonella_phage	99.9	0.0e+00
WP_000671495.1|411708_413166_-	glucosyltransferase domain-containing protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
WP_000703640.1|413155_414088_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|414084_414447_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_001683918.1|414944_415220_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.9e-23
414736:414781	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 2
NZ_CP016525	Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A chromosome, complete genome	4751375	1019446	1027469	4751375	transposase,protease	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|1019446_1020565_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125890.1|1020561_1022508_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|1022637_1022859_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1023182_1023503_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1023533_1025810_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1026000_1026459_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001117984.1|1026732_1026930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|1027091_1027469_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 3
NZ_CP016525	Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A chromosome, complete genome	4751375	1078078	1176037	4751375	portal,holin,terminase,transposase,tail,lysis,protease,tRNA	Salmonella_phage(44.83%)	104	NA	NA
WP_001154025.1|1078078_1078882_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1078874_1080197_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1080177_1080882_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572753.1|1080881_1085348_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925883.1|1085692_1087513_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1087772_1088321_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1088348_1088996_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1089057_1090248_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1090432_1091524_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1092130_1093531_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1093731_1094193_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1094509_1095724_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893206.1|1095968_1097402_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191413.1|1097482_1098685_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262307.1|1098879_1100172_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000065276.1|1100216_1100465_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001682304.1|1100505_1100745_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	98.7	3.3e-37
WP_000189634.1|1100750_1101620_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	86.3	7.2e-146
WP_000187054.1|1101616_1102297_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	97.8	3.3e-130
WP_000100830.1|1102293_1103079_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.8	2.4e-148
WP_000995352.1|1103084_1103381_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
WP_000186242.1|1103471_1103672_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000373338.1|1103959_1104166_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_000091280.1|1104192_1104627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000439725.1|1104628_1105054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230956.1|1105096_1105492_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000992434.1|1105596_1105833_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_015675517.1|1105798_1106173_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.9e-63
WP_031611230.1|1106264_1107170_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.3	7.7e-175
WP_000788826.1|1107166_1107868_+	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	99.1	1.9e-128
WP_023602525.1|1107912_1108314_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
WP_000215887.1|1108310_1108844_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.8	8.1e-92
WP_000224239.1|1108845_1109103_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	4.5e-40
WP_000208143.1|1109113_1109515_+	hypothetical protein	NA	I6R0R2	Salmonella_phage	82.0	1.2e-18
WP_000877758.1|1109622_1110267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1110497_1110731_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1110847_1111096_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|1111130_1111733_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096547.1|1111941_1112553_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001617856.1|1112549_1112696_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1112685_1113483_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_000508329.1|1113649_1113868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000658038.1|1114148_1114337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682303.1|1114539_1114842_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000301013.1|1114819_1115359_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	72.4	2.2e-76
WP_001080030.1|1115666_1116161_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.3	2.2e-59
WP_000371784.1|1116371_1116905_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989238.1|1116861_1119000_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	6.9e-291
WP_000196190.1|1118996_1119203_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009205.1|1119199_1120747_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	63.8	1.1e-176
WP_077906133.1|1120670_1122749_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.3	2.4e-264
WP_001107908.1|1122839_1123163_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1123155_1123455_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453192.1|1123435_1124002_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000196703.1|1123998_1124400_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000132755.1|1124411_1125161_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478858.1|1125206_1125605_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1125601_1125931_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_065305406.1|1126010_1128998_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	2.5e-262
WP_000978295.1|1128994_1129327_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_000410972.1|1129425_1129950_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
WP_000877926.1|1130039_1130573_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1130662_1131358_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000606356.1|1131367_1132105_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	5.2e-113
WP_020867839.1|1132002_1132707_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
WP_077906512.1|1135253_1136129_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.8	2.6e-50
WP_000178849.1|1136167_1136410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001532020.1|1136463_1138839_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	64.9	1.9e-87
WP_031618324.1|1139339_1139660_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
WP_000143158.1|1139649_1140231_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_000161705.1|1140427_1141150_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000388788.1|1141362_1141581_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	89.7	1.7e-24
WP_000343758.1|1141800_1143021_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_071531551.1|1143017_1143515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193784.1|1143949_1146562_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1146769_1147780_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1147945_1148488_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1148484_1149594_-	YcbX family protein	NA	NA	NA	NA	NA
WP_001086485.1|1149692_1151801_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1151813_1153721_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|1153735_1154989_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1154993_1156634_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1156630_1157194_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1157449_1157617_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1157716_1158235_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1158303_1160064_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1160249_1160702_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1160773_1161826_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1162182_1162692_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1162908_1163514_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1163500_1165654_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1165672_1166119_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1166242_1168297_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1168332_1168791_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847716.1|1168885_1169548_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1169721_1170135_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1170179_1170497_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1170554_1171766_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|1171980_1172529_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1172554_1173334_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1173382_1173664_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1173660_1173990_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|1174076_1174736_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938191.1|1175356_1176037_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP016525	Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A chromosome, complete genome	4751375	2075160	2082412	4751375		Morganella_phage(33.33%)	8	NA	NA
WP_001157304.1|2075160_2076591_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
WP_000377037.1|2076664_2077360_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_000107434.1|2077439_2077751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080662.1|2078401_2079598_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_024131109.1|2079855_2080044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2080054_2080267_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457664.1|2080721_2081990_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.2e-226
WP_000394197.1|2081992_2082412_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 5
NZ_CP016525	Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A chromosome, complete genome	4751375	2173095	2182261	4751375		Enterobacteria_phage(42.86%)	9	NA	NA
WP_000565905.1|2173095_2174175_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2174179_2174953_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2174949_2175942_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2175947_2176499_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2176499_2177378_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2177425_2178325_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2178324_2179410_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2179786_2180680_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111845.1|2180857_2182261_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	6.8e-21
>prophage 6
NZ_CP016525	Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A chromosome, complete genome	4751375	2250537	2259708	4751375	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|2250537_2252571_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2252811_2253270_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|2253441_2253972_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2254028_2254496_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2254542_2255262_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2255258_2256944_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|2257166_2257898_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2257957_2258065_+	protein YohO	NA	NA	NA	NA	NA
WP_000824857.1|2258045_2258777_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569165.1|2258760_2259708_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NZ_CP016525	Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A chromosome, complete genome	4751375	2279115	2345502	4751375	lysis,holin,tail	Salmonella_phage(25.0%)	59	NA	NA
WP_000989295.1|2279115_2279811_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2279964_2280849_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2281025_2281745_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2281741_2281987_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136394.1|2282191_2283433_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956097.1|2283426_2284662_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2284736_2285747_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2285762_2287283_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2287416_2288415_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2288913_2289936_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001520237.1|2290085_2291228_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2291242_2291911_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2292240_2293098_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2293086_2293476_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001531764.1|2293480_2294848_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022910.1|2295064_2295952_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2295984_2297307_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488244.1|2297350_2299342_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2299687_2301157_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548316.1|2301346_2302210_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137966.1|2302330_2303380_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873906.1|2303458_2304316_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	1.3e-22
WP_000854395.1|2304380_2306069_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2306085_2307024_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2307023_2308154_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2308521_2309703_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213897.1|2309766_2310432_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2310433_2310556_-	membrane protein	NA	NA	NA	NA	NA
WP_001523448.1|2310943_2311198_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2311521_2312094_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169346.1|2312306_2313293_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2313322_2314042_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2314455_2315028_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957755.1|2315353_2316910_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561742.1|2317016_2318822_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501626.1|2318831_2319926_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137747.1|2319925_2320951_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000222013.1|2320952_2322542_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	7.2e-19
WP_001094639.1|2322545_2322890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2323280_2324471_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234834.1|2324498_2325194_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578130.1|2325345_2327106_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	1.4e-100
WP_000494192.1|2327230_2327515_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033443.1|2327623_2328244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2328271_2329279_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2329458_2329686_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2329717_2331478_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2331758_2332262_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2332289_2332580_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000022213.1|2334803_2335247_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2335624_2336152_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2336154_2337396_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2337988_2338318_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894638.1|2338614_2339946_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	4.6e-19
WP_010989045.1|2339974_2340343_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2340357_2341347_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2341675_2344042_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2344210_2344414_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2344710_2345502_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP016525	Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A chromosome, complete genome	4751375	4333892	4381413	4751375	plate,holin,tail,tRNA	Burkholderia_phage(40.91%)	50	NA	NA
WP_000587739.1|4333892_4334534_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	4.6e-33
WP_024132246.1|4335112_4335529_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000084336.1|4335909_4336365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151758.1|4336361_4336976_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368193.1|4336982_4338641_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_000359509.1|4338643_4339276_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000951734.1|4339268_4340384_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_001093501.1|4340374_4340734_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632053.1|4340897_4342445_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_000703633.1|4342444_4343374_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000593182.1|4343370_4343733_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4344060_4344783_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4344792_4345836_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4345823_4346033_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271420.1|4346032_4346986_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4346985_4349340_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4349436_4349565_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4349524_4349842_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907497.1|4349893_4350418_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
WP_000729852.1|4350417_4351845_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4351834_4352032_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4352028_4352484_-	Gp37 family protein	NA	NA	NA	NA	NA
WP_000777266.1|4352643_4352958_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4352970_4353576_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4353578_4353866_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4354441_4354789_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_000136400.1|4354921_4356271_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000790037.1|4356615_4358265_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001541297.1|4358708_4358951_+	outer membrane protein	NA	NA	NA	NA	NA
WP_022742863.1|4358984_4359653_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000977979.1|4359649_4360387_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000750804.1|4360386_4362483_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000982749.1|4362625_4363036_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252085.1|4363201_4364092_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000382573.1|4364106_4365651_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695415.1|4365782_4366973_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179176.1|4367334_4368444_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000973681.1|4368532_4369891_+	maltoporin	NA	NA	NA	NA	NA
WP_000782497.1|4370054_4370972_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000019230.1|4371152_4371650_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455249.1|4371663_4372536_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017360.1|4372634_4375055_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002900.1|4375225_4375594_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646079.1|4375702_4376311_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001128112.1|4376489_4377815_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001575282.1|4377811_4377925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030592.1|4377946_4378156_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416271.1|4378254_4378770_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001039342.1|4379016_4380327_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001182224.1|4380414_4381413_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP016526	Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence	261310	2692	59387	261310	protease,transposase	Escherichia_phage(23.53%)	57	NA	NA
WP_001585166.1|2692_3772_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040058.1|3773_4547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280115.1|4539_5682_-	phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	6.5e-30
WP_012695441.1|5691_6750_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_000254137.1|7070_7652_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054786.1|7651_8809_+	TerD family protein	NA	NA	NA	NA	NA
WP_000007449.1|8831_9287_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|9309_10350_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|10398_10977_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|11045_11621_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053340.1|12049_13291_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000374058.1|13381_13837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|14077_14269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151572.1|14360_14702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|15688_15943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166877.1|15945_17985_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.3	1.7e-25
WP_065641826.1|17981_18968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|19888_20281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462754.1|20939_21596_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_000340139.1|21798_22296_+	membrane protein	NA	NA	NA	NA	NA
WP_012695445.1|22300_23689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012477377.1|24089_24383_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088044.1|24387_25713_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|25773_25980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985909.1|26080_26491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|27209_28214_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000405672.1|28304_28739_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_012695446.1|28824_31230_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.0	6.6e-141
WP_000118563.1|31226_32303_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_000993245.1|32311_32524_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001087807.1|32589_32826_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277466.1|32822_33188_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000209296.1|33205_34891_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_000522996.1|34929_35355_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732275.1|35382_35658_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294656.1|35673_36039_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_001166628.1|36110_36566_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000278471.1|37243_37669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224686.1|38217_38526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|38541_39399_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_001287391.1|40005_40410_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001100635.1|40587_40881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175475.1|40906_41143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|41697_42363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371925.1|42420_42801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000027057.1|43130_43991_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|44173_44731_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|44894_47900_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001067855.1|51913_52618_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001239317.1|52697_53198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001011939.1|53347_53989_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001067855.1|54132_54837_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000159617.1|55352_55547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172888.1|55543_55855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001180999.1|55917_56157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140246.1|57972_58302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072223036.1|58418_59387_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.8e-185
>prophage 2
NZ_CP016526	Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_261, complete sequence	261310	119158	190471	261310	integrase,transposase	uncultured_Caudovirales_phage(24.0%)	72	122478:122492	178882:179702
WP_072201439.1|119158_120127_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	3.9e-185
WP_000952689.1|120570_121023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836981.1|121012_121438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000235773.1|121446_122001_+	plasmid transfer protein	NA	NA	NA	NA	NA
WP_001232109.1|122120_126425_+	IncHI-type conjugal transfer protein RSP	NA	NA	NA	NA	NA
122478:122492	attL	TTCTCTGGTTCTGAA	NA	NA	NA	NA
WP_001286760.1|126702_127215_+	IncHI-type conjugal transfer protein TrhF	NA	NA	NA	NA	NA
122478:122492	attL	TTCTCTGGTTCTGAA	NA	NA	NA	NA
WP_022652343.1|128632_129601_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	3.7e-183
WP_000125668.1|129820_131224_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000130816.1|131256_131961_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000941305.1|132047_132368_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000922628.1|132413_133703_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000065802.1|133715_134141_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_001066652.1|134200_135028_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000927306.1|135046_136525_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_000864986.1|137016_137292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371914.1|137432_137630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000637193.1|138616_138874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005009.1|138947_139262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975181.1|139309_140206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000464825.1|140208_140724_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833380.1|140938_142366_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000220758.1|142426_142594_+	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_000078513.1|142616_143936_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000121164.1|143948_144152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371952.1|144215_145421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193207.1|145417_146236_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572379.1|146440_146608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019951.1|146701_146974_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001572377.1|147096_148212_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000723070.1|148469_148904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004248839.1|149121_150468_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	8.8e-18
WP_072196614.1|150506_151475_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	1.1e-184
WP_001572373.1|151663_153283_+	phosphoethanolamine--lipid A transferase MCR-9.1	NA	NA	NA	NA	NA
WP_001572372.1|153359_153836_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_001067855.1|154001_154706_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000057569.1|155161_155503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065641828.1|155517_156309_-	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_000480968.1|156489_157326_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|157325_158129_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000845048.1|158286_159300_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000019304.1|159902_160472_-	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
WP_002008781.1|160471_160972_-	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
WP_000050481.1|161237_162779_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|163183_164023_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_012695489.1|164513_165158_+	quinolone resistance pentapeptide repeat protein QnrB2	NA	NA	NA	NA	NA
WP_003833285.1|165199_165652_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_077951605.1|166958_168500_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|168904_169744_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|169737_170085_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
169931:169945	attR	TTCAGAACCAGAGAA	NA	NA	NA	NA
WP_012695487.1|171394_171826_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
169931:169945	attR	TTCAGAACCAGAGAA	NA	NA	NA	NA
WP_012695486.1|172188_172602_-	NAD(+)--rifampin ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_012695485.1|172729_173539_-	aminoglycoside N-acetyltransferase AAC(3)-IIg	NA	O64018	Bacillus_phage	29.3	1.2e-17
WP_006473457.1|173780_175136_-|transposase	IS1380-like element IS1247 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
WP_012695484.1|175623_176205_-	aminoglycoside N-acetyltransferase AAC(6')-IIc	NA	NA	NA	NA	NA
WP_000845048.1|176367_177381_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001044210.1|178027_178168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|178173_178878_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000252081.1|179187_180081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371935.1|180252_180483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071366.1|180661_180982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165367.1|181498_181810_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001371932.1|181814_182306_+	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_000781547.1|182858_183062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551490.1|183116_183341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000814953.1|183380_183581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000633161.1|183803_184115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000802040.1|184168_184345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000703842.1|184490_184772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000137794.1|184988_185594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085949440.1|185926_187295_+|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
WP_000589001.1|187470_188811_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000219087.1|189232_190471_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.1	2.5e-11
