The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016553	Aggregatibacter actinomycetemcomitans strain IDH781 chromosome, complete genome	2291252	30934	58504	2291252	transposase,protease	Bacillus_phage(33.33%)	29	NA	NA
WP_145916689.1|30934_31192_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_143106501.1|31173_31650_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	48.6	2.4e-34
WP_081110847.1|31607_31694_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_005540510.1|31789_32944_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.2	5.6e-130
WP_005540508.1|33151_33421_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005540502.1|33516_34266_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_005594325.1|34318_36025_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_005543706.1|36015_37320_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_145916690.1|37436_38693_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_005543710.1|38770_39502_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_005543712.1|39696_41241_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_005543714.1|41264_41804_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_005543719.1|42003_43434_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_005543722.1|43454_43808_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_005543723.1|43904_44501_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_005543726.1|44590_45034_-	peptidoglycan-binding protein LysM	NA	J9QDY6	Clostridium_phage	46.3	2.0e-06
WP_005543727.1|45128_45956_+	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	37.6	1.5e-31
WP_005543730.1|46157_46949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005543732.1|47359_48004_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	53.1	1.4e-53
WP_053293782.1|48147_50412_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_005543738.1|51019_52003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005555157.1|52010_53072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005543742.1|53068_53824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005555155.1|53825_55103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060828677.1|56789_57164_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145916689.1|57205_57463_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_143106501.1|57444_57921_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	48.6	2.4e-34
WP_081110847.1|57878_57965_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_005542464.1|58003_58504_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP016553	Aggregatibacter actinomycetemcomitans strain IDH781 chromosome, complete genome	2291252	668042	726307	2291252	integrase,transposase,tRNA,protease	Bacillus_phage(10.0%)	56	667728:667741	681437:681450
667728:667741	attL	GTTAAATTAAAAAA	NA	NA	NA	NA
WP_033001777.1|668042_668327_+|integrase	integrase	integrase	A0A1B1P773	Bacillus_phage	45.1	2.1e-09
WP_005549678.1|668330_669353_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_005542772.1|669373_670138_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_005549677.1|670175_670838_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_005549676.1|670841_671066_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_005539195.1|671798_672809_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_005539198.1|672811_674932_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005539200.1|674954_676082_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_005539203.1|676111_676306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033001430.1|676459_677149_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_005540455.1|677145_678369_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005540457.1|678361_679771_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_005550263.1|679797_680250_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_005540460.1|680371_680926_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A0F6R5Z1	Sinorhizobium_phage	29.8	1.7e-07
WP_005540462.1|681399_681870_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
681437:681450	attR	TTTTTTAATTTAAC	NA	NA	NA	NA
WP_032997160.1|682163_684293_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005550269.1|684377_685280_+	lipoprotein NlpI	NA	NA	NA	NA	NA
WP_005540468.1|685391_687194_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.4	3.9e-53
WP_005540470.1|687276_687888_-	UDP-glucose 6-dehydrogenase	NA	M1IB49	Acanthocystis_turfacea_Chlorella_virus	52.7	4.0e-50
WP_014702489.1|687944_688100_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_005540471.1|688192_689296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033001881.1|689427_690702_+	GntP family permease	NA	NA	NA	NA	NA
WP_005555207.1|690698_691838_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.1	2.3e-51
WP_005540477.1|691908_692448_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	32.4	6.2e-15
WP_005540479.1|692686_694048_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_005555210.1|694164_694698_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_032997155.1|694755_696147_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_005540485.1|696336_696837_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_032998660.1|696887_697793_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_005540487.1|697961_698678_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_005582243.1|698775_699030_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_071805323.1|699195_700023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005541174.1|700050_701241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005541177.1|701260_702850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081111108.1|702874_704068_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_005554644.1|703977_704217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005549070.1|704325_705261_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_005537850.1|705269_705920_-	cell division ATP-binding protein FtsE	NA	G3M9Y6	Bacillus_virus	31.1	3.5e-20
WP_005553475.1|705958_707335_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_005549072.1|707422_708007_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_005553477.1|708305_709271_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_005541828.1|709288_710086_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_005541826.1|710099_710936_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_005541824.1|711045_712221_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_005541822.1|712511_713762_+	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	23.8	1.5e-16
WP_005541819.1|713887_714607_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_014702498.1|714909_717297_+	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_005541813.1|717312_719229_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_005541811.1|719237_720473_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_005541810.1|720475_720769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005541809.1|720886_722212_-	MFS transporter	NA	NA	NA	NA	NA
WP_005554982.1|722382_723015_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_005541803.1|723209_723668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060828696.1|723762_724530_+|transposase	IS5-like element ISAac2 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	33.3	2.2e-13
WP_005554791.1|724842_725319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005554789.1|725650_726307_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	45.7	7.3e-42
>prophage 3
NZ_CP016553	Aggregatibacter actinomycetemcomitans strain IDH781 chromosome, complete genome	2291252	742853	784167	2291252	integrase,transposase,tRNA,protease	Shigella_phage(36.36%)	51	742787:742846	776223:776912
742787:742846	attL	TGTAGTGGTACACTAATCCCGCATTCCTCAATAAGTGGTAAAATATCATCAACAAGAGGA	NA	NA	NA	NA
WP_071805258.1|742853_742955_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_005544542.1|743211_743487_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_005544544.1|743476_743710_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6J1X2	Lactobacillus_phage	38.1	4.3e-05
WP_094978623.1|743746_743995_+|transposase	transposase	transposase	Q716C2	Shigella_phage	54.7	1.0e-17
WP_005540696.1|744071_744344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109091990.1|744340_744508_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071805270.1|744548_744965_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	35.7	1.7e-12
WP_005540698.1|745350_745974_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_005540704.1|745963_746176_+	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_005554636.1|746175_746448_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_005554632.1|746844_748218_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_005540708.1|748446_748770_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_005540709.1|748918_749473_+	DUF5358 domain-containing protein	NA	NA	NA	NA	NA
WP_005540710.1|750087_750387_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005540711.1|750380_751430_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005554626.1|751674_752559_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_005540715.1|752571_753114_-	adenosine monophosphate-protein transferase	NA	NA	NA	NA	NA
WP_005540717.1|753132_754569_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_005551725.1|754565_754838_-	DUF997 family protein	NA	NA	NA	NA	NA
WP_005540721.1|754861_756250_-	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_005540723.1|756368_757130_-	transferrin-binding protein-like solute binding protein	NA	NA	NA	NA	NA
WP_005540725.1|757427_758774_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005540726.1|758817_759285_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_005540727.1|759408_759885_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_005540728.1|759983_760985_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_005540730.1|760965_761295_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005540731.1|761276_761696_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005540733.1|761735_762593_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_005540735.1|762704_763472_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_005540737.1|763644_764088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005540738.1|764161_765529_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_005540740.1|765547_765982_-	DUF2489 domain-containing protein	NA	NA	NA	NA	NA
WP_005540748.1|765994_766555_-	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_145916691.1|767097_767973_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_005540996.1|768107_768767_-|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_005540997.1|769147_769837_+	nicotinamide riboside transporter PnuC	NA	U5J9C5	Bacillus_phage	36.5	2.2e-36
WP_005549887.1|769911_770619_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_005541000.1|770708_772040_+	ATP-dependent RNA helicase SrmB	NA	A0A1V0SIR5	Klosneuvirus	32.1	2.8e-48
WP_005541001.1|772445_773750_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_094978623.1|774053_774302_-|transposase	transposase	transposase	Q716C2	Shigella_phage	54.7	1.0e-17
WP_005544544.1|774338_774572_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6J1X2	Lactobacillus_phage	38.1	4.3e-05
WP_005540696.1|774724_774997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094978623.1|775073_775322_-|transposase	transposase	transposase	Q716C2	Shigella_phage	54.7	1.0e-17
WP_005544544.1|775358_775592_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6J1X2	Lactobacillus_phage	38.1	4.3e-05
WP_005544542.1|775581_775857_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_071805258.1|776113_776215_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_041160793.1|776277_776703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005542545.1|777993_780267_-	bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB	NA	NA	NA	NA	NA
776223:776912	attR	TCCTCTTGTTGATGATATTTTACCACTTATTGAGGAATGCGGGATTAGTGTACCACTACAGCACCAGTTTGGTGATTTGCGATTTCTTACGGTATTGATTGCCCGAATAATTCGGCACGCTCACCTGTACGCTGATAGCAAGTAACTCATCATAAGCAATAGAACCCACATCCACCTCTTCCGAATAGGTGCTGAAGTTCATGTAAGGCAAACGTTCATCTTGTATGGTCAGGCTTGCCAGCCCTTCCTGTTCAAACGCCGTCACAATATGGATTTTCGCTTTCTCCAAGCTCAACCGCCAGTCTTCATAGCTCGGATAAACCCTTTTCACATTTTTGGCATAGCCAATCAGGGTATCAAGGCGTATTGCCTGTGCATCCTGCTCGGTATAAATACCCGGGTAGTTCACCAGGATTTTACGTGGATTGAAGGTATCTAAGGTTAAAACAATCTGTGCTGCGGATTTTAAGTAGCGCTGCATTTCGATTTGGTAGTAACGAACTTCATCGGTGATCTCAAGTTTACCTTGGGTATAACTAAATTTACTGGCTTCAAATATTCTTGTTTTAAATGATGACGGTCTTTTTCTTGTCCACTCATAAGCTTTTTCTTGGTCAGGCTCTCCCCAGTAATTAAGACTATTGCCCCAAAACCCATGCGCCGCCCACAGCTCAATATCTTCCGGCGCAA	NA	NA	NA	NA
WP_005542549.1|780498_782100_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_005542551.1|782343_782925_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	61.3	2.0e-59
WP_005542555.1|782934_784167_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.9	1.6e-127
>prophage 4
NZ_CP016553	Aggregatibacter actinomycetemcomitans strain IDH781 chromosome, complete genome	2291252	1098521	1147345	2291252	integrase,transposase,tRNA,protease	Bacillus_phage(11.11%)	50	1086132:1086149	1153650:1153667
1086132:1086149	attL	ACCGCACTTTTACAAGCC	NA	NA	NA	NA
WP_145916692.1|1098521_1098779_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_145916693.1|1098760_1099282_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.0	7.6e-42
WP_005589530.1|1099357_1099768_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005544590.1|1099888_1100200_-	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_005544588.1|1100291_1100609_+	DUF2547 family protein	NA	NA	NA	NA	NA
WP_005544999.1|1100681_1103381_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_005544584.1|1103457_1103862_+	8-oxo-dGTP diphosphatase MutT	NA	NA	NA	NA	NA
WP_005544582.1|1104353_1105388_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_005550875.1|1105387_1105891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005540005.1|1106032_1108621_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.3	7.0e-189
WP_005539999.1|1109396_1109690_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005555177.1|1109673_1110093_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005539995.1|1110183_1111011_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	41.5	1.9e-07
WP_005539993.1|1111026_1111890_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_005550868.1|1111967_1112894_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005539986.1|1112966_1113503_-	bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR	NA	NA	NA	NA	NA
WP_005539982.1|1113641_1114052_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_005539980.1|1114164_1114776_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_005555174.1|1114799_1116167_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.4	2.0e-110
WP_071805285.1|1116135_1116408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005539977.1|1116388_1117138_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005539975.1|1117251_1117659_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005539973.1|1117796_1118921_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_005555172.1|1118933_1119764_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005539967.1|1120403_1121783_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005538533.1|1121936_1122731_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_014167584.1|1122805_1124068_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_005538526.1|1124242_1124713_+	TonB-system energizer ExbB	NA	NA	NA	NA	NA
WP_005550148.1|1124716_1125163_+	TonB system transport protein ExbD	NA	NA	NA	NA	NA
WP_005538521.1|1125172_1125931_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005538518.1|1126018_1126792_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005538517.1|1126867_1127395_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	65.1	1.4e-59
WP_005593809.1|1127556_1128801_+	tryptophan permease	NA	NA	NA	NA	NA
WP_005538649.1|1129077_1129395_+	DUF4298 domain-containing protein	NA	NA	NA	NA	NA
WP_005538650.1|1129776_1130484_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_005554522.1|1130698_1131226_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_005538655.1|1131246_1132578_+	HslU--HslV peptidase ATPase subunit	NA	A0A2H5BJT2	Erwinia_phage	30.4	5.4e-44
WP_005538657.1|1132643_1134227_+	nickel ABC transporter, nickel/metallophore periplasmic binding protein	NA	NA	NA	NA	NA
WP_032996149.1|1134325_1135069_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_005538674.1|1135086_1135581_+	YfbU family protein	NA	NA	NA	NA	NA
WP_155719820.1|1136025_1136196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065559835.1|1136192_1138418_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.9	4.0e-23
WP_041160747.1|1138421_1139561_+	phospholipase	NA	NA	NA	NA	NA
WP_041160783.1|1139521_1140625_+	phospholipase	NA	NA	NA	NA	NA
WP_005538541.1|1142708_1143539_-	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_005538543.1|1143802_1144606_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005538545.1|1144623_1145967_+	MFS transporter	NA	NA	NA	NA	NA
WP_094978623.1|1146561_1146810_-|transposase	transposase	transposase	Q716C2	Shigella_phage	54.7	1.0e-17
WP_005544544.1|1146846_1147080_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6J1X2	Lactobacillus_phage	38.1	4.3e-05
WP_005544542.1|1147069_1147345_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
1153650:1153667	attR	ACCGCACTTTTACAAGCC	NA	NA	NA	NA
>prophage 5
NZ_CP016553	Aggregatibacter actinomycetemcomitans strain IDH781 chromosome, complete genome	2291252	1278735	1322342	2291252	integrase,transposase,tRNA,protease	Bacillus_virus(20.0%)	39	1316365:1316382	1327819:1327836
WP_005553373.1|1278735_1280679_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.1	7.8e-116
WP_005553369.1|1281437_1282496_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.2	4.3e-28
WP_005544430.1|1282517_1284212_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_005551543.1|1284214_1285294_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	4.4e-28
WP_005544426.1|1285315_1286314_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005594911.1|1286687_1287809_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_158512147.1|1287837_1288644_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.8	1.8e-50
WP_005594724.1|1288640_1289015_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005594094.1|1289191_1290532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005542098.1|1290488_1291085_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_005552915.1|1291077_1292328_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005551600.1|1292379_1293219_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.8	1.6e-38
WP_032997062.1|1293227_1294010_-	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_005551602.1|1294117_1294432_+	YqcC family protein	NA	NA	NA	NA	NA
WP_005542108.1|1294428_1295142_+|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_005565219.1|1295192_1295357_+	YoaH family protein	NA	NA	NA	NA	NA
WP_005551608.1|1295547_1295757_+	cold shock domain-containing protein CspD	NA	A0A1J0GVA5	Vibrio_phage	53.1	9.5e-12
WP_005551610.1|1295823_1296270_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_005542113.1|1296416_1298201_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_005548745.1|1298343_1298874_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_005551614.1|1299298_1299655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065559846.1|1299725_1303391_+	exodeoxyribonuclease V subunit beta	NA	NA	NA	NA	NA
WP_005554331.1|1303390_1305370_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	23.7	4.6e-15
WP_005551622.1|1305382_1305979_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005542161.1|1306220_1306649_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_005542159.1|1306665_1307058_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_005551624.1|1307218_1308004_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_005542149.1|1308295_1308550_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_005542147.1|1308764_1310222_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_005542144.1|1310451_1311231_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_005542142.1|1311301_1313782_-	trimethylamine-N-oxide reductase TorA	NA	NA	NA	NA	NA
WP_005542140.1|1313842_1314943_-	cytochrome C nitrate reductase	NA	NA	NA	NA	NA
WP_005542139.1|1315248_1316706_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
1316365:1316382	attL	GAAAGTGCGGTGGAAAAT	NA	NA	NA	NA
WP_005542137.1|1316789_1317494_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_033002082.1|1317677_1318670_+	virulence protein RhuM/Fic/DOC family protein	NA	NA	NA	NA	NA
WP_145916695.1|1318697_1319464_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.2	9.8e-14
WP_014702205.1|1319691_1319979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071805329.1|1320057_1321029_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.8	1.2e-51
WP_005538156.1|1321340_1322342_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M3LRG1	Mannheimia_phage	52.4	4.5e-91
1327819:1327836	attR	GAAAGTGCGGTGGAAAAT	NA	NA	NA	NA
