The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016573	Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 chromosome, complete genome	4751453	371624	415220	4751453	terminase,holin,integrase,coat,protease,lysis,portal	Enterobacteria_phage(44.44%)	64	375471:375516	414736:414781
WP_001043660.1|371624_372677_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	2.2e-112
WP_001285275.1|372959_374063_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893221.1|374074_375325_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.1e-98
375471:375516	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
WP_000051900.1|375530_376694_-|integrase	site-specific integrase	integrase	A0A075B8E2	Enterobacteria_phage	99.7	2.4e-229
WP_000016640.1|376923_377559_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
WP_001277769.1|377659_377839_-	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	98.3	1.6e-28
WP_000208013.1|377935_378622_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.2	4.3e-53
WP_000224223.1|378632_378896_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
WP_001289978.1|378897_379383_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.3e-43
WP_000812182.1|379379_380006_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	71.2	7.1e-71
WP_001682200.1|380002_380167_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_001111313.1|380177_380474_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	90.8	3.9e-43
WP_000031375.1|380804_381422_-	ERF family protein	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
WP_001163402.1|381418_381562_-	hypothetical protein	NA	A0A075B8I9	Enterobacteria_phage	100.0	3.2e-19
WP_000158027.1|381551_381740_-	DUF5444 family protein	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
WP_000582314.1|381720_381879_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
WP_000776964.1|381964_382276_-	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
WP_001737461.1|382423_382627_-	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
WP_000651935.1|382626_382863_-	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
WP_000213983.1|382899_383094_-	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_001682202.1|383308_383887_+	superinfection exclusion B family protein	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_000216175.1|383907_384210_-	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001095984.1|384563_385214_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000276884.1|385294_385480_+	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_000424167.1|385586_385865_+	lambda phage CII family protein	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001125981.1|385899_386046_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067075.1|386038_386854_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001248406.1|386850_388227_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000736921.1|388300_388738_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_000679702.1|388734_388908_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113772.1|388874_389051_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|389053_389386_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|389378_389555_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|389547_390159_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000036317.1|390155_390380_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_000149925.1|390376_390580_+	phage NinH family protein	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219131.1|390560_390740_+	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_001235453.1|390736_391360_+	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_000286100.1|391798_392002_+|holin	phage holin family protein	holin	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000074137.1|391979_392477_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
WP_001531485.1|392565_393003_+|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
WP_001177703.1|393215_393902_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
WP_000807785.1|394204_394447_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001278047.1|394448_394628_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
WP_000729925.1|394651_395140_+	DNA-packaging protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_000417849.1|395117_396617_+|terminase	terminase large subunit	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
WP_000774656.1|396616_398794_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
WP_000433852.1|398807_399719_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196938.1|399718_401011_+|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000684729.1|401049_401259_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001166098.1|401242_401743_+	packaged DNA stabilization gp4 family protein	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_001122424.1|401702_403121_+	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_000774927.1|403124_403826_+	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_000627697.1|403825_404281_+	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_000964902.1|404283_404976_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
WP_000246945.1|404985_406281_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	84.5	2.1e-181
WP_001029838.1|406280_408278_+	hypothetical protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
WP_000749288.1|408368_408854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023602519.1|409256_409544_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	67.8	1.9e-26
WP_000129930.1|409646_411650_+	endorhamnosidase	NA	A0A2H4FWI0	Salmonella_phage	99.9	0.0e+00
WP_000671495.1|411708_413166_-	glucosyltransferase domain-containing protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
WP_000703640.1|413155_414088_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|414084_414447_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_001683918.1|414944_415220_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.9e-23
414736:414781	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 2
NZ_CP016573	Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 chromosome, complete genome	4751453	1019438	1027461	4751453	protease,transposase	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|1019438_1020557_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125890.1|1020553_1022500_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|1022629_1022851_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1023174_1023495_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1023525_1025802_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1025992_1026451_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001117984.1|1026724_1026922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|1027083_1027461_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 3
NZ_CP016573	Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 chromosome, complete genome	4751453	1078070	1176029	4751453	transposase,tRNA,terminase,holin,tail,protease,lysis,portal	Salmonella_phage(43.86%)	103	NA	NA
WP_001154025.1|1078070_1078874_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1078866_1080189_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1080169_1080874_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572753.1|1080873_1085340_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925883.1|1085684_1087505_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1087764_1088313_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1088340_1088988_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1089049_1090240_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_045720415.1|1090424_1091516_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.5	8.3e-99
WP_000117870.1|1092122_1093523_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1093723_1094185_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1094501_1095716_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893206.1|1095960_1097394_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191413.1|1097474_1098677_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262307.1|1098871_1100164_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000065276.1|1100208_1100457_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001682304.1|1100497_1100737_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	98.7	3.3e-37
WP_000189634.1|1100742_1101612_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	86.3	7.2e-146
WP_000187054.1|1101608_1102289_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	97.8	3.3e-130
WP_000100830.1|1102285_1103071_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.8	2.4e-148
WP_000995352.1|1103076_1103373_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
WP_000186242.1|1103463_1103664_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000373338.1|1103951_1104158_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_000091280.1|1104184_1104619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000439725.1|1104620_1105046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230956.1|1105088_1105484_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000992434.1|1105588_1105825_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_015675517.1|1105790_1106165_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.9e-63
WP_031611230.1|1106256_1107162_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.3	7.7e-175
WP_000788826.1|1107158_1107860_+	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	99.1	1.9e-128
WP_023602525.1|1107904_1108306_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
WP_000215887.1|1108302_1108836_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.8	8.1e-92
WP_000224239.1|1108837_1109095_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	4.5e-40
WP_000208143.1|1109105_1109507_+	hypothetical protein	NA	I6R0R2	Salmonella_phage	82.0	1.2e-18
WP_000877758.1|1109614_1110259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1110489_1110723_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1110839_1111088_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|1111122_1111725_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096547.1|1111933_1112545_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001617856.1|1112541_1112688_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1112677_1113475_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_000508329.1|1113641_1113860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000658038.1|1114140_1114329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682303.1|1114531_1114834_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000301013.1|1114811_1115351_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	72.4	2.2e-76
WP_001080030.1|1115658_1116153_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.3	2.2e-59
WP_000371784.1|1116363_1116897_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989238.1|1116853_1118992_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	6.9e-291
WP_000196190.1|1118988_1119195_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009205.1|1119191_1120739_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	63.8	1.1e-176
WP_077906133.1|1120662_1122741_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.3	2.4e-264
WP_001107908.1|1122831_1123155_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1123147_1123447_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453192.1|1123427_1123994_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000196703.1|1123990_1124392_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000132755.1|1124403_1125153_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478858.1|1125198_1125597_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1125593_1125923_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_065305406.1|1126002_1128990_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	2.5e-262
WP_000978295.1|1128986_1129319_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_000410972.1|1129417_1129942_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
WP_000877926.1|1130031_1130565_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1130654_1131350_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000606356.1|1131359_1132097_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	5.2e-113
WP_020867839.1|1131994_1132699_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
WP_000033414.1|1132770_1136121_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	69.3	0.0e+00
WP_000178849.1|1136159_1136402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001532020.1|1136455_1138831_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	64.9	1.9e-87
WP_031618324.1|1139331_1139652_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
WP_000143158.1|1139641_1140223_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_000161705.1|1140419_1141142_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000343758.1|1141792_1143013_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_071531551.1|1143009_1143507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193784.1|1143941_1146554_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1146761_1147772_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1147937_1148480_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1148476_1149586_-	YcbX family protein	NA	NA	NA	NA	NA
WP_001086485.1|1149684_1151793_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1151805_1153713_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000333152.1|1153727_1154981_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1154985_1156626_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1156622_1157186_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1157441_1157609_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1157708_1158227_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1158295_1160056_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1160241_1160694_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1160765_1161818_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1162174_1162684_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1162900_1163506_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1163492_1165646_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1165664_1166111_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1166234_1168289_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1168324_1168783_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847716.1|1168877_1169540_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1169713_1170127_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1170171_1170489_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1170546_1171758_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|1171972_1172521_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1172546_1173326_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|1173374_1173656_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1173652_1173982_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|1174068_1174728_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938191.1|1175348_1176029_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP016573	Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 chromosome, complete genome	4751453	2075152	2082404	4751453		Morganella_phage(33.33%)	8	NA	NA
WP_001157304.1|2075152_2076583_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
WP_000377037.1|2076656_2077352_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_000107434.1|2077431_2077743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080662.1|2078393_2079590_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_024131109.1|2079847_2080036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2080046_2080259_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457664.1|2080713_2081982_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.2e-226
WP_000394197.1|2081984_2082404_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 5
NZ_CP016573	Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 chromosome, complete genome	4751453	2171747	2182253	4751453		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2171747_2173061_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2173087_2174167_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2174171_2174945_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2174941_2175934_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2175939_2176491_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2176491_2177370_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2177417_2178317_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2178316_2179402_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2179778_2180672_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111845.1|2180849_2182253_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	6.8e-21
>prophage 6
NZ_CP016573	Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 chromosome, complete genome	4751453	2250529	2259700	4751453	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|2250529_2252563_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2252803_2253262_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|2253433_2253964_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2254020_2254488_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2254534_2255254_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2255250_2256936_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|2257158_2257890_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2257949_2258057_+	protein YohO	NA	NA	NA	NA	NA
WP_000824857.1|2258037_2258769_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569165.1|2258752_2259700_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NZ_CP016573	Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 chromosome, complete genome	4751453	2279107	2345494	4751453	tail,lysis,holin	Salmonella_phage(25.0%)	59	NA	NA
WP_000989295.1|2279107_2279803_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2279956_2280841_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2281017_2281737_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2281733_2281979_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136394.1|2282183_2283425_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956097.1|2283418_2284654_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2284728_2285739_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2285754_2287275_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2287408_2288407_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2288905_2289928_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001520237.1|2290077_2291220_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2291234_2291903_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2292232_2293090_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2293078_2293468_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001531764.1|2293472_2294840_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022910.1|2295056_2295944_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2295976_2297299_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488244.1|2297342_2299334_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2299679_2301149_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548316.1|2301338_2302202_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137966.1|2302322_2303372_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873906.1|2303450_2304308_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	1.3e-22
WP_000854395.1|2304372_2306061_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2306077_2307016_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2307015_2308146_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2308513_2309695_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213897.1|2309758_2310424_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2310425_2310548_-	membrane protein	NA	NA	NA	NA	NA
WP_001523448.1|2310935_2311190_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2311513_2312086_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169346.1|2312298_2313285_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2313314_2314034_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2314447_2315020_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957755.1|2315345_2316902_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561742.1|2317008_2318814_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501626.1|2318823_2319918_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137747.1|2319917_2320943_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000222013.1|2320944_2322534_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	7.2e-19
WP_001094639.1|2322537_2322882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2323272_2324463_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234834.1|2324490_2325186_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578130.1|2325337_2327098_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	1.4e-100
WP_000494192.1|2327222_2327507_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033443.1|2327615_2328236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2328263_2329271_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2329450_2329678_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2329709_2331470_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2331750_2332254_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2332281_2332572_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000022213.1|2334795_2335239_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2335616_2336144_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2336146_2337388_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2337980_2338310_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894638.1|2338606_2339938_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	4.6e-19
WP_010989045.1|2339966_2340335_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2340349_2341339_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2341667_2344034_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2344202_2344406_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2344702_2345494_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP016573	Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 chromosome, complete genome	4751453	4333970	4381491	4751453	tail,tRNA,holin,plate	Burkholderia_phage(40.91%)	50	NA	NA
WP_000587739.1|4333970_4334612_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	4.6e-33
WP_024132246.1|4335190_4335607_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000084336.1|4335987_4336443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151758.1|4336439_4337054_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368193.1|4337060_4338719_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_000359509.1|4338721_4339354_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000951734.1|4339346_4340462_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_001093501.1|4340452_4340812_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632053.1|4340975_4342523_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_000703633.1|4342522_4343452_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000593182.1|4343448_4343811_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4344138_4344861_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4344870_4345914_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4345901_4346111_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271420.1|4346110_4347064_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4347063_4349418_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4349514_4349643_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4349602_4349920_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907497.1|4349971_4350496_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
WP_000729852.1|4350495_4351923_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4351912_4352110_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4352106_4352562_-	Gp37 family protein	NA	NA	NA	NA	NA
WP_000777266.1|4352721_4353036_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4353048_4353654_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4353656_4353944_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4354519_4354867_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_000136400.1|4354999_4356349_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000790037.1|4356693_4358343_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001541297.1|4358786_4359029_+	outer membrane protein	NA	NA	NA	NA	NA
WP_022742863.1|4359062_4359731_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000977979.1|4359727_4360465_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000750804.1|4360464_4362561_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000982749.1|4362703_4363114_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252085.1|4363279_4364170_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000382573.1|4364184_4365729_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695415.1|4365860_4367051_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179176.1|4367412_4368522_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000973681.1|4368610_4369969_+	maltoporin	NA	NA	NA	NA	NA
WP_000782497.1|4370132_4371050_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000019230.1|4371230_4371728_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455249.1|4371741_4372614_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017360.1|4372712_4375133_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002900.1|4375303_4375672_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646079.1|4375780_4376389_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001128112.1|4376567_4377893_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001575282.1|4377889_4378003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030592.1|4378024_4378234_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416271.1|4378332_4378848_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001039342.1|4379094_4380405_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001182224.1|4380492_4381491_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
