The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016588	Bacillus thuringiensis strain KNU-07 chromosome, complete genome	5344151	57268	65216	5344151		Bacillus_phage(33.33%)	6	NA	NA
WP_000719210.1|57268_58774_-	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	30.0	7.8e-31
WP_000929887.1|58757_59459_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	7.3e-40
WP_000833096.1|59602_60928_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_000743906.1|61313_62852_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_001029993.1|63258_64893_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_000917311.1|64931_65216_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
>prophage 2
NZ_CP016588	Bacillus thuringiensis strain KNU-07 chromosome, complete genome	5344151	1858677	1969582	5344151	tail,transposase,terminase,head,integrase,coat,protease,portal,tRNA,holin	Bacillus_phage(52.17%)	108	1858859:1858876	1930360:1930377
WP_000213002.1|1858677_1859982_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
1858859:1858876	attL	CTTTAACAAATGCAGTTG	NA	NA	NA	NA
WP_001101241.1|1860047_1860947_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.8	3.1e-35
WP_000526272.1|1860989_1861532_+|protease	ATP-dependent protease proteolytic subunit HslV	protease	NA	NA	NA	NA
WP_000550087.1|1861554_1862946_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.0	3.2e-47
WP_000421290.1|1863023_1863803_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_000111485.1|1864151_1864853_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_001018578.1|1864956_1865844_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000042668.1|1865910_1866633_+	UMP kinase	NA	NA	NA	NA	NA
WP_000531501.1|1866635_1867193_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_000971296.1|1867278_1868055_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.5	9.0e-23
WP_000813594.1|1868072_1868864_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000790372.1|1868887_1870030_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_001090245.1|1870047_1871304_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_065703272.1|1871413_1873114_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_065703274.1|1873238_1877540_+	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	39.6	4.1e-24
WP_000359096.1|1877876_1878347_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000102604.1|1878364_1879471_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000071127.1|1879482_1879755_+	YlxR family protein	NA	NA	NA	NA	NA
WP_001286524.1|1879755_1880067_+	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000036343.1|1880071_1882132_+	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.9	3.8e-20
WP_000582367.1|1882128_1882410_+	DUF503 family protein	NA	NA	NA	NA	NA
WP_000776437.1|1882425_1882782_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_065703281.1|1882868_1883792_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000766702.1|1883835_1884807_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001229392.1|1884907_1885177_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_000076737.1|1885337_1887476_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000868232.1|1887630_1888530_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000592989.1|1888616_1889858_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	34.5	4.4e-56
WP_001239756.1|1889992_1890244_+	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000954735.1|1890414_1891317_+	dipicolinic acid synthetase subunit A	NA	NA	NA	NA	NA
WP_065703284.1|1891771_1893319_-	serine recombinase	NA	I3VYZ3	Thermoanaerobacterium_phage	52.6	9.5e-141
WP_065703287.1|1893461_1894211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065703289.1|1894508_1895042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048558726.1|1895082_1895517_-	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	77.8	1.3e-60
WP_065703292.1|1895529_1895967_-	helix-turn-helix transcriptional regulator	NA	D2XR39	Bacillus_phage	59.9	5.4e-33
WP_065703294.1|1896139_1896331_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065703296.1|1896363_1896612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537273.1|1896702_1897290_+	hypothetical protein	NA	D2XR41	Bacillus_phage	69.2	4.9e-74
WP_000215315.1|1897303_1897525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065703299.1|1897705_1897990_+	hypothetical protein	NA	D2XR42	Bacillus_phage	54.3	9.5e-23
WP_065703302.1|1898269_1899220_+	DnaD domain protein	NA	D2XR43	Bacillus_phage	59.7	4.0e-73
WP_065703304.1|1899216_1900539_+	replicative DNA helicase	NA	D2XR44	Bacillus_phage	95.5	2.1e-237
WP_065703306.1|1900541_1900730_+	hypothetical protein	NA	D2XR45	Bacillus_phage	85.5	2.2e-15
WP_065703308.1|1900704_1901067_+	cell division protein SepF	NA	D2XR47	Bacillus_phage	90.0	1.4e-55
WP_065703314.1|1901141_1901333_+	DUF3954 domain-containing protein	NA	D2XR48	Bacillus_phage	83.3	4.6e-21
WP_033693376.1|1901447_1902242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065703316.1|1902267_1903452_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	28.6	1.4e-35
WP_065703318.1|1903681_1904737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065703320.1|1904738_1906037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065703322.1|1906239_1906725_+	ArpU family transcriptional regulator	NA	A0A1B0T6C9	Bacillus_phage	72.3	8.0e-62
WP_065703324.1|1906721_1907264_+|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	95.0	4.9e-92
WP_098283659.1|1907445_1907976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065703326.1|1908403_1908664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065703328.1|1908741_1908987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065703330.1|1908988_1909201_+	hypothetical protein	NA	A0A1B1P7X2	Bacillus_phage	67.9	4.6e-14
WP_065703332.1|1909187_1909523_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	90.1	1.8e-52
WP_065703334.1|1909674_1910031_+	hypothetical protein	NA	A0A2H4JBV9	uncultured_Caudovirales_phage	99.2	1.0e-58
WP_065703336.1|1910027_1911683_+|terminase	terminase large subunit	terminase	A0A2H4JI41	uncultured_Caudovirales_phage	95.5	6.1e-311
WP_065704997.1|1911748_1912855_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	90.1	2.4e-186
WP_065703339.1|1912838_1913615_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	3.3e-57
WP_065703341.1|1913635_1914799_+	hypothetical protein	NA	A0A2H4JH29	uncultured_Caudovirales_phage	96.1	1.5e-210
WP_065703342.1|1914811_1915108_+	hypothetical protein	NA	D2XR19	Bacillus_phage	87.5	3.3e-42
WP_065703344.1|1915109_1915460_+|head	phage head closure protein	head	D2XR20	Bacillus_phage	85.2	2.7e-51
WP_000997556.1|1915461_1915806_+	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	82.3	8.8e-47
WP_000176452.1|1915802_1916138_+	hypothetical protein	NA	D2XR22	Bacillus_phage	89.9	7.5e-51
WP_065703346.1|1916138_1916726_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	81.0	7.4e-86
WP_000415912.1|1916730_1917093_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.8	2.4e-42
WP_065703348.1|1917325_1920952_+	DUF2207 domain-containing protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	85.5	1.8e-182
WP_065703350.1|1920993_1922463_+|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	80.0	5.3e-234
WP_065703352.1|1922459_1928024_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	57.3	0.0e+00
WP_065703354.1|1928039_1928414_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	97.6	2.7e-65
WP_065703356.1|1928531_1929917_+	PQQ-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_065703361.1|1930004_1930430_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	96.5	1.4e-70
1930360:1930377	attR	CTTTAACAAATGCAGTTG	NA	NA	NA	NA
WP_065703364.1|1930429_1931239_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	91.8	1.3e-152
WP_065703366.1|1931566_1932064_-	hypothetical protein	NA	A0A1B2APY6	Phage_Wrath	79.4	1.2e-68
WP_154214719.1|1932221_1932455_+	dipicolinate synthase	NA	NA	NA	NA	NA
WP_000414846.1|1932605_1933652_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000692451.1|1933675_1934908_+	aspartate kinase	NA	NA	NA	NA	NA
WP_000564763.1|1934919_1935798_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_000823098.1|1936534_1938205_+	ribonuclease J	NA	NA	NA	NA	NA
WP_000139806.1|1938306_1939056_+	translocation-enhancing protein TepA	NA	NA	NA	NA	NA
WP_000605020.1|1939052_1939256_+	ribonuclease	NA	NA	NA	NA	NA
WP_001118776.1|1939468_1941850_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	51.4	2.0e-89
WP_155759224.1|1941922_1943291_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	65.3	2.2e-93
WP_000114182.1|1943845_1944571_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065703368.1|1944663_1945749_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000456909.1|1945866_1947399_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.6	2.8e-12
WP_001085254.1|1947391_1948450_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000008857.1|1948450_1949410_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000772405.1|1949619_1950894_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	30.1	1.2e-56
WP_065703370.1|1950894_1952181_+	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	28.9	1.7e-10
WP_000759606.1|1952281_1952995_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000114450.1|1953070_1953319_+	DUF3243 domain-containing protein	NA	NA	NA	NA	NA
WP_000574107.1|1953457_1954243_+	DUF3388 domain-containing protein	NA	NA	NA	NA	NA
WP_065703372.1|1954264_1955221_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065703374.1|1955285_1955864_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000990688.1|1955884_1957123_+	competence/damage-inducible protein CinA	NA	NA	NA	NA	NA
WP_065703376.1|1957972_1958596_+	topoisomerase I	NA	NA	NA	NA	NA
WP_001115373.1|1958861_1959287_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	68.9	2.7e-45
WP_000099770.1|1959768_1961334_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_065703378.1|1961496_1962291_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_000404341.1|1962440_1962701_+	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	43.8	8.4e-10
WP_065703380.1|1962759_1963683_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_000625417.1|1963907_1965665_+	2-oxoacid:acceptor oxidoreductase subunit alpha	NA	NA	NA	NA	NA
WP_000190155.1|1965651_1966518_+	2-oxoacid:ferredoxin oxidoreductase subunit beta	NA	NA	NA	NA	NA
WP_065703382.1|1966948_1968478_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_000870461.1|1968481_1968913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288799.1|1969039_1969582_+|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
>prophage 3
NZ_CP016588	Bacillus thuringiensis strain KNU-07 chromosome, complete genome	5344151	2042144	2051470	5344151	bacteriocin	uncultured_Caudovirales_phage(40.0%)	13	NA	NA
WP_033683142.1|2042144_2042804_-	helix-turn-helix domain-containing protein	NA	A0A2H4J441	uncultured_Caudovirales_phage	41.0	8.7e-35
WP_000283431.1|2043008_2043221_+	hypothetical protein	NA	A6M975	Geobacillus_virus	63.0	1.6e-11
WP_065703428.1|2043423_2044182_+	antirepressor	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	69.0	3.0e-95
WP_001189064.1|2044193_2044388_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	71.0	5.9e-16
WP_065703430.1|2044540_2045413_+	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	60.5	6.2e-97
WP_000464424.1|2045821_2046208_+	DUF1492 domain-containing protein	NA	A0A288WG73	Bacillus_phage	70.6	2.2e-46
WP_065705001.1|2046446_2047433_+	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	42.8	1.4e-33
WP_065703432.1|2047588_2048431_+	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	45.5	9.7e-31
WP_000392443.1|2048492_2048723_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	77.6	1.7e-25
WP_001102627.1|2049094_2049418_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065703434.1|2049410_2049953_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000976240.1|2049953_2050757_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_000413738.1|2050849_2051470_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
>prophage 4
NZ_CP016588	Bacillus thuringiensis strain KNU-07 chromosome, complete genome	5344151	3097416	3102653	5344151		Bacillus_phage(50.0%)	9	NA	NA
WP_001163828.1|3097416_3098091_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.7	2.8e-28
WP_000411453.1|3098103_3098634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065703994.1|3098751_3099261_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	35.4	4.1e-16
WP_065703996.1|3099388_3100270_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_002061469.1|3100407_3100608_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	90.9	1.0e-15
WP_002061468.1|3100672_3100885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000097509.1|3100904_3101705_-	C1 family peptidase	NA	A0A2K9L1Z4	Tupanvirus	37.2	1.0e-37
WP_000369348.1|3102069_3102201_-	DUF3983 domain-containing protein	NA	A0A1B1P7V8	Bacillus_phage	79.1	2.9e-11
WP_001139345.1|3102437_3102653_+	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	83.8	3.4e-25
>prophage 5
NZ_CP016588	Bacillus thuringiensis strain KNU-07 chromosome, complete genome	5344151	3137340	3163527	5344151	head,terminase,integrase,protease,capsid,portal,tail	Bacillus_phage(48.0%)	26	3131606:3131621	3167350:3167365
3131606:3131621	attL	AAAAACAAAAATATAG	NA	NA	NA	NA
WP_025710284.1|3137340_3138405_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	94.4	9.9e-198
WP_000461725.1|3138401_3138641_-	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	96.2	1.0e-33
WP_025710285.1|3138640_3138877_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	98.7	2.0e-18
WP_065704015.1|3138970_3139345_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	76.9	1.8e-45
WP_065704017.1|3139356_3143676_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	58.9	0.0e+00
WP_065704018.1|3143672_3145130_-|tail	phage tail protein	tail	A0A0A7AQV1	Bacillus_phage	59.3	3.4e-172
WP_065704020.1|3145171_3148759_-	DUF2207 domain-containing protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	90.3	2.8e-196
WP_065704022.1|3148989_3149352_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	85.8	5.4e-55
WP_065704024.1|3149358_3149946_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	82.1	1.1e-86
WP_065704026.1|3149946_3150285_-	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	85.5	8.6e-47
WP_065704028.1|3150281_3150626_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	81.4	7.4e-46
WP_065704030.1|3150627_3150981_-|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	96.6	1.7e-58
WP_065704032.1|3150982_3151276_-	hypothetical protein	NA	D2XR19	Bacillus_phage	87.6	2.5e-42
WP_065704034.1|3151288_3152452_-|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	84.8	2.1e-185
WP_065704036.1|3152471_3153248_-|protease	Clp protease ClpP	protease	R9TLM7	Paenibacillus_phage	52.8	3.3e-57
WP_065705031.1|3153231_3154338_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	90.4	1.4e-186
WP_065704038.1|3154402_3156058_-|terminase	terminase large subunit	terminase	A0A2H4JI41	uncultured_Caudovirales_phage	94.9	2.5e-309
WP_000763336.1|3156054_3156411_-	hypothetical protein	NA	A0A2H4JBV9	uncultured_Caudovirales_phage	100.0	3.6e-59
WP_001258476.1|3156561_3156903_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	92.7	3.6e-53
WP_065704040.1|3156883_3157297_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	53.3	5.3e-30
WP_065704045.1|3158148_3158424_-	hypothetical protein	NA	A0A1B1P857	Bacillus_phage	72.5	3.4e-33
WP_000930969.1|3158795_3159014_-	hypothetical protein	NA	H0USV5	Bacillus_phage	66.2	5.2e-21
WP_016081850.1|3159356_3160526_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.6	6.1e-23
WP_065704047.1|3161337_3162288_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_001012135.1|3162502_3163045_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.1	7.3e-88
WP_016081851.1|3163044_3163527_-	ArpU family phage transcriptional regulator	NA	H0USV3	Bacillus_phage	82.5	2.5e-71
3167350:3167365	attR	AAAAACAAAAATATAG	NA	NA	NA	NA
>prophage 6
NZ_CP016588	Bacillus thuringiensis strain KNU-07 chromosome, complete genome	5344151	3169783	3173755	5344151		Bacillus_phage(77.78%)	9	NA	NA
WP_065704057.1|3169783_3170293_-	dUTPase	NA	A0A1L2JY27	Aeribacillus_phage	45.4	6.7e-27
WP_065704059.1|3170312_3170564_-	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	48.7	1.3e-15
WP_000717825.1|3170589_3170757_-	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.8e-13
WP_065704060.1|3170775_3171135_-	cell division protein SepF	NA	A0A1B1P7A1	Bacillus_phage	52.5	2.4e-31
WP_065704062.1|3171127_3171406_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	66.1	2.7e-14
WP_065704065.1|3171409_3172465_-	DnaD domain protein	NA	W8CYG5	Bacillus_phage	44.2	1.6e-59
WP_000522028.1|3172686_3172953_-	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	92.9	6.4e-37
WP_065704067.1|3173009_3173201_-	helix-turn-helix transcriptional regulator	NA	A0A0U3SLC2	Bacillus_phage	85.2	8.3e-23
WP_065704069.1|3173401_3173755_+	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	82.8	3.4e-46
>prophage 7
NZ_CP016588	Bacillus thuringiensis strain KNU-07 chromosome, complete genome	5344151	3795411	3803507	5344151		Bacillus_phage(66.67%)	7	NA	NA
WP_001258541.1|3795411_3796284_-	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	44.8	1.6e-65
WP_065704333.1|3796574_3797294_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_065704335.1|3797521_3798595_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	97.2	5.1e-186
WP_065704337.1|3798591_3799269_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	98.7	4.3e-122
WP_065704339.1|3799355_3801116_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.2	1.8e-273
WP_001194306.1|3801356_3802121_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000755513.1|3802220_3803507_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
>prophage 8
NZ_CP016588	Bacillus thuringiensis strain KNU-07 chromosome, complete genome	5344151	5324950	5333326	5344151		Synechococcus_phage(50.0%)	8	NA	NA
WP_000088589.1|5324950_5325538_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
WP_001262439.1|5325534_5326575_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000879025.1|5326680_5328096_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_000055562.1|5328080_5330300_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.6e-163
WP_000666787.1|5330283_5330967_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278823.1|5330963_5331218_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170544.1|5331210_5331930_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000625682.1|5332018_5333326_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
>prophage 1
NZ_CP016589	Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence	514994	7156	50027	514994	tail,protease,integrase,transposase	Bacillus_phage(55.56%)	37	7108:7122	20200:20214
7108:7122	attL	TAAAAAAGTATACAT	NA	NA	NA	NA
WP_000358766.1|7156_7729_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	42.9	5.4e-33
WP_065705087.1|7915_8395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705090.1|10078_10729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705092.1|10772_11123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705094.1|11354_11780_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001084323.1|11776_12217_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_065705096.1|12894_13377_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_065705099.1|13416_14562_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_065704714.1|15161_16373_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	41.4	1.4e-70
WP_000169374.1|17001_18309_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	8.6e-26
WP_001100112.1|18482_18662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705100.1|20126_20720_-	cupin domain-containing protein	NA	NA	NA	NA	NA
20200:20214	attR	ATGTATACTTTTTTA	NA	NA	NA	NA
WP_065705104.1|21879_22998_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.6	2.9e-171
WP_065705107.1|23320_23632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705108.1|23784_24195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705110.1|24523_25024_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065705114.1|26065_26341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098781304.1|26388_26529_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_065705116.1|26674_26941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705118.1|27001_27490_-	hypothetical protein	NA	A6XML4	Bacillus_virus	53.8	1.5e-15
WP_065705121.1|27775_28321_-	hypothetical protein	NA	A0A0H4TI24	Erysipelothrix_phage	29.7	1.5e-11
WP_065705123.1|28634_30521_-|tail	tail fiber domain-containing protein	tail	D2XR28	Bacillus_phage	41.3	3.1e-109
WP_155759244.1|30545_32177_-	hypothetical protein	NA	A0A0M4RER0	Bacillus_phage	48.1	1.1e-59
WP_065705127.1|32570_32771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705129.1|33054_33738_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_065705131.1|33949_34558_+	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_065705135.1|35421_35805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000757467.1|35969_36545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705137.1|36561_38766_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A7KUS1	Bacillus_phage	37.5	1.5e-14
WP_065705139.1|38762_42764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000765108.1|42794_44891_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_000892003.1|44893_45808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233532.1|45808_46159_-	PrgI family protein	NA	NA	NA	NA	NA
WP_000935868.1|46225_46561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705141.1|46961_47462_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065705143.1|48000_48519_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065705145.1|49127_50027_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP016589	Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence	514994	133858	175776	514994	protease,transposase	Bacillus_phage(65.22%)	39	NA	NA
WP_065705221.1|133858_134338_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_065705223.1|135568_137311_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_001167047.1|137476_137692_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	68.7	3.7e-19
WP_000733521.1|137764_138181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705225.1|139022_140117_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.3	1.8e-93
WP_065705227.1|140963_142082_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.4	6.4e-171
WP_065705229.1|142322_143585_+	hypothetical protein	NA	M4HQ50	Bacillus_phage	46.2	2.0e-24
WP_065705231.1|143647_144988_+	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	39.8	5.3e-15
WP_065705233.1|145255_146626_+	M23 family metallopeptidase	NA	D7RWE0	Brochothrix_phage	42.6	3.3e-20
WP_065705235.1|147262_148012_+	AAA family ATPase	NA	A0A2H4J4U1	uncultured_Caudovirales_phage	38.3	7.8e-32
WP_065705236.1|148437_149361_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_065705238.1|149435_149798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705240.1|149866_150196_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_065705242.1|150343_152026_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_155759246.1|152441_152594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085963828.1|153442_154605_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.6	1.7e-33
WP_065705244.1|154790_155279_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000854592.1|155530_155758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705245.1|155840_157235_+	glycosyltransferase	NA	A0A0N9R395	Chrysochromulina_ericina_virus	25.6	6.6e-08
WP_065705247.1|157337_157688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705249.1|157769_159989_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.8	2.7e-48
WP_065705251.1|159981_161289_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_065705253.1|162109_162538_-	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	55.1	1.6e-34
WP_065705255.1|162560_162989_-	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	51.4	1.2e-29
WP_065705257.1|163125_163362_+	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	60.0	2.8e-12
WP_065705258.1|163588_164485_+	DnaD domain protein	NA	A0A1C8E9B4	Bacillus_phage	56.2	7.8e-79
WP_065705261.1|164588_164975_+	hypothetical protein	NA	A0A288WG73	Bacillus_phage	71.4	1.5e-47
WP_065705263.1|165212_166181_+	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	42.9	4.1e-33
WP_065705265.1|166322_167144_+	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	43.8	1.2e-28
WP_065705266.1|167416_168301_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	52.4	5.5e-77
WP_000377824.1|169015_169252_+	hypothetical protein	NA	A0A288WG97	Bacillus_phage	88.6	3.9e-14
WP_000570185.1|169251_169491_+	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	75.9	2.7e-26
WP_065705268.1|169487_170543_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6C8	Bacillus_phage	70.7	2.9e-149
WP_065705270.1|170860_171436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705272.1|171957_172302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000895161.1|172370_172559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705274.1|172644_172845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705276.1|174253_175366_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQB7	Streptococcus_phage	45.2	2.3e-80
WP_065705278.1|175377_175776_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	69.7	8.0e-52
>prophage 3
NZ_CP016589	Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence	514994	297317	333896	514994	integrase,transposase	Bacillus_phage(50.0%)	33	290431:290468	306012:306049
290431:290468	attL	TTTTATCATTTTAGCCAAGAAGACTCCTTCCTCAAGGA	NA	NA	NA	NA
WP_065705423.1|297317_298430_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQB7	Streptococcus_phage	45.2	2.3e-80
WP_000762752.1|298441_298840_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.9	3.1e-51
WP_065705425.1|299136_299568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000624348.1|299624_300437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705427.1|300423_301254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705429.1|301253_302075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705432.1|302092_302758_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.8	1.4e-32
WP_065705434.1|302754_303306_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_065705437.1|303361_303937_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	41.8	1.6e-29
WP_001057802.1|303926_304268_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_155759250.1|304264_305533_-	DNA repair protein	NA	O64031	Bacillus_phage	47.9	9.0e-105
WP_065705440.1|306218_307337_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.4	2.9e-171
306012:306049	attR	TTTTATCATTTTAGCCAAGAAGACTCCTTCCTCAAGGA	NA	NA	NA	NA
WP_000582597.1|309004_309637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000817896.1|309633_310269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828218.1|310565_310949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705443.1|310965_311604_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	36.6	4.3e-23
WP_000665869.1|311901_312651_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000274543.1|314027_314990_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000022653.1|315720_316152_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000210396.1|316232_316523_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065705444.1|317119_323803_+	DNRLRE domain-containing protein	NA	NA	NA	NA	NA
WP_065705673.1|323826_324180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705446.1|324738_324951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705447.1|324996_325389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705449.1|325530_326649_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.4	1.4e-170
WP_065705451.1|327303_327597_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065705453.1|327919_328303_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_065705455.1|328925_329357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705457.1|329397_330387_+	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	27.2	4.7e-16
WP_065705461.1|330915_331224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705463.1|331462_331777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705674.1|331982_332579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705440.1|332777_333896_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.4	2.9e-171
>prophage 4
NZ_CP016589	Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-01, complete sequence	514994	408606	446600	514994	protease,transposase,integrase,coat	Bacillus_phage(50.0%)	26	445304:445320	455041:455057
WP_065705682.1|408606_409557_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_065705558.1|409925_410372_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_081306193.1|410784_412128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705562.1|413127_414711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705563.1|415034_415511_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_065705565.1|416215_416725_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_065705567.1|416892_417654_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_065705684.1|418401_419271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705569.1|419395_420379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705571.1|423167_423989_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	45.2	8.0e-54
WP_065705573.1|424185_425475_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	35.6	3.1e-76
WP_065705575.1|425471_426425_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L0I7	Tupanvirus	33.6	7.9e-37
WP_065705576.1|426428_427622_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_065705579.1|428082_428784_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_065705581.1|428864_429290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705582.1|429291_430350_-|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_065705584.1|430374_431511_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_065705586.1|431663_432767_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_155759252.1|433224_433422_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_065705685.1|433770_434574_+|protease	CAAX protease	protease	NA	NA	NA	NA
WP_065705588.1|434963_435410_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065705590.1|435605_438488_-	PKD domain-containing protein	NA	NA	NA	NA	NA
WP_065705592.1|438778_440098_-	septum formation initiator	NA	NA	NA	NA	NA
WP_065705593.1|440388_441276_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_065705595.1|443029_444784_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.5	2.7e-14
445304:445320	attL	TAACAGGTGAAATTATA	NA	NA	NA	NA
WP_065705597.1|445427_446600_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_065705597.1|445427_446600_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
455041:455057	attR	TAACAGGTGAAATTATA	NA	NA	NA	NA
>prophage 1
NZ_CP016590	Bacillus thuringiensis strain KNU-07 plasmid pBTKNU07-02, complete sequence	293592	21209	83110	293592	transposase,protease,integrase	Bacillus_phage(50.0%)	47	75170:75185	87110:87125
WP_065705708.1|21209_21545_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081306199.1|21795_22131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705710.1|22611_22791_+	DUF4083 domain-containing protein	NA	NA	NA	NA	NA
WP_065705712.1|22846_23233_+	DUF5412 domain-containing protein	NA	NA	NA	NA	NA
WP_065705714.1|23426_24137_-	hypothetical protein	NA	D2XR34	Bacillus_phage	91.4	7.9e-34
WP_002166598.1|24675_25029_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065706015.1|25072_25678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705716.1|26067_26598_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_065705718.1|26601_27549_+	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_065705720.1|28133_28805_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_085963828.1|29046_30209_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.6	1.7e-33
WP_065705722.1|32598_32823_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
WP_065705724.1|33147_33741_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_155759253.1|34905_36247_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.1	4.1e-31
WP_065705730.1|36912_37320_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_065705732.1|37508_37757_-	hypothetical protein	NA	A0A288WFY7	Bacillus_phage	93.9	5.0e-36
WP_065705734.1|39134_39839_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_065705736.1|39838_40825_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_065706018.1|40967_41738_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	8.0e-32
WP_065705738.1|41712_43683_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_065705740.1|43715_44459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705742.1|45513_46047_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	25.7	1.5e-05
WP_065705744.1|46036_46867_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_065705745.1|46884_48639_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_065705747.1|49286_49616_+	Invasion protein IagB domain protein	NA	NA	NA	NA	NA
WP_065705749.1|49977_51084_+	acyltransferase	NA	NA	NA	NA	NA
WP_065705751.1|51247_51892_+	hypothetical protein	NA	A0A223LKM8	Bacillus_phage	34.0	1.5e-15
WP_065705753.1|52315_53500_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_065703200.1|56190_57420_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.8	1.7e-84
WP_065705755.1|57784_57982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705759.1|59139_59760_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_065705761.1|59779_60544_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_065705763.1|60913_62266_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_154698409.1|62912_63086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705767.1|66265_66916_-	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_065705769.1|67115_67508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705771.1|67958_68186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705773.1|68442_69447_-	VanZ family protein	NA	NA	NA	NA	NA
WP_155759254.1|71427_71679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065705775.1|71830_72958_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_065705777.1|72954_74058_-	endospore germination permease	NA	NA	NA	NA	NA
WP_065705779.1|74044_75553_-	spore germination protein	NA	NA	NA	NA	NA
75170:75185	attL	ATTTATTAGAAGTGAC	NA	NA	NA	NA
WP_065705781.1|76604_77930_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_065705783.1|78197_79655_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_065706020.1|79824_80754_+	glutaminase A	NA	NA	NA	NA	NA
WP_065705785.1|81473_81722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065705787.1|81949_83110_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
87110:87125	attR	GTCACTTCTAATAAAT	NA	NA	NA	NA
