The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016273	Yersinia pestis strain Cadman chromosome, complete genome	4602429	305803	362405	4602429	holin,transposase	Escherichia_phage(33.33%)	53	NA	NA
WP_000255944.1|305803_306826_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002397472.1|306913_307165_+	sugar transporter	NA	NA	NA	NA	NA
WP_002210456.1|307405_308008_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002210455.1|308022_309453_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210454.1|309454_310546_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210453.1|310548_312111_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002213775.1|312257_312716_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002210452.1|313144_313360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002216434.1|314037_314994_+	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002216437.1|315530_317336_+	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002228103.1|317795_319523_+	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
WP_002210448.1|319525_320020_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002213759.1|320218_320677_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002210447.1|321181_322192_+	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002210446.1|322322_322763_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_087768171.1|323220_323310_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210443.1|323864_324323_+	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_002210442.1|324325_325288_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002210441.1|325284_325602_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002210440.1|325667_327431_+	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210439.1|327417_328905_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002210438.1|328901_330278_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002210437.1|330271_331354_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002210436.1|331356_332673_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002210435.1|332672_333875_+	cell division protein FtsW	NA	NA	NA	NA	NA
WP_002210434.1|333871_334942_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002216457.1|335079_336555_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002210432.1|336547_337468_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002228100.1|337469_338297_+	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210431.1|338323_339580_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002210430.1|339652_340804_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002228285.1|340903_341824_+	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210428.1|341990_342515_-	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002210427.1|342543_343077_+	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210426.1|343154_345869_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002210424.1|346163_346550_+	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_001297096.1|346811_347591_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|347590_348613_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002210421.1|348891_349287_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002210420.1|349590_349875_-	YqjK-like family protein	NA	NA	NA	NA	NA
WP_002210419.1|349871_350267_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_002210418.1|350269_350575_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_002210416.1|350729_351110_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_002210415.1|351335_351725_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_002210414.1|351721_352420_-	DedA family protein	NA	NA	NA	NA	NA
WP_002218957.1|352697_353231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210412.1|353479_354274_-	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_002353699.1|354536_355838_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210410.1|356585_357995_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210409.1|358193_359645_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_002210408.1|359655_361146_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_002210407.1|361298_361829_+	YgjV family protein	NA	NA	NA	NA	NA
WP_002213775.1|361946_362405_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
>prophage 2
NZ_CP016273	Yersinia pestis strain Cadman chromosome, complete genome	4602429	576560	594069	4602429	transposase	Tupanvirus(50.0%)	7	NA	NA
WP_002211388.1|576560_582380_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	31.3	1.3e-41
WP_002214915.1|582392_584081_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	3.1e-36
WP_002211387.1|584088_590547_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.0	8.5e-42
WP_001297096.1|590754_591534_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|591533_592556_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_099156340.1|592637_592934_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_002211384.1|593274_594069_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.9	8.9e-119
>prophage 3
NZ_CP016273	Yersinia pestis strain Cadman chromosome, complete genome	4602429	748110	823930	4602429	protease,tRNA,plate,transposase	Escherichia_phage(20.0%)	56	NA	NA
WP_000255944.1|748110_749133_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002213759.1|749316_749775_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002209965.1|750082_752077_-	transketolase	NA	NA	NA	NA	NA
WP_002209967.1|752567_753320_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_071525520.1|753465_753576_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209968.1|753609_753930_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_002209969.1|754089_756069_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209971.1|757275_758430_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002228059.1|758622_759135_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209973.1|759232_759940_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002209975.1|760191_760923_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002209976.1|760948_761908_+	glutathione synthase	NA	NA	NA	NA	NA
WP_002209977.1|762023_762587_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209978.1|762586_763009_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209979.1|763188_764073_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209980.1|764076_765192_+	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_002209981.1|765300_766425_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_002215609.1|766444_767143_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002209983.1|767275_768097_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002209984.1|768384_768939_+	YggT family protein	NA	NA	NA	NA	NA
WP_002215612.1|768935_769226_+	YggU family protein	NA	NA	NA	NA	NA
WP_002215614.1|769325_769919_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002209987.1|769911_771042_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_002224905.1|771231_780564_-	phage minor structural protein	NA	NA	NA	NA	NA
WP_011566213.1|781061_781307_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_002228656.1|781264_781795_-	DUF2884 family protein	NA	NA	NA	NA	NA
WP_002209989.1|781906_782833_-	glutaminase B	NA	NA	NA	NA	NA
WP_002209990.1|782943_783270_-	YggL family protein	NA	NA	NA	NA	NA
WP_002209991.1|783269_783989_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002228057.1|784326_785442_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002209994.1|785619_785892_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002209995.1|786074_787151_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002209997.1|787450_788551_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209998.1|788654_790688_+	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_002209999.1|790770_791754_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210000.1|791786_793286_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
WP_002210001.1|793331_794291_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002210002.1|794846_797009_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_002210005.1|798337_798973_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_086016632.1|799575_800273_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
WP_002210008.1|800368_801136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210009.1|801122_803420_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002210010.1|803435_804071_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002216110.1|805295_805490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016590715.1|805653_806001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210011.1|806144_808367_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_002210012.1|808381_810730_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	3.1e-18
WP_002210013.1|810726_813375_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_002210014.1|813792_814284_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002228049.1|814287_816024_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210015.1|816023_816710_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002211664.1|816706_818059_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002215896.1|818070_819615_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211662.1|819657_820158_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002215900.1|822433_822829_-	lipoprotein	NA	NA	NA	NA	NA
WP_002215902.1|823279_823930_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP016273	Yersinia pestis strain Cadman chromosome, complete genome	4602429	966093	1021235	4602429	protease,integrase,transposase	Escherichia_phage(31.25%)	55	966025:966084	1011805:1013761
966025:966084	attL	TATTGTCAACGACGGATGAAAAGTGATCCACTTATATCTCCACCAACGGCCCAATATTGA	NA	NA	NA	NA
WP_001297096.1|966093_966873_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|966872_967895_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002215951.1|968499_968817_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_002210705.1|968822_969137_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002210707.1|969485_970574_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002215950.1|970570_971530_-	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	1.6e-50
WP_002215949.1|971522_972065_-	ash family protein	NA	NA	NA	NA	NA
WP_002210709.1|972064_972265_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002210710.1|972257_973145_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_002215946.1|973952_974180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215945.1|974341_976012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210712.1|976062_977151_-	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_002210713.1|977229_978429_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.2	2.2e-108
WP_002213775.1|978652_979111_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002210714.1|979745_980228_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	3.4e-28
WP_011055694.1|980286_980823_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002210716.1|980815_981100_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002210717.1|981249_981591_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002210718.1|981704_983366_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002210719.1|983452_984334_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002210720.1|984457_985036_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002210721.1|985143_986424_-	citrate synthase	NA	NA	NA	NA	NA
WP_002210722.1|987133_987523_+	succinate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_002210723.1|987516_987864_+	succinate dehydrogenase membrane anchor subunit	NA	NA	NA	NA	NA
WP_002210724.1|987864_989631_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_002210725.1|989680_990397_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_002210727.1|993588_994812_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_002210728.1|994924_996091_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_002210729.1|996090_996963_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	34.7	3.6e-20
WP_002210730.1|997729_999298_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_002210731.1|999312_1000452_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_002210732.1|1000464_1000599_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_011191945.1|1000588_1000876_+	cyd operon protein YbgE	NA	NA	NA	NA	NA
WP_002210734.1|1001007_1001409_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_002210735.1|1001408_1002095_+	Tol-Pal system protein TolQ	NA	NA	NA	NA	NA
WP_002210736.1|1002107_1002536_+	colicin uptake protein TolR	NA	NA	NA	NA	NA
WP_002210737.1|1002647_1003814_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_002210738.1|1003933_1005226_+	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_002210739.1|1005276_1005783_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_002210740.1|1005792_1006602_+	cell division protein CpoB	NA	NA	NA	NA	NA
WP_002210741.1|1007437_1008499_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_002210742.1|1008620_1009346_+	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	28.6	8.7e-20
WP_002210743.1|1009460_1010399_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	42.0	1.2e-10
WP_002210744.1|1010847_1011864_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	46.8	2.8e-72
WP_001297096.1|1011873_1012653_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1012652_1013675_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002210745.1|1013733_1013859_+	hypothetical protein	NA	NA	NA	NA	NA
1011805:1013761	attR	TATTGTCAACGACGGATGAAAAGTGATCCACTTATATCTCCACCAACGGCCCAATATTGATCCACCGTTTTACTCAGGATTAGCTTCTGCTATAACCCCGGCCTTTCGTTTCTGTCTGAGTCGATAGCTTTCTCCTTTGATTTGAACGACATGTGAGTGGTGTAAGATACGGTCCAGCATCGCTGAGGTCAGTGCTGCATCACCGGCGAACGTTTGATCCCACTGCCCGAACGGCAGATTGGATGTCAGGATCATTGCGCTCTTTTCGTAACGTTTAGCGATGACCTGGAAGAACAGCTTTGCTTCTTCCTGACTGAACGGCAGATAGCCTATTTCATCAATGATGAGCAGGCGGGGGGCCATTACTCCACGCTGAAGCGTCGTTTTATAACGGCCCTGACGTTGTGCCGTAGATAACTGAAGTAACAGATCTGCTGCTGTTGTGAAGCGAACTTTGATACCTGCACGGACTGCTTCATAGCCCATCGCTATTGCCAGATGGGTTTTCCCCACACCTGATGGCCCCAGTAATACGATATTTTCATTACGTTCTATGAAGCTGAGTGAGCGTAACGACTGGAGTTGCTTCTGCGGTGCTCCGGTGGCGAATGTGAAGTCATACTCTTCGAACGTTTTCACCGCCGGGAAGGCTGCCATTCGGGTATACATCGCCTGTTTACGTTGATGACGTGCCAGTTTTTCTTCATGAAGCAGATGCTCCAGGAAGTCCATATAACTCCATTCCTGGTCTACTGCCTGTTGTGACAGCGCAGGCGCTGCGCTTATAAGGCTTTCCAGTTGCAACTGCCCGGCGAGCGCCATCAGTCGTTGATGTTGCAGTTCCATCATCACGCCACTCCTCTGCAGAATGAGTCGTAGATGGAGAGTGGATGATGCAGGGGGTGTTTGTCGAAGTTCACCAGATTTTCATCAAGATGCACGTCATACTCTTTTTTCTCCGGAGGCAGTGCCAGCATGGACTGCTGCTCTTCGAGCCAGCGATCGCAGGGACGGGCCTGGATTGTTTCATGCTTTCGTTGGTTAGCGACATCGTGCAGCCAGCGCAGACCGTGGCGGTTGGCTGTTTCAACATCGACAGTGATCCCCATCGGGCGCAGGCGAGTCATTAGTGGGATGTAAAAACTGTTACGGGTGTACTGCACCATCCGTTCCACCTTACCTTTAGTCTGTGCCCTGAAGGGGCGACACAGTCGGGGAGAGAAGCCCATCTCCTTGCCGAACTGCCACAGCGAAGGATGGAACCGGTGCTGACCGGTCTGATATGCGTCACGTTGCAGAACCACAGTTTTCATATTGTCATACAACACTTCGCGCGGCACACCACCAAAGAAGCGGAACGCATTACGATGGCAGGTCTCCAGCGTGTCATAACGCATATTGTCAGTGAATTCGATGTACAGCATTCGGCTGTATCCGAGAACAGCAACGAACACGTGAAGCGGTGAGCGACCATTACGCATAGTGCCCCAGTCAACCTGCATCTGTCGTCCGGGTTCAGTTTCGAACCGAACGGCAGGCTCCTGCTCCTGAGGAACCGAGAGAGAACGAATGAATGCCCTGAGAATGGTCATTCCGCCACGATATCCCTGGTCTCTGATCTCGCGAGCGATTACCGTTGCCGGGATTTTGTAAGGATGAGCATCGGCGATGCGTTGACGAATATAATCCCGGTATTCATCCAGGAGTGAAGCAACAGCAGGTCGCGGCGTATATTTTGGCGGCTCAGATTTTGCCTGCAAATAACGTTTAACGGTATTGCGGGAGATCCCCAGTTCTCTGGCAATCGCCCGGCTACTCATTCCCTGCTTGTGCAGGATTTTAATTTCCATAACTGTCTCAAAAGTGACCATAAACTCTCCTGAATCAGGAGAGCAGATTACCCCCTGGATCTGATTTCAGGCGTTGGGTGTGGATCACTATTGCACCGTTCGTTACA	NA	NA	NA	NA
WP_002210746.1|1014040_1014793_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_002210747.1|1015139_1015475_-	phosphate starvation-inducible protein PsiF	NA	NA	NA	NA	NA
WP_002216812.1|1015767_1016664_-	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_002216814.1|1016684_1016837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210748.1|1016830_1017982_-	galactokinase	NA	NA	NA	NA	NA
WP_002210749.1|1017978_1019031_-	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002210750.1|1019040_1020057_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	44.8	3.0e-79
WP_002210751.1|1020416_1021235_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP016273	Yersinia pestis strain Cadman chromosome, complete genome	4602429	1043941	1155152	4602429	protease,holin,plate,transposase,tail,coat,tRNA	Clostridium_phage(13.16%)	95	NA	NA
WP_002213775.1|1043941_1044400_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002220180.1|1044628_1046332_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.5	9.4e-57
WP_002218281.1|1046354_1047827_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002218278.1|1047884_1048481_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002228035.1|1048845_1050894_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002214199.1|1051125_1052019_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002214197.1|1052056_1052905_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002214195.1|1053250_1054114_+	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002213775.1|1055042_1055501_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002210776.1|1055915_1056845_+	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_002228612.1|1057144_1058083_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_002210778.1|1058156_1058336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210780.1|1058674_1059610_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_002210781.1|1059730_1061443_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002210782.1|1061652_1062192_+	class IV adenylate cyclase	NA	NA	NA	NA	NA
WP_002214185.1|1062217_1062559_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_002210785.1|1062871_1063975_+	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_002210786.1|1064159_1064408_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002210787.1|1064615_1065452_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	6.1e-17
WP_002210788.1|1065488_1066418_+	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210789.1|1066520_1067381_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002210790.1|1067383_1068265_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_002210791.1|1068510_1068984_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	50.7	1.7e-37
WP_002210792.1|1069418_1070687_+	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210793.1|1070810_1072412_+	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_002210794.1|1072411_1073488_+	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_002210795.1|1073484_1074321_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A285PWH2	Cedratvirus	28.2	4.2e-10
WP_002223523.1|1074414_1075113_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	6.4e-12
WP_002210797.1|1075227_1076085_+	2OG-Fe(II) oxygenase	NA	NA	NA	NA	NA
WP_002210798.1|1076108_1077524_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002210799.1|1077678_1078533_-	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_002214183.1|1079268_1079736_+	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_079993142.1|1079739_1080201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210801.1|1080461_1081616_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210802.1|1081612_1082551_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	6.4e-23
WP_002353933.1|1082685_1083384_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210804.1|1083867_1085202_+	arginine/agmatine antiporter	NA	NA	NA	NA	NA
WP_002210805.1|1085271_1087578_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_002210806.1|1087695_1087899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210807.1|1088023_1088914_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002210809.1|1089325_1090441_-	porin OmpF2	NA	Q1MVN1	Enterobacteria_phage	54.5	2.1e-110
WP_002210810.1|1090710_1092891_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	1.1e-44
WP_002210811.1|1092958_1094398_-	catalase	NA	A0A2K9L0T1	Tupanvirus	38.8	4.9e-99
WP_002210812.1|1094758_1095301_+	YfaZ family protein	NA	NA	NA	NA	NA
WP_002221775.1|1095557_1096766_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_002210814.1|1097384_1098578_+	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_002210815.1|1098635_1099145_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_002210816.1|1099179_1099437_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
WP_002210817.1|1099440_1100571_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210818.1|1100733_1103022_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_002210820.1|1103515_1104244_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002210821.1|1104505_1107181_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	4.0e-102
WP_002228028.1|1107368_1110242_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
WP_002210824.1|1110309_1110963_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_002216094.1|1110965_1111538_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_002216093.1|1111705_1113658_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_002210825.1|1113681_1114836_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210826.1|1115938_1117054_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_002213775.1|1117255_1117714_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002213759.1|1117966_1118425_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002228026.1|1119214_1120381_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_002208870.1|1120655_1122182_-	MFS transporter	NA	NA	NA	NA	NA
WP_002208869.1|1122558_1123587_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002208868.1|1123660_1125448_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208867.1|1125869_1126805_-	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002208866.1|1126976_1127219_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208864.1|1127424_1128147_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002215470.1|1128420_1128900_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208862.1|1129110_1130415_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002208861.1|1131123_1131936_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208860.1|1131911_1132706_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208859.1|1133319_1133610_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208858.1|1133655_1134273_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208857.1|1134277_1134472_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208856.1|1134468_1135977_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208855.1|1135998_1136367_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_002208854.1|1136368_1136668_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208853.1|1136788_1138282_+|coat	coat protein	coat	NA	NA	NA	NA
WP_002208852.1|1138548_1139955_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208850.1|1139951_1141007_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002208848.1|1141614_1142070_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208847.1|1142073_1143210_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002215458.1|1143206_1143467_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208846.1|1143463_1143811_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002208845.1|1143907_1144687_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208843.1|1144984_1145725_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208842.1|1146015_1147452_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208841.1|1147577_1147940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208840.1|1148639_1149128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208839.1|1149140_1150289_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_002230704.1|1150645_1151029_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208837.1|1151259_1153056_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002208836.1|1153083_1153311_-	YejL family protein	NA	NA	NA	NA	NA
WP_002208835.1|1153488_1154493_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002213775.1|1154693_1155152_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
>prophage 6
NZ_CP016273	Yersinia pestis strain Cadman chromosome, complete genome	4602429	1266665	1276302	4602429	protease,tRNA,transposase	Planktothrix_phage(16.67%)	8	NA	NA
WP_002211351.1|1266665_1268615_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	37.7	8.8e-35
WP_002211350.1|1268895_1269159_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	3.6e-16
WP_002211349.1|1269519_1269840_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_002211348.1|1269865_1272142_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.7	7.4e-166
WP_002213759.1|1272434_1272893_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002211347.1|1273264_1273483_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002211346.1|1273648_1274359_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211344.1|1274577_1276302_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	3.3e-17
>prophage 7
NZ_CP016273	Yersinia pestis strain Cadman chromosome, complete genome	4602429	1320216	1394355	4602429	protease,transposase,plate,tRNA	Clostridium_phage(23.08%)	60	NA	NA
WP_002211311.1|1320216_1321002_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_002211310.1|1320998_1322321_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_002211309.1|1322301_1323030_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_002211308.1|1323026_1327484_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_002213759.1|1327699_1328158_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002217987.1|1328441_1330298_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002211305.1|1330521_1331070_+	YcbK family protein	NA	A0A0K1LLY2	Rhodobacter_phage	34.7	7.8e-05
WP_002211304.1|1331130_1331778_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.3	2.2e-22
WP_002430096.1|1331931_1332048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211303.1|1332201_1333392_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_002354007.1|1333648_1334728_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	56.5	3.2e-111
WP_002211301.1|1335028_1336429_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.2	6.5e-80
WP_002228013.1|1336927_1338133_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002220013.1|1338848_1341464_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_002211296.1|1342081_1343092_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_002211295.1|1343274_1343826_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_002211294.1|1343851_1344964_-	MOSC N-terminal beta barrel domain-containing protein	NA	NA	NA	NA	NA
WP_002211293.1|1345063_1347184_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_002211292.1|1347189_1349103_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.5e-47
WP_002211291.1|1349231_1350518_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_002211290.1|1350504_1352157_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_002211289.1|1352153_1352732_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_002228015.1|1353001_1353169_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_002213775.1|1353366_1353825_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_001297096.1|1354985_1355765_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1355764_1356787_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211286.1|1357420_1357609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220006.1|1357874_1358393_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002224683.1|1358461_1360213_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002226586.1|1360423_1360879_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002213775.1|1361047_1361506_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002213066.1|1361695_1362757_-	porin OmpA	NA	NA	NA	NA	NA
WP_002213065.1|1363114_1363621_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213064.1|1363849_1364485_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213063.1|1364586_1366725_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213062.1|1366754_1367201_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002213061.1|1367394_1369380_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	28.4	5.3e-19
WP_002213060.1|1369440_1369905_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002213058.1|1370083_1370764_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213056.1|1371079_1371496_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213054.1|1371604_1371922_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213052.1|1371982_1373173_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213049.1|1373266_1373545_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002213046.1|1373596_1373926_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_002213039.1|1377571_1379989_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213038.1|1380142_1380889_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213036.1|1381619_1381838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213034.1|1382101_1382626_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213032.1|1382615_1383899_+	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|1383900_1384638_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213028.1|1384653_1385892_+	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213026.1|1385884_1386604_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213025.1|1386605_1387358_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213024.1|1387360_1388149_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002228570.1|1388235_1388676_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213017.1|1388713_1388962_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002213016.1|1389060_1389909_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002213014.1|1390897_1391398_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002214707.1|1391440_1392991_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002213011.1|1393002_1394355_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
NZ_CP016273	Yersinia pestis strain Cadman chromosome, complete genome	4602429	1419219	1468657	4602429	tRNA,transposase,lysis,plate	Escherichia_phage(18.18%)	40	NA	NA
WP_002211940.1|1419219_1420983_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211941.1|1420946_1422032_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002214552.1|1422006_1422588_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211943.1|1422587_1423040_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002211944.1|1423064_1424432_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002211945.1|1424643_1425267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|1425949_1427545_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211947.1|1427772_1428426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|1428469_1429678_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211948.1|1429813_1430584_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_002211949.1|1430585_1431860_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_002211950.1|1432394_1433705_-	darobactin maturation radical SAM/SPASM protein DarE	NA	NA	NA	NA	NA
WP_002211951.1|1433714_1434383_-	darobactin export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.4e-35
WP_002211952.1|1434384_1435647_-	darobactin export ABC transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002215886.1|1435648_1438009_-	darobactin export ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002227980.1|1438092_1438305_-	peptide antibiotic darobactin C	NA	NA	NA	NA	NA
WP_002211956.1|1438561_1439404_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002211957.1|1439424_1440564_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.9	5.2e-35
WP_002211958.1|1440836_1441706_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211959.1|1441841_1442993_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_002211960.1|1443176_1443839_+	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
WP_002211961.1|1443893_1445060_+	DUF418 family protein	NA	NA	NA	NA	NA
WP_002215885.1|1445807_1446815_+	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_002211965.1|1448584_1449595_+	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_002211966.1|1450039_1450777_-	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_002211968.1|1451057_1452755_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002211969.1|1453109_1453994_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_002211970.1|1454319_1455015_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_002211971.1|1455011_1455419_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002211973.1|1455660_1456842_-	MFS transporter	NA	NA	NA	NA	NA
WP_002211974.1|1457174_1458428_-	LVIVD repeat-containing protein	NA	NA	NA	NA	NA
WP_002211975.1|1458445_1459522_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002228565.1|1460219_1460882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|1461146_1461926_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1461925_1462948_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002213775.1|1463058_1463517_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002211870.1|1463680_1465708_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	8.0e-55
WP_002211871.1|1465972_1467085_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_002211872.1|1467329_1467971_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.9	1.0e-35
WP_002211873.1|1468075_1468657_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	2.5e-33
>prophage 9
NZ_CP016273	Yersinia pestis strain Cadman chromosome, complete genome	4602429	1512230	1568127	4602429	transposase	uncultured_virus(27.27%)	48	NA	NA
WP_002209743.1|1512230_1513439_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002216388.1|1513401_1516554_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_002211911.1|1517578_1518883_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211912.1|1518891_1519314_-	thiol-disulfide oxidoreductase DCC family protein	NA	NA	NA	NA	NA
WP_002216393.1|1519741_1520482_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002211916.1|1520529_1521372_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002211917.1|1521403_1522681_+	L-fuconate dehydratase	NA	NA	NA	NA	NA
WP_002211919.1|1522977_1524123_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_002211920.1|1524327_1525695_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	7.0e-63
WP_002224723.1|1525988_1527419_+	EmmdR/YeeO family multidrug/toxin efflux MATE transporter	NA	NA	NA	NA	NA
WP_002211922.1|1527446_1528787_-	MFS transporter	NA	NA	NA	NA	NA
WP_002211923.1|1528822_1529704_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_002217591.1|1530280_1530976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211926.1|1531065_1531605_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002213125.1|1532471_1533101_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002213124.1|1533358_1534651_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_002213122.1|1534670_1535177_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_002213121.1|1535300_1536293_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002213120.1|1536815_1537556_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_002216586.1|1537761_1537926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213113.1|1537942_1540069_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_042468818.1|1540146_1541424_-	MFS transporter	NA	NA	NA	NA	NA
WP_002209743.1|1541448_1542657_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002217041.1|1542619_1542916_-	biofilm formation regulator BssS	NA	NA	NA	NA	NA
WP_002213110.1|1543421_1543667_-	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	51.3	2.6e-13
WP_002213109.1|1543979_1545026_-	dihydroorotase	NA	NA	NA	NA	NA
WP_002213107.1|1545260_1545548_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_002209743.1|1545824_1547033_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002354074.1|1547128_1550785_-	ribonuclease E	NA	NA	NA	NA	NA
WP_002210927.1|1551368_1552331_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_002213759.1|1552550_1553009_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002210928.1|1553163_1553760_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002210930.1|1553901_1554426_+	23S rRNA accumulation protein YceD	NA	NA	NA	NA	NA
WP_002210931.1|1554438_1554606_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002210932.1|1554639_1555674_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002210933.1|1555680_1556631_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_002210934.1|1556668_1557598_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002210935.1|1557611_1558346_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	7.7e-16
WP_002220787.1|1558499_1558736_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.6	7.7e-10
WP_002213079.1|1558830_1560072_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_002213775.1|1560271_1560730_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002213080.1|1561145_1561952_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_002217396.1|1562240_1563266_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002213082.1|1563255_1563894_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.1	4.6e-25
WP_002213083.1|1563893_1564916_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_002213084.1|1564930_1565740_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_002213085.1|1566045_1567479_+	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002213759.1|1567668_1568127_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
>prophage 10
NZ_CP016273	Yersinia pestis strain Cadman chromosome, complete genome	4602429	1664095	1682083	4602429	protease,coat,transposase	Escherichia_phage(50.0%)	15	NA	NA
WP_000255944.1|1664095_1665118_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002215943.1|1665524_1665914_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_002210859.1|1666023_1666263_-	YebV family protein	NA	NA	NA	NA	NA
WP_002210858.1|1666470_1667460_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_002210857.1|1667665_1670113_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002210856.1|1670300_1671053_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002216611.1|1671083_1671641_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|1671661_1672192_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210852.1|1672197_1672752_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216616.1|1673230_1675882_-	PqiB family protein	NA	NA	NA	NA	NA
WP_002367629.1|1675850_1677098_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002210850.1|1677329_1677827_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002210849.1|1677922_1678636_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210848.1|1678655_1680728_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210847.1|1681201_1682083_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 11
NZ_CP016273	Yersinia pestis strain Cadman chromosome, complete genome	4602429	1984055	2083712	4602429	tRNA,holin,lysis,integrase,tail,transposase	Escherichia_phage(14.81%)	104	1994607:1994637	2036331:2036361
WP_002211184.1|1984055_1984754_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002211183.1|1984890_1985496_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_087768167.1|1985496_1985604_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002211182.1|1986138_1987827_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	1.8e-31
WP_002211181.1|1987986_1989108_+	ribonuclease D	NA	NA	NA	NA	NA
WP_002211180.1|1989344_1989614_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211179.1|1989617_1990430_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002220631.1|1990454_1991141_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211743.1|1991861_1992134_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_002215627.1|1992274_1993360_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211740.1|1993430_1994087_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002211739.1|1994189_1994636_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
1994607:1994637	attL	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
WP_002211738.1|1994662_1995901_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_000255944.1|1995970_1996993_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|1996992_1997772_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215632.1|1997939_1998200_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_002211736.1|1999224_1999671_+	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_002211735.1|1999744_2000350_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002215636.1|2000350_2000740_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002215638.1|2000743_2000962_+	ash family protein	NA	NA	NA	NA	NA
WP_002211732.1|2001010_2001574_+	Bro-N domain-containing protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002393183.1|2001658_2001835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211731.1|2001997_2002207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215644.1|2002203_2002479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002430108.1|2002724_2002922_+|holin	phage holin family protein	holin	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002211730.1|2002952_2003465_+	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002211729.1|2003449_2003908_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211727.1|2004453_2005167_+	phage antirepressor KilAC domain-containing protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211725.1|2005623_2006259_+	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211724.1|2006289_2006739_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002211723.1|2006742_2007327_+	hypothetical protein	NA	A0A0R6PHH0	Moraxella_phage	70.7	4.8e-69
WP_002209743.1|2007374_2008583_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211722.1|2008587_2009562_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	81.1	2.3e-153
WP_002228445.1|2009561_2010290_+	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002228446.1|2010308_2010950_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002211721.1|2010950_2012063_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002211720.1|2012184_2012958_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211719.1|2012971_2014177_+	Ig-like domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211718.1|2014224_2014707_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211717.1|2014703_2014958_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211716.1|2014959_2015310_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211715.1|2015311_2015896_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211714.1|2015892_2016300_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211713.1|2016365_2017286_+	Ig-like domain-containing protein	NA	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211712.1|2017298_2017610_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_071525538.1|2017657_2017918_+	DUF1799 domain-containing protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_002211711.1|2017918_2021422_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_002211710.1|2021424_2021766_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002213759.1|2022070_2022529_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002211709.1|2022649_2023402_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002211708.1|2023404_2024115_+	C40 family peptidase	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211707.1|2024375_2025008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211706.1|2025086_2025518_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211705.1|2025641_2025809_+	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211704.1|2025882_2026890_+	Bro-N domain-containing protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002214482.1|2026988_2027540_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211701.1|2027682_2027898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|2027953_2028574_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002211699.1|2028615_2028780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002359202.1|2028748_2028970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|2029145_2032349_+	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002211697.1|2032348_2033347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211696.1|2033363_2034281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211695.1|2034291_2034711_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	42.0	5.7e-08
WP_002209743.1|2034931_2036140_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002214492.1|2036444_2037617_-	MFS transporter	NA	NA	NA	NA	NA
2036331:2036361	attR	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
WP_002211693.1|2037620_2038820_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002211692.1|2038836_2039577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214494.1|2040668_2041025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002227934.1|2041441_2041972_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002211689.1|2042207_2043782_-	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002211688.1|2044025_2044745_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211687.1|2044962_2046498_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211686.1|2046962_2048267_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002216508.1|2048282_2049485_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211685.1|2049749_2050619_-	pirin family protein	NA	NA	NA	NA	NA
WP_002211684.1|2050816_2051722_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211683.1|2051756_2052875_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002216501.1|2052982_2054257_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_002211681.1|2054406_2056341_-	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002430110.1|2056784_2057534_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211679.1|2057606_2058482_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002224141.1|2058795_2059791_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211677.1|2060138_2060552_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002217933.1|2060622_2060895_+	YeaC family protein	NA	NA	NA	NA	NA
WP_002211676.1|2061028_2061676_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002211675.1|2061690_2062707_-	asparaginase	NA	NA	NA	NA	NA
WP_002211674.1|2062823_2064674_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211673.1|2064836_2065388_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002211671.1|2065612_2066659_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002211670.1|2066720_2068646_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211669.1|2068642_2068933_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211668.1|2068945_2069332_-	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211667.1|2069429_2070236_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211665.1|2071045_2071906_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002209743.1|2072777_2073986_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210667.1|2073948_2074818_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	5.5e-13
WP_002210666.1|2074901_2075366_-	YchJ family protein	NA	NA	NA	NA	NA
WP_002210665.1|2076699_2077716_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002210664.1|2078022_2079369_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002210661.1|2079803_2080202_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002210659.1|2080951_2081542_+	thymidine kinase	NA	A0A1Z1LYD5	Serratia_phage	55.8	1.5e-54
WP_001297096.1|2081910_2082690_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2082689_2083712_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 12
NZ_CP016273	Yersinia pestis strain Cadman chromosome, complete genome	4602429	2740744	2795994	4602429	tRNA,integrase,transposase	Clostridium_phage(18.18%)	55	2740637:2740696	2795428:2796139
2740637:2740696	attL	AATAAATATCCTCCGGCATAGCCGGAGGTTTTTCATATGCGCCTATAAGGCTCTGTTACC	NA	NA	NA	NA
WP_002213775.1|2740744_2741203_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002209726.1|2741481_2742492_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002209727.1|2742491_2743373_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002209728.1|2743529_2744192_+	DedA family protein	NA	NA	NA	NA	NA
WP_002209729.1|2744422_2745337_+	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_002209730.1|2745585_2746890_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002209731.1|2747009_2747732_+	cell division protein DedD	NA	NA	NA	NA	NA
WP_002209732.1|2748043_2748553_+	colicin V production protein	NA	NA	NA	NA	NA
WP_002209733.1|2748565_2750083_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.4	5.0e-86
WP_002209734.1|2750329_2750902_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_002216029.1|2751426_2752209_+	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_002209736.1|2752311_2752998_+	histidine ABC transporter permease HisQ	NA	NA	NA	NA	NA
WP_002209737.1|2752994_2753711_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002209738.1|2753724_2754522_+	histidine ABC transporter ATP-binding protein HisP	NA	G9BWD6	Planktothrix_phage	33.5	7.1e-23
WP_002209739.1|2754645_2755554_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_002209740.1|2755907_2756600_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002227850.1|2756800_2757376_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_002209742.1|2757597_2758146_+	NUDIX hydrolase YfcD	NA	NA	NA	NA	NA
WP_002222248.1|2758262_2759519_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_002209743.1|2759658_2760867_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_071525544.1|2760930_2762433_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_002209745.1|2762645_2762891_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	64.2	7.2e-19
WP_002209746.1|2764412_2764814_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_002209748.1|2765046_2765448_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_002209749.1|2765459_2766032_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002227852.1|2766055_2766307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209751.1|2766345_2766585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209752.1|2767393_2769310_+	autotransporter adhesin YapC	NA	NA	NA	NA	NA
WP_002224869.1|2769433_2769556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209753.1|2769844_2770426_+	AbiEi antitoxin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|2770827_2772036_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209756.1|2772487_2774695_+	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_002209757.1|2774687_2775218_+	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_002209758.1|2775376_2777758_+	glycoside hydrolase family 3 C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002209759.1|2777836_2779465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209762.1|2779937_2780789_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	1.2e-49
WP_002209763.1|2780814_2781804_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002209764.1|2781858_2782752_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000255944.1|2782845_2783868_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002215253.1|2785012_2785318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209765.1|2785414_2785816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209766.1|2785797_2787117_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_002215255.1|2787109_2788873_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002209768.1|2788869_2789502_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_002209769.1|2789511_2790441_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002209770.1|2790433_2791036_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_002354559.1|2791435_2791642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079866998.1|2791853_2792132_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y6Q1	Salmonella_phage	73.5	4.2e-31
WP_002215266.1|2792214_2792553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228356.1|2792688_2793186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215268.1|2793299_2793500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215270.1|2793758_2793941_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_002209774.1|2794295_2795162_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
WP_002209775.1|2795176_2795389_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_002213775.1|2795535_2795994_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
2795428:2796139	attR	AATAAATATCCTCCGGCATAGCCGGAGGTTTTTCATATGCGCCTATAAGGCTCTGTTACCAGCCGCGCCCTAACAGGCGCATCGCGATCTGACATTTGCATCTATGGATTACTTACGGCCCGTAAACGGGCTACCGGGATACGGGATCGAGAGTTGCTCACCCATTTTATCCTCTTCCAATTGGTGCTTTATGTATTCTTGTATCCTGGCCGTGTTTTTCCCTACCGTATCAACGTAATACCCTCGACACCAAAACTCCCTGTTACGGTATTTGAACTTCAAATCGCCAAACTGCTCATAAAGCATCAGACTGCTCTTTCCCTTCAGGTACCCCATAAATCCCGAGACACTCATCTTGGGCGGGATCTCCAGAAGCATATGGATGTGATCCACACAGCATTCTGCTTCCAGGATATTCACGTTTTTCCATTCGCACAGTTTTCTTAAAATACTGCCAATCGCTCTGCGTTTTTCCCTGTAGAACACCTGCCTTCGGTACTTCGGCGCAAAAACTATATGATATTTACAGTTCCATCGGGTGTGCGCTAAGCTCTTTTCATCCCTCATTGGGACCCCCTTTTGATTTCTTGTTGAACATTTGCAGTTGCCAGACCGCAAACTGTTTTAACAAATCAAAAGGGGTTTTTATAACTGACCCAAAGCTGAAAGCTTTACTGAACCCCCAGCCTAGCTGGGGGTTTTCTGGGCACAA	NA	NA	NA	NA
>prophage 13
NZ_CP016273	Yersinia pestis strain Cadman chromosome, complete genome	4602429	2860338	2928102	4602429	transposase,plate,tRNA	Clostridium_phage(14.29%)	58	NA	NA
WP_002209820.1|2860338_2861535_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_002209821.1|2861796_2862225_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_002215515.1|2862551_2864972_-	peptidase inhibitor family I36 protein	NA	NA	NA	NA	NA
WP_146737630.1|2865661_2870050_+	autotransporter YapA	NA	NA	NA	NA	NA
WP_002215508.1|2870607_2873766_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_002215505.1|2873731_2874052_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_071525548.1|2874130_2874256_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209828.1|2874389_2875343_-	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_002209829.1|2875421_2876720_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	39.0	9.7e-38
WP_002209830.1|2876859_2877060_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_002209831.1|2877089_2877425_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_002209832.1|2877427_2879380_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	37.8	1.8e-96
WP_002209833.1|2879622_2880147_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_002209834.1|2880257_2880581_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	7.8e-21
WP_002209835.1|2880850_2881237_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	5.4e-53
WP_002209836.1|2881267_2882497_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	33.1	8.6e-36
WP_002222202.1|2882550_2883045_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_002217034.1|2883200_2883974_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_002213305.1|2884092_2884896_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_002213775.1|2885099_2885558_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002217028.1|2885704_2886727_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_002213310.1|2886717_2887392_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_002213314.1|2887533_2888895_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_002213316.1|2888891_2890049_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_002227864.1|2890400_2890949_-	attachment invasion locus protein Ail	NA	A0A1B0VBR9	Salmonella_phage	36.7	6.8e-25
WP_002223388.1|2891058_2891241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211552.1|2891392_2892646_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.5	2.8e-98
WP_002211553.1|2893186_2894377_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002211554.1|2895909_2896248_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_002211555.1|2896262_2897885_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.5	1.1e-94
WP_002211556.1|2898044_2899382_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.4	1.2e-11
WP_072120864.1|2899344_2900367_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_002216114.1|2900415_2901852_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.8	3.1e-13
WP_002213759.1|2902072_2902531_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002216113.1|2902520_2902745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211559.1|2903757_2904318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211560.1|2904769_2905219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032487261.1|2905526_2905634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211561.1|2905630_2909521_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.5	8.8e-127
WP_002211562.1|2909836_2911297_+	membrane-bound lytic murein transglycosylase MltF	NA	I1VXB7	Halocynthia_phage	41.4	7.1e-13
WP_002211563.1|2911405_2912008_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	34.1	6.5e-05
WP_002211564.1|2912078_2912774_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_002211565.1|2913000_2913888_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_002211566.1|2914095_2914935_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211567.1|2915096_2915357_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	9.3e-17
WP_002213775.1|2915512_2915971_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002211568.1|2916172_2916553_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002211569.1|2916552_2917284_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_001297096.1|2917473_2918253_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2918252_2919275_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211571.1|2919953_2921303_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002211572.1|2921306_2921846_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211573.1|2922119_2922605_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211574.1|2922930_2924433_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211575.1|2924456_2924981_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002211576.1|2925085_2925694_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211577.1|2925678_2926869_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|2926893_2928102_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 14
NZ_CP016273	Yersinia pestis strain Cadman chromosome, complete genome	4602429	3267692	3321556	4602429	tRNA,transposase	Escherichia_phage(33.33%)	46	NA	NA
WP_000255944.1|3267692_3268715_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3268714_3269494_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002418742.1|3269544_3270444_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_002208732.1|3270499_3271246_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.1	3.4e-35
WP_002208733.1|3271226_3271880_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002208734.1|3271876_3272545_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002208735.1|3272557_3273346_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002208736.1|3273673_3274507_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208738.1|3274816_3275020_+	oxalurate catabolism protein HpxX	NA	NA	NA	NA	NA
WP_002208739.1|3275016_3276414_+	AtzE family amidohydrolase	NA	NA	NA	NA	NA
WP_002264506.1|3276523_3276910_+	oxalurate catabolism protein HpxZ	NA	NA	NA	NA	NA
WP_002208741.1|3277143_3278343_+	MFS transporter	NA	NA	NA	NA	NA
WP_002208742.1|3278502_3279276_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_002208743.1|3279272_3279614_+	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_002208744.1|3279785_3280298_+	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_002208745.1|3280681_3281854_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_002208746.1|3281892_3283428_+	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_002208747.1|3283550_3284717_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002216643.1|3284968_3285406_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	36.6	2.6e-11
WP_002208749.1|3285575_3286325_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_002208750.1|3286367_3289010_+	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002208751.1|3289185_3290541_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002208752.1|3290602_3290944_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002217405.1|3297046_3299620_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.9	2.4e-128
WP_002209471.1|3299749_3300481_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002209470.1|3300482_3301460_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_002209469.1|3301595_3302327_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002209468.1|3302681_3303044_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_002213775.1|3303374_3303833_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_000255944.1|3305135_3306158_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3306157_3306937_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002209466.1|3307013_3307232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209465.1|3307336_3308458_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002228238.1|3308470_3309541_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	1.5e-89
WP_002209463.1|3309773_3310490_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002209462.1|3312585_3313353_+	YdiY family protein	NA	NA	NA	NA	NA
WP_002213759.1|3313655_3314114_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002209461.1|3314325_3314673_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002222284.1|3314753_3315494_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002209459.1|3315532_3316081_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002209458.1|3316102_3316351_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002209456.1|3316578_3317940_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002209455.1|3318105_3318897_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002354744.1|3318968_3320249_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002213759.1|3320386_3320845_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002213775.1|3321097_3321556_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
>prophage 15
NZ_CP016273	Yersinia pestis strain Cadman chromosome, complete genome	4602429	3590303	3642930	4602429	protease,transposase	Escherichia_phage(17.65%)	53	NA	NA
WP_002213775.1|3590303_3590762_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002210156.1|3590957_3591410_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_002210155.1|3591449_3591677_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_002210154.1|3591681_3592002_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_002210153.1|3592007_3592400_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_002210152.1|3592766_3593468_-	esterase	NA	NA	NA	NA	NA
WP_000255944.1|3593524_3594547_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3594546_3595326_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210151.1|3596406_3597300_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210150.1|3597561_3598266_+	pirin family protein	NA	NA	NA	NA	NA
WP_002210149.1|3599202_3600102_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.4	1.0e-49
WP_002228200.1|3600164_3602138_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_002210147.1|3602221_3602575_+	YraN family protein	NA	NA	NA	NA	NA
WP_002210146.1|3602845_3603436_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	32.0	3.2e-12
WP_002210145.1|3603446_3604022_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_002210144.1|3604228_3604954_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_002210143.1|3604950_3605604_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_002210142.1|3605845_3608182_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.4	9.9e-41
WP_002210140.1|3608445_3609369_-	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_002229651.1|3610191_3614658_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_002210138.1|3614667_3616086_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002210137.1|3616526_3617012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216203.1|3617164_3617680_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
WP_002210135.1|3617685_3618327_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002230558.1|3618506_3618704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210133.1|3618700_3619093_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002210132.1|3619107_3619536_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210131.1|3619849_3620977_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210130.1|3621200_3621605_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002218066.1|3621875_3623249_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002213775.1|3623365_3623824_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002210128.1|3624049_3625138_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002210127.1|3625318_3626581_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210126.1|3626734_3626989_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210125.1|3627135_3627438_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210124.1|3627473_3628097_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210123.1|3628109_3628667_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210122.1|3628671_3629454_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210121.1|3629671_3630490_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210120.1|3630754_3631729_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210119.1|3631839_3632826_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002228203.1|3633074_3633638_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002218352.1|3633634_3634198_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002210117.1|3634181_3634727_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002210116.1|3634733_3635459_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210115.1|3635520_3636954_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002213952.1|3637382_3637865_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210113.1|3638170_3639025_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002210112.1|3639021_3639294_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210111.1|3639631_3640567_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210110.1|3640578_3641043_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210109.1|3641180_3641567_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000255944.1|3641907_3642930_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 16
NZ_CP016273	Yersinia pestis strain Cadman chromosome, complete genome	4602429	3772421	3856905	4602429	transposase,plate	Escherichia_phage(28.57%)	56	NA	NA
WP_002212105.1|3772421_3773768_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002212104.1|3773770_3774316_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002212103.1|3774315_3775632_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_002213885.1|3775757_3776846_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001297096.1|3777876_3778656_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|3778655_3779678_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002212100.1|3782032_3782473_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002212099.1|3782479_3783961_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002212098.1|3784028_3784526_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002212097.1|3785049_3785568_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002212095.1|3785719_3785998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212093.1|3786468_3787380_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_002212092.1|3787620_3788892_-	maltoporin	NA	NA	NA	NA	NA
WP_002212091.1|3788962_3790072_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	G9BWD6	Planktothrix_phage	35.5	5.0e-27
WP_002221973.1|3790075_3790312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212089.1|3790873_3792085_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_002212088.1|3792271_3793849_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_002212087.1|3793862_3794753_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_002212086.1|3794895_3795303_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_002212085.1|3795437_3797084_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002212084.1|3797453_3798839_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_002228189.1|3799406_3801092_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_002212081.1|3801161_3806069_+	hemagglutinin repeat-containing protein	NA	NA	NA	NA	NA
WP_002212080.1|3806164_3809860_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	82.5	4.6e-24
WP_002212079.1|3811038_3812766_-	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_002212078.1|3813021_3814329_-	isocitrate lyase	NA	NA	NA	NA	NA
WP_002212077.1|3814375_3815974_-	malate synthase A	NA	NA	NA	NA	NA
WP_002212076.1|3816394_3817324_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_002210692.1|3824167_3825757_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	2.2e-68
WP_002210691.1|3825816_3827103_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002355296.1|3827250_3827904_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002210689.1|3827953_3828229_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	3.6e-19
WP_002210688.1|3828417_3829008_-	YjaG family protein	NA	NA	NA	NA	NA
WP_002210687.1|3829053_3829794_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_002210686.1|3829823_3830891_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_002210685.1|3831009_3831795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210684.1|3831887_3832670_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_002210683.1|3832766_3833276_+	sigma D regulator	NA	NA	NA	NA	NA
WP_002210682.1|3833651_3835697_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_002210681.1|3835683_3836358_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_002210680.1|3836347_3837145_+	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	27.8	1.6e-11
WP_002217275.1|3837141_3837357_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_002217273.1|3837358_3838174_+	thiazole synthase	NA	NA	NA	NA	NA
WP_002210678.1|3838166_3839297_+	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_002213775.1|3839728_3840187_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	7.2e-12
WP_002210677.1|3840313_3844534_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.5e-67
WP_002210676.1|3844662_3848691_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	1.2e-22
WP_002230058.1|3849033_3849426_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002210674.1|3849492_3849990_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002210673.1|3850354_3851059_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002210672.1|3851062_3851491_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002210671.1|3851681_3852227_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
WP_002210670.1|3852228_3852612_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002210669.1|3852862_3854047_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	2.0e-13
WP_001297096.1|3855103_3855883_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|3855882_3856905_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 17
NZ_CP016273	Yersinia pestis strain Cadman chromosome, complete genome	4602429	3967109	4006836	4602429	plate,transposase	Escherichia_phage(25.0%)	23	NA	NA
WP_002213759.1|3967109_3967568_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_000255944.1|3970335_3971358_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3971357_3972137_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210461.1|3973800_3975462_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002214274.1|3976401_3977394_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002214276.1|3977369_3978977_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002210464.1|3978963_3979674_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002210465.1|3979742_3980510_-	DedA family protein	NA	NA	NA	NA	NA
WP_002210466.1|3980705_3983075_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002220588.1|3983535_3986442_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002210468.1|3986697_3987051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099156322.1|3987072_3990486_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_002210469.1|3990573_3992184_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002210470.1|3992180_3993536_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210471.1|3993655_3994147_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|3994139_3994505_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|3994510_3995128_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|3995120_3996224_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002210474.1|3998481_4000830_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002210475.1|4000933_4003522_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210476.1|4003539_4004523_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210477.1|4004515_4006360_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002210478.1|4006392_4006836_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 18
NZ_CP016273	Yersinia pestis strain Cadman chromosome, complete genome	4602429	4413069	4457678	4602429	protease,transposase	Escherichia_phage(28.57%)	35	NA	NA
WP_002216348.1|4413069_4413906_+|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_002208930.1|4413940_4414699_+	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100067904.1|4414891_4416245_+|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002208933.1|4416423_4417308_-	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_002208934.1|4417540_4419976_-	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_002208935.1|4421514_4421832_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_002208936.1|4422180_4422636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216737.1|4423178_4423394_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002208938.1|4423636_4425835_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_002216730.1|4426187_4427216_+	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_002208941.1|4427281_4428127_+	cell division protein FtsN	NA	NA	NA	NA	NA
WP_002208942.1|4428226_4428751_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_002208943.1|4428821_4430153_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.8	1.2e-43
WP_002208944.1|4430388_4431306_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002208945.1|4431447_4431933_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_002228141.1|4432049_4432634_-	DUF4232 domain-containing protein	NA	NA	NA	NA	NA
WP_002215873.1|4433263_4433503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208949.1|4433715_4435008_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000255944.1|4435919_4436942_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|4436941_4437721_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002213759.1|4439452_4439911_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	A0A0A8WIU6	Clostridium_phage	34.1	9.4e-12
WP_002208953.1|4440118_4440358_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_002208954.1|4440985_4441834_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.5	3.2e-13
WP_002208957.1|4445081_4445516_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_002208958.1|4445684_4446299_+	DUF1454 family protein	NA	NA	NA	NA	NA
WP_002208959.1|4446427_4447195_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_002208960.1|4447426_4448662_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208961.1|4448798_4449536_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_002208962.1|4449532_4450246_+	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_002208963.1|4450311_4451739_+	anion permease	NA	NA	NA	NA	NA
WP_002218867.1|4451856_4452633_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208965.1|4452882_4453872_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208966.1|4454092_4455076_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002208967.1|4455293_4456196_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_002353252.1|4456757_4457678_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	8.6e-73
>prophage 1
NZ_CP016274	Yersinia pestis strain Cadman plasmid pCD1, complete sequence	70304	30336	58213	70304	protease,transposase	Enterobacteria_phage(25.0%)	26	NA	NA
WP_002213294.1|30336_30744_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	29.2	4.7e-07
WP_002213244.1|30767_31085_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|31256_31715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042469136.1|31783_32053_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213256.1|34664_36980_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.6	1.0e-279
WP_002213258.1|37143_37695_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002224338.1|37713_38178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229829.1|38316_38646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016640.1|38745_39844_+|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002213267.1|39992_40418_-	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_000255944.1|42206_43229_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|43228_44008_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002213403.1|45132_45525_-	type III secretion system chaperone SycE/YerA	NA	NA	NA	NA	NA
WP_002229754.1|45718_46378_+	type III secretion system effector GTPase activator YopE	NA	NA	NA	NA	NA
WP_002213360.1|46517_46817_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002224342.1|46809_47052_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_002213357.1|47595_47769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154020274.1|47917_48154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213354.1|48313_49279_-	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	56.6	3.1e-89
WP_002220902.1|49275_50442_-	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.3	3.5e-196
WP_002229770.1|52453_53083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213007.1|53680_54229_-	type III secretion system effector YopK	NA	NA	NA	NA	NA
WP_002213006.1|54728_55697_+|protease	T3SS effector cysteine protease YopT	protease	NA	NA	NA	NA
WP_002213004.1|55696_56095_+	type III secretion system chaperone SycT	NA	NA	NA	NA	NA
WP_002222515.1|56799_57219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_116442925.1|57967_58213_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP016275	Yersinia pestis strain Cadman plasmid pMT1, complete sequence	96210	19306	82009	96210	transposase,terminase,tail	Salmonella_phage(85.71%)	67	NA	NA
WP_002211746.1|19306_19813_+	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211745.1|20525_20756_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211744.1|20828_22838_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_000255944.1|22961_23984_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|23983_24763_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002425587.1|25332_25758_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_002213141.1|25787_26351_-	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002215095.1|26423_26675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213135.1|26895_27327_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002213132.1|27446_28475_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002225551.1|28535_29480_+	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_000920226.1|29479_29746_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002213439.1|30915_31116_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_002222866.1|31119_31950_+	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002222868.1|32103_32475_+	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222869.1|32458_32869_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002228797.1|32936_33212_+	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002228796.1|33252_33432_+	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002227818.1|33428_33764_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002222711.1|33763_33976_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002214164.1|34544_35609_-	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002214160.1|36353_36998_+	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	1.8e-122
WP_002213298.1|37357_38380_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002213300.1|38795_39881_+	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
WP_002214148.1|40110_42027_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
WP_002213303.1|42016_42763_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_002214145.1|42775_43345_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_002213759.1|43553_44012_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002211802.1|44211_44493_+	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002211801.1|44698_45181_+	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002214137.1|45819_46047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211799.1|46131_46782_-	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214134.1|47103_47631_-	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211796.1|47635_48058_-	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214131.1|48117_48396_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211794.1|48398_49958_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002228791.1|50022_50721_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211792.1|50720_51389_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002211791.1|51385_52024_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211790.1|52016_52271_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211789.1|52276_53167_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_000176291.1|53176_53443_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211788.1|53638_54280_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_002211787.1|54282_55539_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211786.1|55572_57147_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	2.4e-301
WP_002211785.1|57169_58003_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	91.3	5.8e-137
WP_002211784.1|58029_58905_+	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002211783.1|58979_59642_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211782.1|59685_60120_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211781.1|60119_60953_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_001027662.1|61050_61395_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211780.1|61385_61859_+	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_002211779.1|61860_62244_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211778.1|62318_63065_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_000163862.1|63124_63442_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_000952684.1|63567_63792_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_002211776.1|63799_68377_+	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000440566.1|68418_68754_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211775.1|68843_69542_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	7.1e-136
WP_002211774.1|69534_70332_+	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211773.1|70319_70907_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002214118.1|70928_75560_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
WP_002211771.1|75616_76195_+	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_002211770.1|76275_79164_+|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211769.1|79465_80074_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_001297096.1|80207_80987_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|80986_82009_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
