The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016440	Bordetella pseudohinzii strain HI4681 chromosome, complete genome	4490371	1775473	1857379	4490371	tRNA,tail,integrase,capsid,plate,transposase,holin	Pseudomonas_phage(19.51%)	96	1818690:1818711	1863634:1863655
WP_043207777.1|1775473_1777891_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_043207778.1|1777905_1778244_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	43.3	1.6e-13
WP_043207779.1|1778301_1778700_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053073215.1|1778877_1779996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109842432.1|1780576_1780732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109842433.1|1780915_1781815_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	32.6	2.0e-21
WP_043207781.1|1781839_1783801_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	29.4	8.9e-27
WP_043207783.1|1783929_1784436_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_043207785.1|1784442_1784685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043207787.1|1784813_1785092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043207789.1|1785184_1785637_+	low affinity iron permease family protein	NA	NA	NA	NA	NA
WP_029579565.1|1785633_1786104_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_043207791.1|1786358_1786952_+	twin-arginine translocation pathway signal	NA	NA	NA	NA	NA
WP_043207793.1|1786999_1787284_+	CsbD family protein	NA	NA	NA	NA	NA
WP_029579562.1|1787341_1787524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043207794.1|1788175_1788388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029579560.1|1788536_1788749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043207796.1|1788875_1789952_+	N-acylglucosamine 2-epimerase	NA	NA	NA	NA	NA
WP_043207798.1|1790041_1790257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043207891.1|1790330_1790636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043207800.1|1790643_1791009_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_043207801.1|1791061_1792864_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	27.4	6.2e-43
WP_043207802.1|1792991_1793816_+	oxidoreductase	NA	A0A2H4PQR8	Staphylococcus_phage	47.8	7.0e-66
WP_043207804.1|1793819_1794806_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_043207805.1|1794822_1795017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043207806.1|1795013_1796189_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_043207893.1|1796362_1797019_+	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	49.5	1.0e-56
WP_043207807.1|1797013_1799545_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_043207895.1|1799704_1801618_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_043207808.1|1801753_1802200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043207809.1|1802215_1802644_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_043207810.1|1802809_1803892_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_043207813.1|1803903_1804365_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	8.8e-18
WP_043207815.1|1804502_1805729_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_043207818.1|1805751_1806195_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_043207821.1|1806291_1807533_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_043207824.1|1807542_1808376_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_043207825.1|1808372_1809338_-	NAD-binding protein	NA	NA	NA	NA	NA
WP_043207827.1|1809448_1810363_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043207830.1|1810369_1811038_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043207897.1|1811034_1812771_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_043207832.1|1812984_1813977_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_043207834.1|1814224_1814902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043207835.1|1814872_1815769_-	DMT family transporter	NA	NA	NA	NA	NA
WP_048026460.1|1815836_1817300_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_043207838.1|1817750_1818536_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_043207840.1|1818683_1820957_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	43.3	6.7e-127
1818690:1818711	attL	CCGCGCCGCCGGCCTGGCCGCG	NA	NA	NA	NA
WP_043207843.1|1821063_1821498_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_043207845.1|1821665_1822667_+|integrase	site-specific integrase	integrase	A0A2H4JE37	uncultured_Caudovirales_phage	31.7	5.2e-23
WP_043207900.1|1822669_1823461_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	76.5	1.0e-122
WP_043207847.1|1823636_1823990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048026442.1|1824231_1825041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043208305.1|1825037_1825616_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	36.0	4.8e-29
WP_043208306.1|1825612_1826680_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	46.8	2.4e-79
WP_043208308.1|1826679_1827030_-	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	64.3	6.2e-32
WP_043208310.1|1827095_1827737_-|plate	phage baseplate assembly protein	plate	F6MIL4	Haemophilus_phage	45.6	1.9e-39
WP_043208313.1|1827726_1828830_-|tail	tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	42.1	5.7e-71
WP_043208315.1|1828813_1830073_-	hypothetical protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	34.6	1.4e-54
WP_043208316.1|1830072_1832277_-	hypothetical protein	NA	A0A0M3LPB6	Mannheimia_phage	42.3	2.1e-85
WP_043208318.1|1832420_1832813_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_043208320.1|1832809_1833184_-	hypothetical protein	NA	A0A2H4J9F8	uncultured_Caudovirales_phage	40.7	1.9e-18
WP_043208323.1|1833199_1834627_-|tail	tail sheath protein	tail	A0A2H4JFT7	uncultured_Caudovirales_phage	40.0	1.6e-73
WP_010926885.1|1834632_1834815_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_043208326.1|1834814_1835510_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_043208478.1|1835506_1835935_-	DUF1320 domain-containing protein	NA	A0A2D1GNP0	Pseudomonas_phage	33.8	6.7e-12
WP_043208328.1|1836035_1836311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033841489.1|1836382_1837330_-	hypothetical protein	NA	G8GWE7	Rhodobacter_phage	48.2	2.2e-76
WP_048026448.1|1837385_1837745_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_054471552.1|1837790_1838798_-	cell envelope integrity protein TolA	NA	Q5ZQY0	Pseudomonas_phage	53.5	3.5e-35
WP_010926892.1|1839032_1839590_-	hypothetical protein	NA	A0A0M3LSP9	Mannheimia_phage	33.5	1.1e-09
WP_053073217.1|1839728_1841069_-|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	41.8	1.3e-66
WP_048026450.1|1841061_1842597_-	DUF935 family protein	NA	Q5ZQY4	Pseudomonas_phage	56.8	3.5e-151
WP_043208330.1|1842596_1844279_-	phage protein	NA	A0A219VH72	Ochrobactrum_phage	46.9	2.0e-120
WP_043208332.1|1844278_1844830_-	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	53.6	1.2e-29
WP_043208334.1|1844833_1845133_-	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	61.2	2.6e-23
WP_043208336.1|1845143_1845440_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_043208338.1|1845551_1845959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082149643.1|1845955_1846591_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	61.2	1.7e-67
WP_043208339.1|1846590_1846971_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	62.8	4.1e-29
WP_131726016.1|1847064_1847403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053073218.1|1847485_1848097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043208341.1|1848099_1848540_-	helix-turn-helix transcriptional regulator	NA	Q6QID2	Burkholderia_phage	44.1	4.8e-21
WP_033841483.1|1848641_1848866_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_043208343.1|1849026_1849500_+	hypothetical protein	NA	Q6QID6	Burkholderia_phage	53.5	3.9e-45
WP_043208345.1|1849496_1849802_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	52.5	4.3e-21
WP_043208347.1|1849820_1850714_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	54.7	6.6e-70
WP_054471551.1|1850716_1852492_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	53.0	2.7e-176
WP_043208352.1|1852502_1853687_+	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	51.2	1.1e-99
WP_053073219.1|1853677_1853998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043208355.1|1853991_1854207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043208358.1|1854206_1854809_+	hypothetical protein	NA	A0A0M5MXL4	Ralstonia_phage	54.3	8.2e-48
WP_043208360.1|1854805_1855426_+	DUF3164 family protein	NA	Q6QIE4	Burkholderia_phage	57.2	3.0e-61
WP_043208362.1|1855545_1855827_+	HU family DNA-binding protein	NA	G8GWC6	Rhodobacter_phage	39.1	2.4e-10
WP_053073220.1|1855922_1856288_+	hypothetical protein	NA	A0A218KCM7	Bacillus_phage	46.7	9.4e-07
WP_131726015.1|1856367_1856784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068945275.1|1856788_1857379_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	55.6	4.0e-31
1863634:1863655	attR	CCGCGCCGCCGGCCTGGCCGCG	NA	NA	NA	NA
>prophage 2
NZ_CP016440	Bordetella pseudohinzii strain HI4681 chromosome, complete genome	4490371	2752111	2760234	4490371	protease	Lake_Baikal_phage(28.57%)	8	NA	NA
WP_043208542.1|2752111_2754547_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.2e-222
WP_043208545.1|2754713_2756012_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.5	2.8e-130
WP_043208546.1|2756116_2756770_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.9	1.2e-55
WP_043208547.1|2756772_2758083_-	trigger factor	NA	NA	NA	NA	NA
WP_043208548.1|2758287_2758827_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.5	3.1e-22
WP_029580519.1|2758880_2759087_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.1	7.4e-17
WP_043208550.1|2759350_2759902_-	DUF924 family protein	NA	A0A1V0SIY0	Klosneuvirus	30.6	7.1e-14
WP_005014599.1|2760030_2760234_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
>prophage 3
NZ_CP016440	Bordetella pseudohinzii strain HI4681 chromosome, complete genome	4490371	3468444	3480569	4490371	integrase	Burkholderia_phage(41.67%)	16	3462833:3462846	3487283:3487296
3462833:3462846	attL	GCGCGCTGCTGGCG	NA	NA	NA	NA
WP_043214226.1|3468444_3468864_-	M15 family metallopeptidase	NA	A0A2I6PFM8	Proteus_phage	50.0	5.9e-29
WP_043214224.1|3468972_3469995_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JE37	uncultured_Caudovirales_phage	32.4	2.2e-24
WP_043214222.1|3469997_3470354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146027869.1|3470698_3470914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083218090.1|3470904_3471861_-	hypothetical protein	NA	A0A0A8J8U5	Ralstonia_phage	39.4	7.2e-30
WP_043207544.1|3471861_3472509_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	44.9	3.2e-42
WP_043207542.1|3472505_3473696_-	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	41.0	7.7e-66
WP_043207540.1|3473688_3474033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043207539.1|3474029_3474716_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	37.2	6.5e-33
WP_043207535.1|3474700_3475525_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.3	2.3e-40
WP_043207532.1|3475517_3475826_-	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	34.3	5.0e-09
WP_048026478.1|3475822_3476383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043207531.1|3476382_3477999_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	31.4	2.4e-22
WP_043207529.1|3478089_3478545_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	50.0	1.8e-23
WP_043207528.1|3478554_3479004_-	hypothetical protein	NA	I7ATP4	Escherichia_phage	45.9	5.2e-31
WP_043207526.1|3479060_3480569_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.6	1.2e-71
3487283:3487296	attR	CGCCAGCAGCGCGC	NA	NA	NA	NA
