The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016762	Citrobacter freundii strain B38 chromosome, complete genome	5134500	821344	829462	5134500	integrase,transposase,tRNA	Pseudomonas_phage(16.67%)	8	815645:815657	830389:830401
815645:815657	attL	GATTGGTAGCCTG	NA	NA	NA	NA
WP_096878465.1|821344_822442_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_003026911.1|822452_823970_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	1.3e-86
WP_003846403.1|824047_824602_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_016150941.1|824768_825527_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	37.3	3.2e-09
WP_003026898.1|826225_826699_+	DUF1643 domain-containing protein	NA	A0A142F2K6	Mycobacterium_phage	37.8	1.2e-22
WP_003026895.1|826827_827046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003026893.1|827039_827618_-|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	27.4	2.2e-10
WP_085949497.1|828315_829462_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
830389:830401	attR	GATTGGTAGCCTG	NA	NA	NA	NA
>prophage 2
NZ_CP016762	Citrobacter freundii strain B38 chromosome, complete genome	5134500	1111905	1193771	5134500	transposase,plate,tRNA,protease,tail,portal,holin,terminase	Salmonella_phage(18.37%)	83	NA	NA
WP_065944618.1|1111905_1113075_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.3	6.7e-147
WP_065945129.1|1113280_1113847_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	75.4	2.8e-82
WP_065944619.1|1114206_1114461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168927629.1|1114457_1114634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046669975.1|1114621_1115161_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	80.4	9.5e-80
WP_065944620.1|1115289_1116117_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	90.9	3.6e-139
WP_001515608.1|1116173_1116545_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	92.7	1.1e-58
WP_181246020.1|1116921_1117581_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	62.7	7.3e-74
WP_065944621.1|1117673_1117877_+	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	67.8	2.1e-16
WP_046669971.1|1117899_1118451_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	67.8	4.7e-66
WP_003034732.1|1118623_1118803_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	3.0e-14
WP_048217448.1|1118792_1119659_+	conserved phage C-terminal domain-containing protein	NA	U5P0A0	Shigella_phage	87.8	1.9e-34
WP_065944622.1|1119658_1120555_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	88.1	1.5e-154
WP_065944623.1|1120547_1122482_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.6	1.3e-200
WP_065944624.1|1122478_1122865_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	86.8	1.3e-59
WP_003034743.1|1122878_1123565_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	53.8	9.9e-58
WP_065944625.1|1123561_1124557_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	69.0	6.5e-143
WP_065944626.1|1124578_1125268_+	antitermination protein	NA	NA	NA	NA	NA
WP_162493521.1|1125342_1125558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100216202.1|1126063_1127231_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
WP_065944627.1|1127228_1128155_+	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	80.1	3.4e-146
WP_065944628.1|1128301_1128688_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	92.2	1.8e-56
WP_071891788.1|1128674_1128956_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	50.5	5.7e-20
WP_065944629.1|1128955_1129573_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	79.4	4.2e-92
WP_065944630.1|1129569_1130127_+	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	42.4	3.2e-06
WP_065944631.1|1130180_1130522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016150425.1|1130746_1131253_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	64.3	1.4e-48
WP_065944632.1|1131256_1133374_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	70.4	1.3e-305
WP_044711201.1|1133370_1133586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065944633.1|1133594_1135106_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	55.9	2.7e-156
WP_065944634.1|1135062_1137165_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	52.4	5.2e-198
WP_040230734.1|1137237_1137573_+	DUF2190 family protein	NA	A0A2K9V343	Faecalibacterium_phage	32.1	4.3e-06
WP_044711193.1|1137572_1137929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044711191.1|1137930_1138587_+	hypothetical protein	NA	D5LGZ7	Escherichia_phage	35.3	1.2e-15
WP_044711187.1|1138598_1139153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044711184.1|1139145_1139763_+|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	36.2	3.0e-13
WP_065944635.1|1139801_1141271_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	37.3	3.3e-74
WP_016150414.1|1141267_1141774_+|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_016150413.1|1141832_1142132_+|tail	phage tail assembly protein	tail	Q75QK8	Wolbachia_phage	31.6	7.2e-05
WP_044711178.1|1142234_1144160_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	35.4	9.3e-29
WP_080953303.1|1144156_1144627_+|tail	phage tail protein	tail	V5YTC2	Pseudomonas_phage	40.6	1.3e-19
WP_065944636.1|1144601_1144817_+|tail	tail protein X	tail	R9TR63	Vibrio_phage	50.0	1.1e-10
WP_065944637.1|1144818_1145937_+	late control protein D	NA	R9TNM7	Vibrio_phage	32.8	1.2e-33
WP_032943848.1|1145976_1146330_+	GPW/gp25 family protein	NA	R9TRM1	Vibrio_phage	54.1	6.5e-21
WP_032943847.1|1146313_1147234_+|plate	baseplate J/gp47 family protein	plate	A0A088FQL4	Escherichia_phage	48.8	5.0e-65
WP_065944638.1|1147223_1147787_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	40.9	8.2e-26
WP_065944639.1|1149717_1150248_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	36.5	3.7e-20
WP_065944640.1|1150219_1150759_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	50.0	2.0e-37
WP_065944642.1|1152183_1152735_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	87.8	1.8e-86
WP_038642073.1|1152863_1153106_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	4.4e-29
WP_065944643.1|1153184_1153574_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	1.5e-50
WP_164972480.1|1153740_1153902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065945131.1|1153888_1154425_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_065944644.1|1154428_1154779_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_065944645.1|1155195_1155957_+	hypothetical protein	NA	Q6J1W3	Lactobacillus_phage	33.3	4.2e-09
WP_086538730.1|1156558_1157722_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_061549647.1|1157729_1159916_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	29.8	3.2e-17
WP_061549646.1|1159912_1161322_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_100216202.1|1172514_1173682_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	89.5	8.4e-166
WP_141211320.1|1173604_1173910_-	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_003031211.1|1174492_1174975_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.2e-28
WP_071891790.1|1175117_1175573_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_057102097.1|1175556_1175853_+	RnfH family protein	NA	NA	NA	NA	NA
WP_003826401.1|1175903_1176248_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_065944646.1|1176397_1178059_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003031220.1|1178144_1179023_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_003031221.1|1179145_1179739_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_008785520.1|1179788_1181078_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003031224.1|1181096_1181888_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_003031226.1|1182053_1183415_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003031228.1|1183668_1183917_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003031230.1|1183935_1184484_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003031232.1|1184528_1185296_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|1185335_1185683_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_032937964.1|1185814_1186297_-	OmpA family protein	NA	NA	NA	NA	NA
WP_003839838.1|1186309_1187536_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.6	1.1e-06
WP_049002927.1|1187528_1188047_-	YfiR family protein	NA	NA	NA	NA	NA
WP_003031240.1|1188205_1188580_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_003031241.1|1188795_1189866_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	50.9	4.5e-89
WP_061549642.1|1189876_1190998_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_003839850.1|1191094_1192255_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_100250063.1|1192354_1192402_-	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_085949497.1|1192624_1193771_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
>prophage 3
NZ_CP016762	Citrobacter freundii strain B38 chromosome, complete genome	5134500	1691021	1699439	5134500	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_044711387.1|1691021_1691969_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	9.3e-22
WP_003844383.1|1691952_1692684_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|1692664_1692772_-	protein YohO	NA	NA	NA	NA	NA
WP_049002964.1|1692823_1693555_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.8e-105
WP_003027348.1|1693780_1695466_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
WP_003840155.1|1695462_1696182_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003027346.1|1696228_1696699_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
WP_061549341.1|1696741_1697200_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	68.6	3.0e-50
WP_003844377.1|1697405_1699439_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
>prophage 4
NZ_CP016762	Citrobacter freundii strain B38 chromosome, complete genome	5134500	1737588	1745766	5134500	tRNA,protease	Planktothrix_phage(16.67%)	7	NA	NA
WP_003840216.1|1737588_1739535_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	2.4e-40
WP_003036813.1|1739609_1739834_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003036810.1|1740157_1740478_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036804.1|1740508_1742785_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_044701894.1|1743054_1744416_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.9	5.3e-204
WP_003841759.1|1744575_1744908_-	YegP family protein	NA	NA	NA	NA	NA
WP_003036797.1|1745043_1745766_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
>prophage 5
NZ_CP016762	Citrobacter freundii strain B38 chromosome, complete genome	5134500	1789016	1797872	5134500		Enterobacteria_phage(57.14%)	8	NA	NA
WP_061549037.1|1789016_1790411_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	34.6	1.4e-21
WP_048218083.1|1790576_1791470_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	39.7	1.9e-45
WP_048218081.1|1791843_1792929_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	7.4e-100
WP_048218080.1|1792928_1793828_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.3	3.6e-31
WP_048218077.1|1793879_1794758_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	6.6e-107
WP_061549036.1|1794759_1795332_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.0	2.8e-50
WP_061549035.1|1795334_1796603_+	flippase	NA	NA	NA	NA	NA
WP_181621566.1|1796729_1797872_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.0	5.4e-32
>prophage 6
NZ_CP016762	Citrobacter freundii strain B38 chromosome, complete genome	5134500	1822755	1860504	5134500	transposase,plate,integrase,head,protease,tail,terminase,capsid	Pseudomonas_phage(25.64%)	56	1851563:1851579	1857655:1857671
WP_065944677.1|1822755_1823313_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	82.0	1.0e-81
WP_065944678.1|1823360_1823723_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	52.1	1.3e-11
WP_061549859.1|1823725_1824160_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	51.7	3.3e-35
WP_061549860.1|1824131_1824557_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	72.4	3.8e-23
WP_065944679.1|1825548_1826121_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	41.6	7.0e-33
WP_060570681.1|1826117_1827185_-|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	43.8	9.6e-68
WP_060570682.1|1827184_1827535_-	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	60.0	2.6e-30
WP_065944680.1|1827624_1828230_-|plate	phage baseplate assembly protein	plate	F6MIL4	Haemophilus_phage	55.6	4.5e-30
WP_065944681.1|1828213_1829431_-|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	37.6	7.9e-74
WP_065944682.1|1829414_1830746_-	DNA circularization N-terminal domain-containing protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	27.5	8.7e-34
WP_065944683.1|1830742_1832983_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	35.3	1.4e-68
WP_045261512.1|1833117_1833510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023311695.1|1833510_1833885_-	hypothetical protein	NA	F6MIK8	Haemophilus_phage	54.9	9.6e-31
WP_045261513.1|1833898_1835317_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B7SDP8	Haemophilus_phage	42.2	2.7e-86
WP_023311742.1|1835303_1835525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023311741.1|1835511_1836171_-	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	35.4	2.5e-21
WP_021567602.1|1836170_1836599_-	DUF1320 family protein	NA	A0A1B0T6F3	Thiobacimonas_phage	35.1	5.1e-12
WP_045261516.1|1836602_1837010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021567604.1|1837009_1837918_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A2H4J778	uncultured_Caudovirales_phage	63.9	3.8e-105
WP_045261517.1|1837931_1838324_-	hypothetical protein	NA	A0A2P9JZJ1	Alteromonadaceae_phage	48.0	4.1e-24
WP_065944684.1|1838335_1839451_-|protease	phage protease	protease	A0A0M5N0Q6	Ralstonia_phage	42.6	5.0e-59
WP_032668432.1|1839506_1839716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047063499.1|1839832_1840375_-	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	37.1	3.7e-23
WP_065944685.1|1840371_1841631_-|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	34.8	1.1e-51
WP_065944686.1|1841617_1843186_-	DUF935 domain-containing protein	NA	A0A0U5KSI0	unidentified_phage	45.0	4.6e-127
WP_065944687.1|1843188_1844838_-|terminase	phage terminase large subunit	terminase	H6V8N6	Pseudomonas_phage	66.5	1.8e-214
WP_063930090.1|1844862_1845069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000941096.1|1845061_1845562_-	DUF1804 family protein	NA	L7P7L4	Pseudomonas_phage	54.1	1.2e-47
WP_048977996.1|1845563_1845848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000171281.1|1845844_1846087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944688.1|1846095_1846728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023063181.1|1846693_1846957_-	DUF2644 domain-containing protein	NA	A0A2D1GNW8	Pseudomonas_phage	57.3	2.8e-13
WP_065944689.1|1846953_1847598_-	glycoside hydrolase family 19 protein	NA	A0A248XCW5	Klebsiella_phage	56.8	2.5e-63
WP_065944690.1|1847676_1848171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944691.1|1848182_1848617_-	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	47.0	1.2e-27
WP_065944692.1|1848561_1849038_-	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	63.0	7.4e-44
WP_060570700.1|1849099_1849315_-	hypothetical protein	NA	A0A2D1GNS9	Pseudomonas_phage	57.7	2.4e-18
WP_065944693.1|1849492_1849708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065945134.1|1849700_1850075_-	DUF4406 domain-containing protein	NA	A0A1V0E824	Vibrio_phage	52.2	1.5e-20
WP_158513304.1|1850074_1850245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944694.1|1850241_1850502_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	70.2	9.9e-27
WP_065944695.1|1850498_1850795_-	hypothetical protein	NA	A0A076G611	Escherichia_phage	64.0	3.7e-09
WP_065944696.1|1850791_1851511_-	DUF2786 domain-containing protein	NA	A0A0S4L2R2	Pseudomonas_phage	32.2	5.2e-17
1851563:1851579	attL	TTTAAAAGTGATTTAAA	NA	NA	NA	NA
WP_032663812.1|1851591_1851783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054829983.1|1851772_1852006_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049111782.1|1852007_1852652_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	64.6	9.3e-74
WP_048703759.1|1852641_1852848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023311925.1|1852860_1853151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023311926.1|1853161_1854055_-	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	59.8	3.6e-100
WP_023311927.1|1854066_1856121_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.9	3.8e-161
WP_023311928.1|1856122_1856335_-	helix-turn-helix domain-containing protein	NA	A0A0C4UQU0	Shigella_phage	72.5	5.1e-21
WP_048703754.1|1856555_1856954_+	hypothetical protein	NA	A0A076FSV9	Pseudomonas_phage	49.2	8.4e-09
WP_023311929.1|1856968_1857625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003838976.1|1857849_1858428_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.0	2.1e-21
1857655:1857671	attR	TTTAAAAGTGATTTAAA	NA	NA	NA	NA
WP_003838979.1|1858424_1859192_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_032936755.1|1859331_1860504_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	86.7	1.1e-197
>prophage 7
NZ_CP016762	Citrobacter freundii strain B38 chromosome, complete genome	5134500	1906471	1921848	5134500	transposase	Enterobacteria_phage(23.08%)	21	NA	NA
WP_081309857.1|1906471_1908943_-	exonuclease	NA	K7P6V4	Enterobacteria_phage	38.0	2.6e-108
WP_032944383.1|1909084_1909411_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_065944697.1|1909468_1909684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944698.1|1909901_1910282_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	66.7	6.5e-19
WP_003832309.1|1910387_1910600_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	59.7	3.8e-16
WP_065944699.1|1910603_1911158_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	32.4	7.1e-14
WP_158513305.1|1912107_1912779_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	77.1	7.2e-69
WP_065944701.1|1912794_1913211_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_065945137.1|1913216_1913543_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	46.7	4.9e-15
WP_065944702.1|1913834_1914398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158513306.1|1914407_1914584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065944704.1|1915285_1915519_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	74.0	2.8e-28
WP_065944705.1|1915563_1915803_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	63.8	1.7e-20
WP_065944706.1|1915912_1916380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145924163.1|1916376_1916712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944708.1|1917048_1917249_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	60.0	7.9e-16
WP_060683641.1|1917251_1917611_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	65.3	1.4e-42
WP_065944710.1|1917607_1918648_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.7	1.1e-95
WP_065944711.1|1918659_1919007_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.8	9.8e-54
WP_065944712.1|1919205_1920489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949497.1|1920700_1921848_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
>prophage 8
NZ_CP016762	Citrobacter freundii strain B38 chromosome, complete genome	5134500	1960145	2010989	5134500	integrase,head,protease,tail,portal,holin,terminase,capsid	Salmonella_phage(28.89%)	64	1997424:1997438	2012535:2012549
WP_065944713.1|1960145_1961156_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	86.3	1.0e-172
WP_065944714.1|1961155_1961383_-	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	88.0	4.6e-36
WP_065944716.1|1962595_1962889_-	hypothetical protein	NA	E7C9R6	Salmonella_phage	45.9	1.7e-11
WP_156484524.1|1962885_1963047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944717.1|1963593_1964634_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	88.4	1.2e-163
WP_071891820.1|1966048_1966312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032140310.1|1966606_1967326_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	34.7	1.8e-25
WP_024195799.1|1967395_1967653_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	41.1	3.5e-08
WP_016240141.1|1967684_1968248_+	hypothetical protein	NA	S5FXP0	Shigella_phage	27.1	6.5e-07
WP_071524480.1|1968423_1968609_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.4	9.9e-13
WP_065944720.1|1968592_1969537_+	conserved phage C-terminal domain-containing protein	NA	K7PLZ7	Enterobacterial_phage	81.2	6.4e-148
WP_065944721.1|1969539_1969983_+	hypothetical protein	NA	U5P0U0	Shigella_phage	31.1	4.1e-12
WP_065944722.1|1969982_1970651_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	79.6	1.2e-95
WP_003833987.1|1970637_1970856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003833984.1|1970857_1971178_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	58.7	7.7e-29
WP_065944723.1|1971174_1971543_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	64.8	7.7e-41
WP_008323291.1|1971652_1972444_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	73.1	1.0e-106
WP_065944724.1|1972451_1973441_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	71.4	2.2e-143
WP_065944725.1|1973455_1974034_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	55.6	2.7e-48
WP_065944726.1|1974170_1974920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008323296.1|1975076_1975472_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	81.7	2.6e-50
WP_008323297.1|1975458_1975740_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	88.2	4.2e-39
WP_065944727.1|1975739_1976357_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	72.2	3.4e-81
WP_065944728.1|1976364_1976634_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	70.1	1.0e-21
WP_065944729.1|1976842_1977103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944730.1|1977298_1977514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048217952.1|1977501_1977852_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	80.2	2.7e-51
WP_065944731.1|1978008_1978482_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	88.5	1.0e-77
WP_065944732.1|1978481_1980239_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	89.4	0.0e+00
WP_008323320.1|1980249_1980435_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	57.6	2.9e-12
WP_065944733.1|1980434_1981664_+|portal	phage portal protein	portal	U5P411	Shigella_phage	83.2	1.5e-205
WP_016150486.1|1981650_1982304_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	85.5	2.3e-104
WP_058671170.1|1982317_1983526_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	82.7	1.4e-187
WP_065944734.1|1983564_1983825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065944735.1|1983821_1984145_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.0	8.6e-20
WP_065944736.1|1984491_1984941_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	86.6	2.2e-66
WP_065944737.1|1984937_1985285_+	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	76.5	1.7e-45
WP_065944738.1|1985342_1986047_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	73.1	7.0e-91
WP_038642092.1|1986074_1986446_+|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	86.0	7.2e-55
WP_071891825.1|1986457_1986748_+	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	89.6	1.3e-40
WP_038642089.1|1986806_1986986_+	hypothetical protein	NA	K7PH36	Enterobacterial_phage	84.7	6.2e-20
WP_065945139.1|1987031_1990316_+|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	69.1	0.0e+00
WP_016150474.1|1990357_1990717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003841703.1|1990705_1990930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003841701.1|1991095_1991689_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	96.4	5.3e-108
WP_003841700.1|1991688_1992273_+	hypothetical protein	NA	S4TND4	Salmonella_phage	96.4	1.0e-103
WP_065944739.1|1992279_1992678_+	hypothetical protein	NA	S4TR39	Salmonella_phage	93.2	8.5e-70
WP_065944740.1|1992677_1995398_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	92.2	0.0e+00
WP_048217927.1|1995397_1996342_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	68.0	8.7e-121
WP_065944741.1|1996351_1997677_+	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	50.1	4.5e-107
1997424:1997438	attL	AAGTTACCCCTGATG	NA	NA	NA	NA
WP_003840850.1|1997812_1998055_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
WP_065944743.1|1998375_1998765_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	71.3	3.0e-51
WP_065944744.1|1999247_1999988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063856247.1|2000068_2001286_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_065945140.1|2001703_2002018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000045627.1|2002043_2002577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065944745.1|2002649_2003084_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_065944746.1|2003693_2004512_-	DUF726 domain-containing protein	NA	NA	NA	NA	NA
WP_040090352.1|2004573_2005476_-	WYL domain-containing transcriptional regulator	NA	A0A0R6PH67	Moraxella_phage	31.9	5.7e-37
WP_000280683.1|2005855_2006182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065944747.1|2006230_2008831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256735.1|2008881_2009520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000281555.1|2009509_2009710_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032636140.1|2009852_2010989_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	27.6	2.0e-15
2012535:2012549	attR	AAGTTACCCCTGATG	NA	NA	NA	NA
>prophage 9
NZ_CP016762	Citrobacter freundii strain B38 chromosome, complete genome	5134500	2075669	2205569	5134500	integrase,head,tRNA,tail,portal,holin,terminase,capsid,coat	Enterobacteria_phage(32.77%)	166	2086188:2086244	2166630:2166686
WP_003034673.1|2075669_2077403_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	1.7e-85
WP_003034677.1|2077641_2078208_+	VOC family protein	NA	NA	NA	NA	NA
WP_061548920.1|2078210_2078957_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_003839177.1|2079200_2080169_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003034686.1|2080165_2080909_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.3	3.2e-25
WP_003034689.1|2080949_2081345_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_065944756.1|2081397_2082171_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	78.7	1.6e-56
WP_065944757.1|2082149_2083463_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	89.4	1.3e-234
WP_065944758.1|2083521_2083758_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	92.3	2.1e-39
WP_065944759.1|2083795_2084368_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	81.1	1.1e-91
WP_053390038.1|2084389_2084644_-	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	54.4	4.1e-17
WP_065944760.1|2085452_2085755_-	hypothetical protein	NA	E7C9R6	Salmonella_phage	82.5	1.4e-11
WP_156484524.1|2085751_2085913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081309860.1|2085909_2086446_-	hypothetical protein	NA	Q9MCR3	Enterobacteria_phage	37.9	1.5e-08
2086188:2086244	attL	CCGCCAGCTCCCTGCACTTGCTCTCGGCGTTAGCGAGCTGTACTGCCATGTCTGTGA	NA	NA	NA	NA
WP_065944762.1|2086609_2087149_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	79.9	8.8e-78
WP_065944763.1|2087277_2088105_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	90.5	3.6e-139
WP_001515608.1|2088161_2088533_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	92.7	1.1e-58
WP_048220745.1|2089511_2090393_+	BRCT domain-containing protein	NA	U3PB51	Vibrio_phage	29.8	1.5e-34
WP_048220746.1|2090384_2091071_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	42.0	2.3e-38
WP_044702968.1|2091207_2091450_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071828988.1|2092203_2092389_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	2.4e-14
WP_065944765.1|2093394_2094291_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.9	7.9e-164
WP_065944766.1|2094283_2096218_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.6	2.3e-200
WP_065944767.1|2096214_2096601_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	88.4	1.2e-60
WP_065944768.1|2096614_2097298_+	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	60.4	6.0e-63
WP_065944769.1|2097294_2098290_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	69.6	8.5e-143
WP_065944770.1|2098306_2099137_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	46.1	4.6e-57
WP_065944771.1|2099324_2099564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065944772.1|2099730_2100066_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	57.0	1.6e-29
WP_065944773.1|2100075_2100693_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	80.4	5.0e-93
WP_065944774.1|2100689_2101226_+	DUF2514 domain-containing protein	NA	A0A0A0P0G7	Enterobacteria_phage	49.4	1.4e-06
WP_065944775.1|2101222_2101672_+	hypothetical protein	NA	G8C7T5	Escherichia_phage	71.1	2.7e-56
WP_065944776.1|2101731_2101929_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	90.8	3.7e-26
WP_081309861.1|2101975_2102233_+	hypothetical protein	NA	K7PKT0	Enterobacteria_phage	65.4	1.6e-24
WP_065944778.1|2102292_2102502_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	88.1	2.9e-29
WP_158513307.1|2102657_2102834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065944779.1|2102847_2103564_+	Fur-regulated protein	NA	M9NZE9	Enterobacteria_phage	83.1	6.6e-105
WP_000453624.1|2103814_2104360_+|terminase	terminase small subunit	terminase	E4WL18	Enterobacteria_phage	100.0	1.2e-95
WP_065944780.1|2104334_2106257_+|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	97.5	0.0e+00
WP_003034782.1|2106256_2106463_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	95.5	3.2e-28
WP_003826190.1|2106459_2108052_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	92.1	9.7e-290
WP_065944781.1|2108032_2109370_+	S49 family peptidase	NA	O64320	Escherichia_phage	83.4	2.4e-188
WP_003826193.1|2109379_2109712_+|head	head decoration protein	head	E4WL24	Enterobacteria_phage	82.7	5.0e-47
WP_003034798.1|2109779_2110805_+|capsid	major capsid protein	capsid	K7PGW9	Enterobacteria_phage	92.7	1.9e-182
WP_048231661.1|2110850_2111255_+	DNA-packaging protein	NA	K7PM13	Enterobacteria_phage	53.7	2.1e-23
WP_048231663.1|2111266_2111620_+|tail	tail attachment protein	tail	K7P6U9	Enterobacteria_phage	76.1	9.0e-47
WP_048231665.1|2111629_2112184_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	91.4	2.1e-74
WP_003826202.1|2112180_2112579_+|tail	tail protein	tail	K7P7G5	Enterobacteria_phage	82.6	1.2e-60
WP_048216152.1|2112586_2113324_+|tail	phage tail protein	tail	O64327	Escherichia_phage	62.9	9.6e-83
WP_003034815.1|2113360_2113768_+|tail	phage minor tail protein G	tail	K7PM17	Enterobacteria_phage	57.9	2.9e-25
WP_071701019.1|2113776_2114097_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	69.8	2.7e-34
WP_065944783.1|2114074_2116591_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	70.2	0.0e+00
WP_065944784.1|2116594_2116942_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	68.7	1.2e-38
WP_065944785.1|2116938_2117694_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	84.5	9.4e-126
WP_065944786.1|2117695_2118406_+	C40 family peptidase	NA	K7PJV6	Enterobacteria_phage	97.0	5.5e-144
WP_065944787.1|2118570_2119080_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	74.3	9.3e-69
WP_024262609.1|2119168_2119582_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	65.0	1.4e-51
WP_065944788.1|2119640_2120231_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	85.7	1.0e-90
WP_065944789.1|2120284_2123470_+	host specificity protein J	NA	O64335	Escherichia_phage	87.5	0.0e+00
WP_065944790.1|2123469_2123784_+	hypothetical protein	NA	O64336	Escherichia_phage	58.7	2.7e-26
WP_065944791.1|2123784_2124459_+	hypothetical protein	NA	O64337	Escherichia_phage	52.9	2.0e-55
WP_048217926.1|2124865_2126191_+	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	51.1	1.1e-108
WP_003840850.1|2126325_2126568_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
WP_024199385.1|2126646_2127036_+	DNA polymerase V	NA	Q1MVE7	Enterobacteria_phage	72.1	3.9e-51
WP_003841685.1|2127637_2128204_-	hydrolase	NA	NA	NA	NA	NA
WP_065944792.1|2128492_2130265_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003844155.1|2130266_2130710_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003034865.1|2130738_2131482_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003034867.1|2131516_2132038_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003034869.1|2132118_2132730_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003841680.1|2132738_2133749_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
WP_003034874.1|2133827_2134613_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_003034877.1|2134609_2135365_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	6.5e-18
WP_061548929.1|2135443_2136388_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_071891834.1|2136403_2137723_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
WP_061548922.1|2137842_2138814_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_003034890.1|2138857_2140300_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_003034893.1|2140418_2141288_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003034896.1|2141655_2143131_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	8.3e-78
WP_003841668.1|2143364_2145176_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_003034901.1|2145210_2145852_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_057101948.1|2145919_2147098_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_003034906.1|2147229_2147520_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_003034909.1|2147641_2147995_+	protein YebF	NA	NA	NA	NA	NA
WP_061548923.1|2148089_2148749_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_180967061.1|2148835_2150890_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_065944793.1|2150880_2151543_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	32.4	7.0e-08
WP_061548925.1|2151566_2152223_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003034925.1|2152329_2152560_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
WP_003034928.1|2152703_2153078_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_061548926.1|2153081_2153954_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_003833793.1|2153974_2154313_+	YebY family protein	NA	NA	NA	NA	NA
WP_065944794.1|2154649_2155735_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	69.0	7.3e-148
WP_071891838.1|2155703_2155976_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	63.3	3.2e-28
WP_065944795.1|2156040_2156283_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	90.0	2.7e-34
WP_003841645.1|2156269_2156473_-	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	66.7	1.7e-10
WP_065944796.1|2156465_2156810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944797.1|2156844_2157885_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	76.5	1.8e-156
WP_065944798.1|2157899_2160725_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7P6V4	Enterobacteria_phage	59.3	4.1e-283
WP_061360104.1|2160864_2161026_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	96.2	1.8e-23
WP_001568763.1|2161037_2161244_-	hypothetical protein	NA	K7PM31	Enterobacteria_phage	100.0	1.5e-33
WP_019076927.1|2161571_2161796_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	64.7	1.2e-15
WP_065554613.1|2161826_2162588_-	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	46.3	8.5e-10
WP_145924165.1|2162656_2163379_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	53.8	1.4e-70
WP_019076923.1|2163447_2163675_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	56.3	2.4e-16
WP_065944800.1|2163706_2164246_+	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	86.0	1.9e-80
WP_016156235.1|2164413_2165361_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	30.7	3.8e-23
WP_065944801.1|2165363_2166113_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	87.1	2.5e-123
WP_065944802.1|2166131_2166443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065945142.1|2166859_2167105_+	hypothetical protein	NA	B8K1D2	Salmonella_phage	74.1	7.9e-18
2166630:2166686	attR	TCACAGACATGGCAGTACAGCTCGCTAACGCCGAGAGCAAGTGCAGGGAGCTGGCGG	NA	NA	NA	NA
WP_181510957.1|2167129_2167285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065944804.1|2167571_2168012_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	87.2	3.7e-42
WP_065945143.1|2168130_2168547_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_065944805.1|2168525_2168930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065944806.1|2169020_2169278_+	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	81.3	3.2e-25
WP_065944807.1|2169630_2170230_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	95.5	7.2e-105
WP_065944808.1|2170229_2170436_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	67.6	4.5e-22
WP_065944809.1|2170438_2171047_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.2	1.2e-46
WP_145924166.1|2171043_2171175_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	90.9	1.5e-10
WP_065944810.1|2171171_2171861_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	1.9e-64
WP_019076556.1|2172016_2172532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568784.1|2172688_2172967_+|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
WP_065944811.1|2172938_2173487_+	lysozyme	NA	K7PM52	Enterobacteria_phage	94.5	4.1e-99
WP_065944812.1|2173465_2174017_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_071891841.1|2174020_2174236_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_168927631.1|2174214_2174385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054528475.1|2174503_2174728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065944813.1|2174819_2175818_+|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	43.9	1.8e-39
WP_065944814.1|2175795_2177100_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.3	1.3e-146
WP_065944815.1|2177104_2178508_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	90.7	5.4e-244
WP_065944816.1|2178509_2179616_+	hypothetical protein	NA	G8C7P5	Escherichia_phage	90.8	3.2e-191
WP_158513308.1|2179618_2179762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065944817.1|2179887_2180640_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	79.2	2.4e-105
WP_065944818.1|2180656_2181793_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	87.0	2.1e-182
WP_065944819.1|2181832_2182090_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	56.5	6.0e-16
WP_065944820.1|2182092_2182575_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	85.0	1.1e-76
WP_065944821.1|2182689_2183043_+	hypothetical protein	NA	G8C7Q0	Escherichia_phage	93.2	4.5e-54
WP_065944822.1|2183045_2183645_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	86.4	9.5e-97
WP_065944823.1|2183634_2184084_+	DUF4128 domain-containing protein	NA	G8C7Q2	Escherichia_phage	92.6	5.8e-75
WP_065944824.1|2184130_2185063_+	immunoglobulin domain-containing protein	NA	G8C7Q3	Escherichia_phage	91.3	4.1e-155
WP_065944825.1|2185104_2185443_+	hypothetical protein	NA	G8C7Q5	Escherichia_phage	92.0	2.1e-53
WP_065944826.1|2185460_2185748_+	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	66.2	2.2e-19
WP_065944827.1|2185747_2188789_+|tail	phage tail tape measure protein	tail	G8C7Q6	Escherichia_phage	53.0	2.9e-242
WP_065944828.1|2188788_2189013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065944829.1|2189044_2189458_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	42.6	4.5e-21
WP_065944830.1|2189494_2189797_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_114141104.1|2189886_2190054_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_081309863.1|2190090_2190972_+	hypothetical protein	NA	I6S627	Salmonella_phage	48.0	1.7e-70
WP_158513309.1|2191051_2191228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065944832.1|2191571_2191922_+|tail	phage tail protein	tail	G8C7R0	Escherichia_phage	90.5	1.5e-54
WP_065944833.1|2191930_2192704_+|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	90.2	3.0e-135
WP_065944834.1|2192716_2193448_+	C40 family peptidase	NA	G8C7R2	Escherichia_phage	91.8	1.3e-143
WP_038641010.1|2193435_2194035_+|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	92.0	2.5e-97
WP_065944835.1|2194090_2197300_+	host specificity protein J	NA	G8C7R4	Escherichia_phage	84.7	0.0e+00
WP_065944836.1|2197299_2197614_+	hypothetical protein	NA	O64336	Escherichia_phage	57.8	1.0e-25
WP_065944837.1|2197614_2198289_+	hypothetical protein	NA	O64337	Escherichia_phage	52.0	2.0e-55
WP_071891844.1|2198397_2198637_+	cor protein	NA	Q5G8V7	Enterobacteria_phage	59.7	1.6e-18
WP_048217926.1|2198695_2200021_+	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	51.1	1.1e-108
WP_065944838.1|2200155_2200398_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	2.0e-29
WP_065944839.1|2200475_2200895_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.3	1.4e-33
WP_065944840.1|2200896_2202165_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	79.6	7.9e-202
WP_065944841.1|2202211_2202691_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_065944842.1|2202693_2202987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944843.1|2202983_2203589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944844.1|2203803_2204445_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.3	2.4e-74
WP_061548927.1|2204927_2205569_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.0	4.3e-55
>prophage 10
NZ_CP016762	Citrobacter freundii strain B38 chromosome, complete genome	5134500	2870547	2974898	5134500	integrase,head,tRNA,lysis,tail,holin,terminase,coat	Cronobacter_phage(28.57%)	141	2929440:2929499	2974899:2975101
WP_061550013.1|2870547_2871327_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.7	1.0e-10
WP_044699989.1|2871323_2872766_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	4.5e-52
WP_003836643.1|2872827_2873541_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003836644.1|2873857_2874322_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_003030567.1|2874399_2875149_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_049014469.1|2875148_2875700_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003832584.1|2875760_2876741_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
WP_003030571.1|2876894_2877194_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_003030574.1|2877198_2879586_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003832580.1|2879601_2880585_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2880784_2880829_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_003030578.1|2880955_2881312_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003030583.1|2881367_2881565_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_048997935.1|2881661_2882204_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
WP_003832572.1|2882207_2884136_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	4.4e-127
WP_065945152.1|2884553_2886479_+	acyltransferase	NA	C6ZR20	Salmonella_phage	38.5	1.0e-59
WP_065944889.1|2888744_2891222_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	86.8	0.0e+00
WP_065944890.1|2891208_2891625_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	86.8	2.9e-68
WP_065944891.1|2892058_2892556_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	85.5	1.7e-83
WP_065944892.1|2892555_2895486_-|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	45.2	4.4e-147
WP_065944893.1|2895498_2896170_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	48.2	5.0e-54
WP_065944894.1|2896227_2896971_-	Ig-like domain-containing protein	NA	F1C5E5	Cronobacter_phage	84.8	4.2e-70
WP_081309866.1|2897044_2897608_-	HNH endonuclease	NA	A0A2I7S6L5	Vibrio_phage	38.3	5.5e-30
WP_032608745.1|2897706_2898090_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	64.6	2.3e-40
WP_065944895.1|2898086_2898527_-	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	51.1	3.0e-31
WP_065944896.1|2898529_2898880_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	66.1	1.2e-38
WP_065944897.1|2898890_2899208_-	hypothetical protein	NA	G8GWD9	Rhodobacter_phage	66.3	2.1e-31
WP_065944898.1|2899204_2899375_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_065944899.1|2899371_2899650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045332661.1|2899649_2900030_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	5.3e-29
WP_065944900.1|2900032_2900398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944901.1|2900407_2901505_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	77.4	5.0e-160
WP_017693196.1|2901515_2901950_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	72.2	1.4e-49
WP_065944902.1|2901953_2903342_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.2	1.3e-152
WP_017693194.1|2903354_2903537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017693193.1|2903606_2904089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944903.1|2904146_2905142_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.0	1.6e-112
WP_065945154.1|2905068_2906526_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	60.4	2.0e-156
WP_065944904.1|2906554_2908117_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	93.1	4.0e-304
WP_065944905.1|2908113_2908764_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	91.2	5.1e-104
WP_065944906.1|2908767_2908974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944907.1|2908970_2909189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944908.1|2909324_2909627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944909.1|2909687_2910149_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	59.2	2.4e-39
WP_065945155.1|2910145_2910622_-	glycoside hydrolase family 104 protein	NA	A5VW81	Enterobacteria_phage	89.7	1.6e-75
WP_048220920.1|2910608_2910929_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	74.0	4.5e-37
WP_158513312.1|2911009_2911180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944910.1|2911602_2912286_-	DUF1133 family protein	NA	Q8HA89	Salmonella_phage	42.7	7.9e-39
WP_065944911.1|2912282_2912870_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	58.8	1.9e-49
WP_065944912.1|2912862_2913312_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.9	2.9e-34
WP_193407058.1|2913728_2914196_-	DUF551 domain-containing protein	NA	G5DA83	Enterobacteria_phage	65.4	1.3e-32
WP_065944914.1|2914544_2914733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944915.1|2914734_2915331_-	ead/Ea22-like family protein	NA	K7P881	Enterobacteria_phage	39.6	4.6e-27
WP_156484524.1|2915327_2915489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944918.1|2916383_2916683_-	hypothetical protein	NA	E7EKU6	Edwardsiella_phage	44.9	5.7e-10
WP_065944919.1|2916679_2917087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944920.1|2917088_2917778_-	phage replication protein	NA	G8C7U6	Escherichia_phage	87.8	5.6e-117
WP_065944921.1|2918503_2919211_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_065944922.1|2919243_2919546_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	63.9	8.3e-25
WP_065944923.1|2919670_2919886_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	81.7	1.3e-27
WP_145924171.1|2919962_2920658_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	83.1	1.7e-113
WP_065944924.1|2920876_2921224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193407059.1|2921519_2921726_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	5.1e-18
WP_065944926.1|2922137_2922461_+	antitermination protein	NA	A4KWR8	Enterobacteria_phage	70.8	2.3e-33
WP_065944927.1|2922481_2923219_+	hypothetical protein	NA	V5URU3	Shigella_phage	58.0	4.9e-71
WP_164091700.1|2923259_2923421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065944928.1|2923466_2923691_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_065944930.1|2924056_2924191_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	67.4	4.3e-10
WP_065944932.1|2924656_2925283_+	ERF family protein	NA	A0A1W6JP21	Morganella_phage	61.3	2.9e-64
WP_065944933.1|2925283_2925757_+	single-stranded DNA-binding protein	NA	A0A2H4JHK3	uncultured_Caudovirales_phage	78.6	1.1e-42
WP_065944934.1|2925770_2926055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065944935.1|2926047_2926599_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	58.9	2.0e-56
WP_057101640.1|2926595_2926814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065944936.1|2926911_2927133_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	47.1	8.5e-11
WP_061351770.1|2927132_2927480_+	hypothetical protein	NA	G8C7S4	Escherichia_phage	94.8	2.0e-59
WP_048220889.1|2927457_2927697_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	73.1	1.1e-27
WP_071891867.1|2927706_2927931_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_065944937.1|2928036_2928273_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	53.7	3.3e-13
WP_065944938.1|2928230_2929439_-|integrase	site-specific integrase	integrase	I6R9B6	Salmonella_phage	76.7	1.5e-181
2929440:2929499	attL	GCTTGTCCCTGTTGAACTTTGTCGGAATTGGTACACGATTTGGTACACAGATTCTACGAC	NA	NA	NA	NA
WP_065945152.1|2930008_2931934_+	acyltransferase	NA	C6ZR20	Salmonella_phage	38.5	1.0e-59
WP_065944890.1|2936666_2937083_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	86.8	2.9e-68
WP_065944940.1|2937045_2937516_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.9	7.0e-79
WP_065944941.1|2937515_2938013_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	87.3	1.8e-85
WP_065944892.1|2938012_2940943_-|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	45.2	4.4e-147
WP_065944893.1|2940955_2941627_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	48.2	5.0e-54
WP_065944894.1|2941684_2942428_-	Ig-like domain-containing protein	NA	F1C5E5	Cronobacter_phage	84.8	4.2e-70
WP_081309866.1|2942501_2943065_-	HNH endonuclease	NA	A0A2I7S6L5	Vibrio_phage	38.3	5.5e-30
WP_032608745.1|2943163_2943547_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	64.6	2.3e-40
WP_065944895.1|2943543_2943984_-	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	51.1	3.0e-31
WP_065944896.1|2943986_2944337_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	66.1	1.2e-38
WP_065944897.1|2944347_2944665_-	hypothetical protein	NA	G8GWD9	Rhodobacter_phage	66.3	2.1e-31
WP_065944898.1|2944661_2944832_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_065944899.1|2944828_2945107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045332661.1|2945106_2945487_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	5.3e-29
WP_065944900.1|2945489_2945855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944901.1|2945864_2946962_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	77.4	5.0e-160
WP_017693196.1|2946972_2947407_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	72.2	1.4e-49
WP_065944902.1|2947410_2948799_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.2	1.3e-152
WP_017693194.1|2948811_2948994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017693193.1|2949063_2949546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944903.1|2949603_2950599_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.0	1.6e-112
WP_065945154.1|2950525_2951983_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	60.4	2.0e-156
WP_065944904.1|2952011_2953574_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	93.1	4.0e-304
WP_065944905.1|2953570_2954221_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	91.2	5.1e-104
WP_065944906.1|2954224_2954431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944907.1|2954427_2954646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944908.1|2954781_2955084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944909.1|2955144_2955606_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	59.2	2.4e-39
WP_065945155.1|2955602_2956079_-	glycoside hydrolase family 104 protein	NA	A5VW81	Enterobacteria_phage	89.7	1.6e-75
WP_048220920.1|2956065_2956386_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	74.0	4.5e-37
WP_158513312.1|2956466_2956637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944910.1|2957059_2957743_-	DUF1133 family protein	NA	Q8HA89	Salmonella_phage	42.7	7.9e-39
WP_065944911.1|2957739_2958327_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	58.8	1.9e-49
WP_065944912.1|2958319_2958769_-	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.9	2.9e-34
WP_193407058.1|2959185_2959653_-	DUF551 domain-containing protein	NA	G5DA83	Enterobacteria_phage	65.4	1.3e-32
WP_065944914.1|2960001_2960190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944915.1|2960191_2960788_-	ead/Ea22-like family protein	NA	K7P881	Enterobacteria_phage	39.6	4.6e-27
WP_156484524.1|2960784_2960946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944918.1|2961840_2962140_-	hypothetical protein	NA	E7EKU6	Edwardsiella_phage	44.9	5.7e-10
WP_065944919.1|2962136_2962544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065944920.1|2962545_2963235_-	phage replication protein	NA	G8C7U6	Escherichia_phage	87.8	5.6e-117
WP_065944921.1|2963960_2964668_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_065944922.1|2964700_2965003_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	63.9	8.3e-25
WP_065944923.1|2965127_2965343_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	81.7	1.3e-27
WP_145924171.1|2965419_2966115_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	83.1	1.7e-113
WP_065944924.1|2966333_2966681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193407059.1|2966976_2967183_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	5.1e-18
WP_065944926.1|2967594_2967918_+	antitermination protein	NA	A4KWR8	Enterobacteria_phage	70.8	2.3e-33
WP_065944927.1|2967938_2968676_+	hypothetical protein	NA	V5URU3	Shigella_phage	58.0	4.9e-71
WP_164091700.1|2968716_2968878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065944928.1|2968923_2969148_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_065944930.1|2969513_2969648_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	67.4	4.3e-10
WP_065944932.1|2970114_2970741_+	ERF family protein	NA	A0A1W6JP21	Morganella_phage	61.3	2.9e-64
WP_065944935.1|2971506_2972058_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	58.9	2.0e-56
WP_057101640.1|2972054_2972273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065944936.1|2972370_2972592_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	47.1	8.5e-11
WP_061351770.1|2972591_2972939_+	hypothetical protein	NA	G8C7S4	Escherichia_phage	94.8	2.0e-59
WP_048220889.1|2972916_2973156_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	73.1	1.1e-27
WP_071891867.1|2973165_2973390_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_065944937.1|2973495_2973732_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	53.7	3.3e-13
WP_065944938.1|2973689_2974898_-|integrase	site-specific integrase	integrase	I6R9B6	Salmonella_phage	76.7	1.5e-181
2974899:2975101	attR	GCTTGTCCCTGTTGAACTTTGTCGGAATTGGTACACGATTTGGTACACAGATTCTACGACACGAACGCGGACAACATGAACTAAATTGAAACGGGTAAATTGAATAAAGTTAGGTGTGATGCGGAATTGTTGAAACAGGTAGGAACAGACATGAATGAGGTGAAATTCTGGATGGTACTTACACGTAAGATCACATACAAAGA	NA	NA	NA	NA
>prophage 11
NZ_CP016762	Citrobacter freundii strain B38 chromosome, complete genome	5134500	3065946	3074425	5134500	transposase	uncultured_Caudovirales_phage(40.0%)	11	NA	NA
WP_072324104.1|3065946_3066159_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	2.1e-22
WP_003030760.1|3066402_3066828_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
WP_061549975.1|3066840_3068130_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.2	9.3e-166
WP_003030762.1|3068174_3068495_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
WP_061549503.1|3068580_3069279_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.7	3.8e-89
WP_049269458.1|3069666_3069909_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	1.3e-28
WP_061549504.1|3070083_3070593_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_065944944.1|3070668_3072207_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	91.2	1.9e-274
WP_040115192.1|3072256_3072604_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	5.3e-60
WP_015060490.1|3072600_3072978_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	91.3	2.7e-57
WP_003030769.1|3073174_3074425_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	9.4e-22
>prophage 1
NZ_CP016763	Citrobacter freundii strain B38 plasmid pOZ172, complete sequence	127005	60557	89826	127005	transposase,integrase	Macacine_betaherpesvirus(25.0%)	22	78482:78496	89977:89991
WP_065945178.1|60557_61778_+|transposase	ISL3-like element ISCfr12 family transposase	transposase	NA	NA	NA	NA
WP_008324207.1|61837_62260_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	2.4e-30
WP_008324209.1|62432_64661_-	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_008324210.1|64657_65839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324213.1|65975_66836_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_008324215.1|66843_67362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096147877.1|67483_68604_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_148661854.1|70243_71458_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.0	8.8e-33
WP_168927635.1|71491_72895_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_065945181.1|73242_75381_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_004118488.1|76756_77008_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_008325193.1|77061_77367_+	hypothetical protein	NA	NA	NA	NA	NA
78482:78496	attL	AACCTGACCGGCGAT	NA	NA	NA	NA
WP_004206785.1|78649_79621_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	1.0e-148
WP_000523812.1|79620_80787_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
WP_000200070.1|81537_82548_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
WP_001515717.1|83245_83986_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_022652281.1|84585_85566_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
WP_065945187.1|85575_86052_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000019450.1|86368_87349_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_000780222.1|87626_87908_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|87888_88218_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000427623.1|88821_89826_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
89977:89991	attR	ATCGCCGGTCAGGTT	NA	NA	NA	NA
>prophage 1
NZ_CP016764	Citrobacter freundii strain B38 plasmid pOZ181, complete sequence	277592	159827	261279	277592	protease,transposase,integrase	Escherichia_phage(19.23%)	91	152478:152493	247413:247429
152478:152493	attL	CTGATTTTTTCTGTTT	NA	NA	NA	NA
WP_000795949.1|159827_161003_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
152478:152493	attL	CTGATTTTTTCTGTTT	NA	NA	NA	NA
WP_001285422.1|161172_161385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232447.1|161745_162828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284315.1|162993_164493_-	kinase	NA	NA	NA	NA	NA
WP_000081059.1|164518_166156_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253656.1|166155_167196_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|167280_167919_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|167918_168560_-	TerD family protein	NA	NA	NA	NA	NA
WP_001253657.1|168582_169221_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|169683_170151_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_011152964.1|170168_171377_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_011152965.1|171387_172344_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001585166.1|172343_173423_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040058.1|173424_174198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065945224.1|174190_175333_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	5.0e-30
WP_012695441.1|175342_176401_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_000254137.1|176721_177303_+	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054786.1|177302_178460_+	TerD family protein	NA	NA	NA	NA	NA
WP_000007449.1|178482_178938_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|178960_180001_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116680.1|180049_180628_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	2.5e-06
WP_000301247.1|180696_181272_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053340.1|181700_182942_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000374058.1|183032_183488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000398479.1|183728_183920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151572.1|184011_184353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000880375.1|185333_185588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065945225.1|185590_187630_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	25.5	1.0e-25
WP_000211824.1|187626_188613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427620.1|189822_190827_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|190905_193878_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|193880_194438_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845048.1|194743_195757_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000777555.1|196252_196726_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_050563329.1|196764_197229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000503573.1|197242_198031_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|198198_198546_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|198539_199379_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|199783_201325_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000359986.1|202723_203497_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_077252464.1|203477_203759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002026779.1|203978_204164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002001451.1|204212_205397_+|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_000052512.1|205795_207271_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|207326_208211_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_004896925.1|208569_209112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|209996_210701_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
209415:209430	attR	CTGATTTTTTCTGTTT	NA	NA	NA	NA
WP_000018326.1|210954_211770_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
209415:209430	attR	CTGATTTTTTCTGTTT	NA	NA	NA	NA
WP_001067858.1|211882_212587_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000278471.1|213107_213533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224686.1|214081_214390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|214405_215263_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_001287391.1|215869_216274_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001100635.1|216451_216745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175475.1|216770_217007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000916941.1|217047_217503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|217699_218680_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_065945228.1|218780_219428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371925.1|219485_219866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|224023_224728_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000174662.1|225204_225969_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	52.4	1.9e-25
WP_000182008.1|226433_227111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001071437.1|227141_227765_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_000778342.1|228295_228991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372356.1|229166_229424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000981293.1|229450_230278_-	ParA family protein	NA	J9QE36	Clostridium_phage	27.4	2.0e-12
WP_000151478.1|230456_231392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022646501.1|232286_232616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372357.1|232793_232931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217270.1|233137_234967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000215804.1|235136_237824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065945229.1|237975_238806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085954987.1|238921_239110_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_065945230.1|240190_240904_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000699996.1|240952_241219_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_065945231.1|241520_243497_-	excinuclease ABC subunit UvrB	NA	A7WKH8	Acidianus_filamentous_virus	39.0	7.1e-08
WP_001120775.1|243783_244059_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842119.1|244117_245227_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.3	1.8e-32
WP_000070400.1|245277_245676_+	VOC family protein	NA	NA	NA	NA	NA
WP_000664785.1|245833_247168_+	DUF3422 family protein	NA	NA	NA	NA	NA
WP_000440264.1|247215_248046_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000233327.1|248063_249374_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065945232.1|249577_252229_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.8	3.6e-156
WP_000765646.1|252420_252852_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_001141269.1|253216_253492_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_022646510.1|254969_255134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000831397.1|255191_255560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000896835.1|256243_257611_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_003026030.1|257586_258255_-	response regulator	NA	NA	NA	NA	NA
WP_001805638.1|258340_259117_-	membrane protein	NA	NA	NA	NA	NA
WP_072196614.1|260310_261279_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	1.1e-184
